TB-Profiler result

Run: SRR18002941

Summary

Run ID: SRR18002941

Sample name:

Date: 2024-04-14T19:46:15.907826

Number of reads: 2085859

Percentage reads mapped: 57.16

Median coverage: 57.0

Strain: lineage2.2.1

Spoligotype:

Drug-resistance: RR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage2 East-Asian RD105 1.0
lineage2.2.1 East-Asian (Beijing) RD105;RD207;RD181 1.0
lineage2.2 East-Asian (Beijing) RD105;RD207 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.Ser441Ala Assoc w R - Interim
p.Leu464Met Mutation from literature
isoniazid
ethambutol
pyrazinamide
streptomycin rpsL p.Lys43Arg Assoc w R
rrs n.799C>T Uncertain significance Mutation from literature
n.888G>A Uncertain significance Mutation from literature
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin rrs n.1402C>A Uncertain significance Mutation from literature
n.1484G>T Assoc w R
capreomycin rrs n.1402C>A Uncertain significance Mutation from literature
n.1484G>T Assoc w R
kanamycin rrs n.1402C>A Uncertain significance Mutation from literature
n.1484G>T Assoc w R
cycloserine
ethionamide
clofazimine
para-aminosalicylic_acid
delamanid
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
rpoB 761127 p.Ser441Ala missense_variant 0.2 rifampicin Assoc w R - Interim
rpoB 761196 p.Leu464Met missense_variant 0.15 rifampicin Mutation from literature
rpsL 781687 p.Lys43Arg missense_variant 1.0 streptomycin Assoc w R
rrs 1472644 n.799C>T non_coding_transcript_exon_variant 0.33 streptomycin Uncertain significance Mutation from literature
rrs 1472733 n.888G>A non_coding_transcript_exon_variant 0.19 streptomycin Uncertain significance Mutation from literature
rrs 1473247 n.1402C>A non_coding_transcript_exon_variant 0.37 capreomycin Uncertain significance Mutation from literature
kanamycin Uncertain significance Mutation from literature
amikacin Uncertain significance Mutation from literature
rrs 1473329 n.1484G>T non_coding_transcript_exon_variant 0.26 capreomycin Assoc w R
amikacin Assoc w R
kanamycin Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
fgd1 491742 c.960T>C synonymous_variant 1.0 clofazimine Not assoc w R
pretomanid
delamanid Not assoc w R - Interim
mshA 575907 p.Ala187Val missense_variant 1.0 ethionamide Not assoc w R
isoniazid Not assoc w R
ccsA 620625 p.Ile245Met missense_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Uncertain significance
Rv0565c 657081 c.390G>A synonymous_variant 1.0 ethionamide Not assoc w R - Interim
Rv0565c 657142 p.Arg110His missense_variant 1.0 ethionamide Uncertain significance
rpoB 761096 c.1290G>C synonymous_variant 0.17 rifampicin
rpoB 761102 c.1296A>G synonymous_variant 0.17 rifampicin
rpoB 761132 c.1326G>T synonymous_variant 0.14 rifampicin Not assoc w R - Interim
rpoB 761133 c.1327T>C synonymous_variant 0.16 rifampicin Not assoc w R - Interim
rpoB 761156 c.1350G>C synonymous_variant 0.14 rifampicin
rpoB 761165 c.1359G>C synonymous_variant 0.17 rifampicin Not assoc w R - Interim
rpoB 761180 c.1374A>C synonymous_variant 0.15 rifampicin Not assoc w R - Interim
rpoB 761189 c.1383T>C synonymous_variant 0.15 rifampicin Not assoc w R - Interim
rpoB 761195 c.1389G>C synonymous_variant 0.15 rifampicin Not assoc w R - Interim
rpoB 763031 c.3225T>C synonymous_variant 1.0 rifampicin Not assoc w R
rpoC 763570 c.201G>C synonymous_variant 0.11 rifampicin Not assoc w R - Interim
rpoC 763606 c.237C>A synonymous_variant 0.14 rifampicin
rpoC 763615 c.246G>C synonymous_variant 0.14 rifampicin Not assoc w R - Interim
rpoC 763618 c.249C>T synonymous_variant 0.16 rifampicin
rpoC 763622 p.Ala85Ser missense_variant 0.16 rifampicin Uncertain significance
rpoC 763636 c.267T>C synonymous_variant 0.2 rifampicin
rpoC 763642 c.273G>C synonymous_variant 0.22 rifampicin Not assoc w R - Interim
rpoC 763647 p.Gly93Ala missense_variant 0.2 rifampicin
rpoC 763655 p.Glu96Lys missense_variant 0.18 rifampicin
rpoC 763660 c.291T>C synonymous_variant 0.18 rifampicin Not assoc w R - Interim
rpoC 763669 c.300C>G synonymous_variant 0.18 rifampicin Not assoc w R - Interim
rpoC 763696 c.327T>C synonymous_variant 0.19 rifampicin Not assoc w R - Interim
rpoC 763708 c.339G>C synonymous_variant 0.21 rifampicin
rpoC 763714 c.345G>C synonymous_variant 0.22 rifampicin Not assoc w R - Interim
rpoC 763717 c.348T>C synonymous_variant 0.2 rifampicin Not assoc w R - Interim
rpoC 763723 c.354G>C synonymous_variant 0.21 rifampicin
rpoC 763724 p.Asp119Asn missense_variant 0.21 rifampicin
rpoC 763729 c.360G>C synonymous_variant 0.21 rifampicin
rpoC 763732 c.363C>G synonymous_variant 0.22 rifampicin
rpoC 763735 c.366G>C synonymous_variant 0.21 rifampicin
rpoC 763751 p.Ile128Val missense_variant 0.15 rifampicin
rpoC 764509 c.1140G>C synonymous_variant 0.11 rifampicin Not assoc w R - Interim
rpoC 764521 c.1152T>C synonymous_variant 0.11 rifampicin Not assoc w R - Interim
rpoC 764566 c.1197C>G synonymous_variant 0.11 rifampicin Not assoc w R - Interim
rpoC 764572 c.1203G>C synonymous_variant 0.11 rifampicin
rpoC 764575 c.1206T>G synonymous_variant 0.11 rifampicin Not assoc w R - Interim
rpoC 764581 c.1212T>C synonymous_variant 0.14 rifampicin
rpoC 764582 p.Leu405Met missense_variant 0.14 rifampicin
rpoC 764605 c.1236G>C synonymous_variant 0.14 rifampicin Not assoc w R - Interim
rpoC 764611 c.1242G>C synonymous_variant 0.15 rifampicin
rpoC 764623 c.1254C>G synonymous_variant 0.11 rifampicin Not assoc w R - Interim
rpoC 764632 c.1263T>C synonymous_variant 0.15 rifampicin Not assoc w R - Interim
rpoC 764662 c.1293G>C synonymous_variant 0.12 rifampicin Not assoc w R - Interim
rpoC 764731 c.1362G>C synonymous_variant 0.12 rifampicin
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 776100 p.Thr794Ile missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpS5 779615 c.-710C>G upstream_gene_variant 1.0 clofazimine
bedaquiline
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
Rv1129c 1254562 c.-28T>C upstream_gene_variant 1.0 moxifloxacin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
Rv1258c 1406760 c.580_581insC frameshift_variant 1.0 streptomycin Uncertain significance
isoniazid Uncertain significance
pyrazinamide Uncertain significance
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472106 n.261G>A non_coding_transcript_exon_variant 0.26 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472108 n.263C>T non_coding_transcript_exon_variant 0.34 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472113 n.268T>C non_coding_transcript_exon_variant 0.23 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472123 n.278A>G non_coding_transcript_exon_variant 0.31 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472124 n.279C>T non_coding_transcript_exon_variant 0.36 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472150 n.305T>A non_coding_transcript_exon_variant 0.43 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472150 n.305T>G non_coding_transcript_exon_variant 0.33 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472151 n.306C>A non_coding_transcript_exon_variant 0.33 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472155 n.310C>T non_coding_transcript_exon_variant 0.4 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472160 n.315C>T non_coding_transcript_exon_variant 0.14 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472172 n.327T>C non_coding_transcript_exon_variant 0.57 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472251 n.406G>A non_coding_transcript_exon_variant 0.63 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472258 n.413A>G non_coding_transcript_exon_variant 0.28 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472259 n.414C>A non_coding_transcript_exon_variant 0.32 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472513 n.668T>C non_coding_transcript_exon_variant 0.33 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472537 n.692C>T non_coding_transcript_exon_variant 0.29 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472544 n.699C>A non_coding_transcript_exon_variant 0.22 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472545 n.700A>T non_coding_transcript_exon_variant 0.23 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472549 n.704G>A non_coding_transcript_exon_variant 0.37 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472558 n.713G>A non_coding_transcript_exon_variant 0.35 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472569 n.724G>A non_coding_transcript_exon_variant 0.35 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472581 n.736A>C non_coding_transcript_exon_variant 0.3 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472581 n.736A>T non_coding_transcript_exon_variant 0.57 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472584 n.739A>T non_coding_transcript_exon_variant 0.29 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472597 n.752G>A non_coding_transcript_exon_variant 0.37 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472598 n.753A>C non_coding_transcript_exon_variant 0.23 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472599 n.754G>T non_coding_transcript_exon_variant 0.21 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472607 n.762G>A non_coding_transcript_exon_variant 0.36 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472616 n.771G>A non_coding_transcript_exon_variant 0.28 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472647 n.802C>T non_coding_transcript_exon_variant 0.16 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472655 n.810G>A non_coding_transcript_exon_variant 0.25 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472655 n.810G>T non_coding_transcript_exon_variant 0.61 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472658 n.813G>A non_coding_transcript_exon_variant 0.19 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472660 n.815T>C non_coding_transcript_exon_variant 0.63 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472661 n.816A>G non_coding_transcript_exon_variant 0.19 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472690 n.845C>A non_coding_transcript_exon_variant 0.23 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472692 n.847T>C non_coding_transcript_exon_variant 0.56 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472697 n.852T>C non_coding_transcript_exon_variant 0.23 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472707 n.862A>T non_coding_transcript_exon_variant 0.13 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472713 n.868T>C non_coding_transcript_exon_variant 0.19 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472714 n.869A>G non_coding_transcript_exon_variant 0.58 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472716 n.871C>T non_coding_transcript_exon_variant 0.2 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472755 n.910G>A non_coding_transcript_exon_variant 0.19 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472952 n.1107T>C non_coding_transcript_exon_variant 0.33 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472955 n.1110C>T non_coding_transcript_exon_variant 0.24 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472956 n.1111T>C non_coding_transcript_exon_variant 0.53 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472957 n.1112C>T non_coding_transcript_exon_variant 0.3 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472958 n.1113A>G non_coding_transcript_exon_variant 0.28 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472973 n.1128A>T non_coding_transcript_exon_variant 0.59 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472974 n.1129A>G non_coding_transcript_exon_variant 0.33 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472987 n.1142G>A non_coding_transcript_exon_variant 0.19 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472988 n.1143T>C non_coding_transcript_exon_variant 0.37 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472989 n.1144G>A non_coding_transcript_exon_variant 0.23 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472990 n.1145A>G non_coding_transcript_exon_variant 0.6 streptomycin Uncertain significance
kanamycin Not assoc w R
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473035 n.1190G>A non_coding_transcript_exon_variant 0.72 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1473055 n.1210C>T non_coding_transcript_exon_variant 0.67 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473056 n.1211A>T non_coding_transcript_exon_variant 0.72 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1473066 n.1221A>G non_coding_transcript_exon_variant 0.77 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473088 n.1243A>G non_coding_transcript_exon_variant 0.73 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473093 n.1248C>T non_coding_transcript_exon_variant 0.45 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473100 n.1255G>A non_coding_transcript_exon_variant 0.75 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473102 n.1257C>T non_coding_transcript_exon_variant 0.42 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473104 n.1259C>T non_coding_transcript_exon_variant 0.76 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473110 n.1265T>G non_coding_transcript_exon_variant 0.75 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473111 n.1266A>G non_coding_transcript_exon_variant 0.79 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473115 n.1270G>T non_coding_transcript_exon_variant 0.34 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473121 n.1276T>C non_coding_transcript_exon_variant 0.75 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473123 n.1278A>T non_coding_transcript_exon_variant 0.42 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473145 n.1300C>T non_coding_transcript_exon_variant 0.46 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473148 n.1303G>T non_coding_transcript_exon_variant 0.33 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473163 n.1318C>A non_coding_transcript_exon_variant 0.37 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473166 n.1321G>A non_coding_transcript_exon_variant 0.39 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473173 n.1328C>T non_coding_transcript_exon_variant 0.41 streptomycin Not assoc w R
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473221 n.1376C>T non_coding_transcript_exon_variant 0.42 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473252 n.1407T>C non_coding_transcript_exon_variant 0.41 streptomycin Uncertain significance
kanamycin Not assoc w R
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473259 n.1414C>T non_coding_transcript_exon_variant 0.42 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1473262 n.1417T>C non_coding_transcript_exon_variant 0.22 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473270 n.1425G>A non_coding_transcript_exon_variant 0.24 streptomycin
kanamycin Uncertain significance
capreomycin
amikacin Uncertain significance
rrs 1473276 n.1431A>G non_coding_transcript_exon_variant 0.52 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473290 n.1445delCinsTTTT non_coding_transcript_exon_variant 0.37 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473301 n.1456T>C non_coding_transcript_exon_variant 0.39 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473305 n.1460G>T non_coding_transcript_exon_variant 0.31 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473314 n.1469A>G non_coding_transcript_exon_variant 0.12 streptomycin Uncertain significance
kanamycin
capreomycin
amikacin
rrs 1473316 n.1471C>T non_coding_transcript_exon_variant 0.46 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrl 1474249 n.592G>T non_coding_transcript_exon_variant 0.62 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474269 n.612C>T non_coding_transcript_exon_variant 0.5 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474351 n.694G>T non_coding_transcript_exon_variant 0.69 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474353 n.696A>G non_coding_transcript_exon_variant 0.52 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474355 n.698A>G non_coding_transcript_exon_variant 0.41 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474362 n.705A>G non_coding_transcript_exon_variant 0.71 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474387 n.730C>T non_coding_transcript_exon_variant 0.64 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474393 n.736A>G non_coding_transcript_exon_variant 0.52 capreomycin
linezolid
rrl 1474402 n.745T>C non_coding_transcript_exon_variant 0.57 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474414 n.757_778delCCCACACGCGCATACGCGCGTGinsT non_coding_transcript_exon_variant 0.62 capreomycin
linezolid
rrl 1474448 n.791T>C non_coding_transcript_exon_variant 0.62 capreomycin Uncertain significance
linezolid
rrl 1474467 n.810A>G non_coding_transcript_exon_variant 0.58 capreomycin
linezolid
rrl 1474488 n.831G>T non_coding_transcript_exon_variant 0.74 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474495 n.838G>A non_coding_transcript_exon_variant 0.59 capreomycin
linezolid
rrl 1474498 n.841G>T non_coding_transcript_exon_variant 0.5 capreomycin
linezolid
rrl 1474505 n.848C>G non_coding_transcript_exon_variant 0.48 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474508 n.851C>T non_coding_transcript_exon_variant 0.55 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474516 n.859C>A non_coding_transcript_exon_variant 0.77 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474527 n.870T>C non_coding_transcript_exon_variant 0.56 capreomycin
linezolid
rrl 1474529 n.872A>C non_coding_transcript_exon_variant 0.26 capreomycin
linezolid
rrl 1474530 n.873G>A non_coding_transcript_exon_variant 0.24 capreomycin
linezolid
rrl 1474537 n.880G>A non_coding_transcript_exon_variant 0.78 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474539 n.882C>T non_coding_transcript_exon_variant 0.26 capreomycin
linezolid
rrl 1474540 n.883T>G non_coding_transcript_exon_variant 0.28 capreomycin
linezolid
rrl 1474542 n.885A>G non_coding_transcript_exon_variant 0.53 capreomycin
linezolid
rrl 1474558 n.901G>A non_coding_transcript_exon_variant 0.26 capreomycin Uncertain significance
linezolid
rrl 1474584 n.927C>T non_coding_transcript_exon_variant 0.29 capreomycin
linezolid
rrl 1474626 n.969T>C non_coding_transcript_exon_variant 0.51 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474627 n.970G>A non_coding_transcript_exon_variant 0.31 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474632 n.975G>T non_coding_transcript_exon_variant 0.79 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474634 n.977T>G non_coding_transcript_exon_variant 0.53 capreomycin
linezolid
rrl 1474636 n.979A>C non_coding_transcript_exon_variant 0.56 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474636 n.979A>T non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid
rrl 1474637 n.980C>T non_coding_transcript_exon_variant 0.35 capreomycin Uncertain significance
linezolid
rrl 1474638 n.981C>G non_coding_transcript_exon_variant 0.85 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474639 n.982G>C non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474658 n.1001A>G non_coding_transcript_exon_variant 0.55 capreomycin
linezolid
rrl 1474663 n.1006C>T non_coding_transcript_exon_variant 0.57 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474672 n.1015C>T non_coding_transcript_exon_variant 0.22 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474673 n.1016T>C non_coding_transcript_exon_variant 0.57 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474674 n.1017A>C non_coding_transcript_exon_variant 0.24 capreomycin
linezolid
rrl 1474675 n.1018C>A non_coding_transcript_exon_variant 0.24 capreomycin
linezolid
rrl 1474676 n.1019T>A non_coding_transcript_exon_variant 0.53 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474676 n.1019T>C non_coding_transcript_exon_variant 0.22 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474677 n.1020A>G non_coding_transcript_exon_variant 0.82 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474692 n.1035G>A non_coding_transcript_exon_variant 0.53 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474694 n.1037C>T non_coding_transcript_exon_variant 0.18 capreomycin
linezolid
rrl 1474711 n.1054_1060delGGTGTAAinsCGGGTTGT non_coding_transcript_exon_variant 0.66 capreomycin
linezolid
rrl 1474723 n.1066G>A non_coding_transcript_exon_variant 0.13 capreomycin
linezolid
rrl 1474734 n.1077G>C non_coding_transcript_exon_variant 0.67 capreomycin
linezolid
rrl 1474736 n.1079C>T non_coding_transcript_exon_variant 0.13 capreomycin
linezolid
rrl 1474749 n.1092C>T non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474753 n.1096_1097delACinsG non_coding_transcript_exon_variant 0.62 capreomycin
linezolid
rrl 1474760 n.1103A>G non_coding_transcript_exon_variant 0.68 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474777 n.1120T>C non_coding_transcript_exon_variant 0.12 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1474779 n.1122G>A non_coding_transcript_exon_variant 0.25 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474780 n.1123C>T non_coding_transcript_exon_variant 0.24 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474782 n.1125G>A non_coding_transcript_exon_variant 0.25 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1474794 n.1137C>T non_coding_transcript_exon_variant 0.79 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474802 n.1145T>C non_coding_transcript_exon_variant 0.19 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474823 n.1166C>G non_coding_transcript_exon_variant 0.44 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474824 n.1167A>G non_coding_transcript_exon_variant 0.4 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474827 n.1170C>T non_coding_transcript_exon_variant 0.17 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474830 n.1173A>G non_coding_transcript_exon_variant 0.69 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474831 n.1174A>C non_coding_transcript_exon_variant 0.48 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474831 n.1174A>T non_coding_transcript_exon_variant 0.33 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474832 n.1175A>T non_coding_transcript_exon_variant 0.24 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474864 n.1207C>T non_coding_transcript_exon_variant 0.73 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1474883 n.1226T>C non_coding_transcript_exon_variant 0.28 capreomycin
linezolid
rrl 1474901 n.1244A>G non_coding_transcript_exon_variant 0.26 capreomycin
linezolid
rrl 1474903 n.1246T>C non_coding_transcript_exon_variant 0.35 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474904 n.1247G>C non_coding_transcript_exon_variant 0.48 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474913 n.1256T>C non_coding_transcript_exon_variant 0.56 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475031 n.1374G>C non_coding_transcript_exon_variant 0.57 capreomycin Uncertain significance
linezolid
rrl 1475059 n.1403_1404insTA non_coding_transcript_exon_variant 0.69 capreomycin
linezolid
rrl 1475062 n.1405A>T non_coding_transcript_exon_variant 0.69 capreomycin Uncertain significance
linezolid
rrl 1475065 n.1409_1411delCAA non_coding_transcript_exon_variant 0.69 capreomycin
linezolid
rrl 1475076 n.1419_1422delCCTTinsGCCCTA non_coding_transcript_exon_variant 0.61 capreomycin
linezolid
rrl 1475080 n.1425_1426delCC non_coding_transcript_exon_variant 0.61 capreomycin
linezolid
rrl 1475090 n.1433A>T non_coding_transcript_exon_variant 0.5 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475104 n.1447T>A non_coding_transcript_exon_variant 0.48 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475114 n.1457C>T non_coding_transcript_exon_variant 0.46 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475124 n.1467A>T non_coding_transcript_exon_variant 0.46 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475672 n.2015C>T non_coding_transcript_exon_variant 0.25 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475673 n.2016T>C non_coding_transcript_exon_variant 0.23 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475696 n.2039T>C non_coding_transcript_exon_variant 0.42 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475699 n.2042C>T non_coding_transcript_exon_variant 0.62 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475703 n.2046A>G non_coding_transcript_exon_variant 0.48 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475722 n.2065G>T non_coding_transcript_exon_variant 0.19 capreomycin
linezolid
rrl 1475751 n.2094C>A non_coding_transcript_exon_variant 0.66 capreomycin
linezolid
rrl 1475752 n.2095C>T non_coding_transcript_exon_variant 0.19 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475753 n.2096C>G non_coding_transcript_exon_variant 0.2 capreomycin Uncertain significance
linezolid
rrl 1475754 n.2097G>A non_coding_transcript_exon_variant 0.36 capreomycin
linezolid
rrl 1475756 n.2099_2107delTAACCCGCAinsCAACCCCCTCG non_coding_transcript_exon_variant 0.47 capreomycin
linezolid
rrl 1475765 n.2108A>G non_coding_transcript_exon_variant 0.41 capreomycin Uncertain significance
linezolid
rrl 1475774 n.2117C>T non_coding_transcript_exon_variant 0.36 capreomycin
linezolid
rrl 1475775 n.2118G>T non_coding_transcript_exon_variant 0.19 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475777 n.2120A>T non_coding_transcript_exon_variant 0.52 capreomycin
linezolid
rrl 1475869 n.2212C>A non_coding_transcript_exon_variant 0.26 capreomycin
linezolid
rrl 1475881 n.2224T>C non_coding_transcript_exon_variant 0.66 capreomycin
linezolid
rrl 1475883 n.2226A>C non_coding_transcript_exon_variant 0.43 capreomycin Uncertain significance
linezolid
rrl 1475883 n.2226A>T non_coding_transcript_exon_variant 0.36 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475884 n.2227A>G non_coding_transcript_exon_variant 0.42 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475898 n.2241A>G non_coding_transcript_exon_variant 0.81 capreomycin Uncertain significance
linezolid
rrl 1475899 n.2242G>A non_coding_transcript_exon_variant 0.81 capreomycin Uncertain significance
linezolid
rrl 1475900 n.2243A>G non_coding_transcript_exon_variant 0.38 capreomycin Uncertain significance
linezolid
rrl 1475906 n.2249C>T non_coding_transcript_exon_variant 0.15 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475916 n.2259C>G non_coding_transcript_exon_variant 0.85 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475937 n.2280A>T non_coding_transcript_exon_variant 0.8 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475943 n.2286G>A non_coding_transcript_exon_variant 0.87 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475945 n.2288C>A non_coding_transcript_exon_variant 0.42 capreomycin
linezolid
rrl 1475952 n.2295A>G non_coding_transcript_exon_variant 0.8 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475963 n.2306G>T non_coding_transcript_exon_variant 0.47 capreomycin
linezolid
rrl 1475970 n.2313C>T non_coding_transcript_exon_variant 0.78 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475975 n.2318C>T non_coding_transcript_exon_variant 0.63 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475977 n.2320A>G non_coding_transcript_exon_variant 0.79 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475978 n.2321C>T non_coding_transcript_exon_variant 0.61 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475988 n.2331A>G non_coding_transcript_exon_variant 0.76 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1475993 n.2336C>T non_coding_transcript_exon_variant 0.68 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475997 n.2340A>T non_coding_transcript_exon_variant 0.72 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475998 n.2341C>T non_coding_transcript_exon_variant 0.71 capreomycin
linezolid Uncertain significance
rrl 1476001 n.2344T>C non_coding_transcript_exon_variant 0.73 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476030 n.2373A>G non_coding_transcript_exon_variant 0.56 capreomycin Uncertain significance
linezolid
rrl 1476032 n.2375C>A non_coding_transcript_exon_variant 0.56 capreomycin
linezolid
rrl 1476034 n.2377C>G non_coding_transcript_exon_variant 0.53 capreomycin Uncertain significance
linezolid
rrl 1476040 n.2383C>T non_coding_transcript_exon_variant 0.53 capreomycin
linezolid
rrl 1476045 n.2388G>T non_coding_transcript_exon_variant 0.53 capreomycin Uncertain significance
linezolid
rrl 1476047 n.2390G>T non_coding_transcript_exon_variant 0.56 capreomycin
linezolid
rrl 1476049 n.2392C>T non_coding_transcript_exon_variant 0.56 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476164 n.2507A>G non_coding_transcript_exon_variant 0.42 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476194 n.2537A>G non_coding_transcript_exon_variant 0.59 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476200 n.2543A>T non_coding_transcript_exon_variant 0.62 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476201 n.2544C>T non_coding_transcript_exon_variant 0.5 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476214 n.2557G>T non_coding_transcript_exon_variant 0.55 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476215 n.2558C>T non_coding_transcript_exon_variant 0.52 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476224 n.2567A>G non_coding_transcript_exon_variant 0.58 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476245 n.2588C>T non_coding_transcript_exon_variant 0.45 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476251 n.2594T>C non_coding_transcript_exon_variant 0.27 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476252 n.2595T>G non_coding_transcript_exon_variant 0.56 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476253 n.2596A>G non_coding_transcript_exon_variant 0.36 capreomycin
linezolid
rrl 1476256 n.2599A>G non_coding_transcript_exon_variant 0.45 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 0.74 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476280 n.2623A>C non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476281 n.2624T>C non_coding_transcript_exon_variant 0.46 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476294 n.2637A>G non_coding_transcript_exon_variant 0.69 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476295 n.2638C>G non_coding_transcript_exon_variant 0.64 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476296 n.2639C>T non_coding_transcript_exon_variant 0.69 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476297 n.2640C>A non_coding_transcript_exon_variant 0.46 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476299 n.2642C>G non_coding_transcript_exon_variant 0.29 capreomycin
linezolid
rrl 1476300 n.2643G>T non_coding_transcript_exon_variant 0.28 capreomycin
linezolid
rrl 1476301 n.2644A>T non_coding_transcript_exon_variant 0.62 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476302 n.2645G>A non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476311 n.2654G>C non_coding_transcript_exon_variant 0.6 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476312 n.2655T>C non_coding_transcript_exon_variant 0.63 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476332 n.2675G>C non_coding_transcript_exon_variant 0.34 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476337 n.2680C>T non_coding_transcript_exon_variant 0.21 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476338 n.2681C>T non_coding_transcript_exon_variant 0.32 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476353 n.2696G>T non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476357 n.2700T>C non_coding_transcript_exon_variant 0.12 capreomycin
linezolid
rrl 1476358 n.2701T>C non_coding_transcript_exon_variant 0.33 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476359 n.2702C>G non_coding_transcript_exon_variant 0.47 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476369 n.2712C>T non_coding_transcript_exon_variant 0.32 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476372 n.2715T>C non_coding_transcript_exon_variant 0.43 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476381 n.2724G>C non_coding_transcript_exon_variant 0.43 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476382 n.2725A>G non_coding_transcript_exon_variant 0.33 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476383 n.2726T>A non_coding_transcript_exon_variant 0.37 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476408 n.2751G>A non_coding_transcript_exon_variant 0.14 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476425 n.2768G>T non_coding_transcript_exon_variant 0.22 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 0.59 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476429 n.2772A>C non_coding_transcript_exon_variant 0.57 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476466 n.2809C>T non_coding_transcript_exon_variant 0.64 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476481 n.2824T>C non_coding_transcript_exon_variant 0.61 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476506 n.2849T>C non_coding_transcript_exon_variant 0.65 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476513 n.2856G>T non_coding_transcript_exon_variant 0.25 capreomycin
linezolid
rrl 1476515 n.2858C>T non_coding_transcript_exon_variant 0.6 capreomycin Uncertain significance
linezolid
rrl 1476523 n.2866T>C non_coding_transcript_exon_variant 0.25 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476524 n.2867C>T non_coding_transcript_exon_variant 0.45 capreomycin
linezolid
rrl 1476525 n.2868A>G non_coding_transcript_exon_variant 0.59 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476528 n.2871A>G non_coding_transcript_exon_variant 0.14 capreomycin Uncertain significance
linezolid
rrl 1476530 n.2873C>T non_coding_transcript_exon_variant 0.4 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476536 n.2879G>A non_coding_transcript_exon_variant 0.48 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476538 n.2881A>G non_coding_transcript_exon_variant 0.25 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476539 n.2882A>G non_coding_transcript_exon_variant 0.58 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476540 n.2883C>G non_coding_transcript_exon_variant 0.42 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476547 n.2890C>T non_coding_transcript_exon_variant 0.35 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476584 n.2927C>T non_coding_transcript_exon_variant 0.24 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476585 n.2928A>G non_coding_transcript_exon_variant 0.24 capreomycin Uncertain significance
linezolid Uncertain significance
rpsA 1833979 c.438T>C synonymous_variant 0.15 pyrazinamide
rpsA 1833994 c.453G>C synonymous_variant 0.15 pyrazinamide
rpsA 1834009 c.468C>T synonymous_variant 0.15 pyrazinamide
rpsA 1834012 c.471G>C synonymous_variant 0.15 pyrazinamide
rpsA 1834024 c.483G>C synonymous_variant 0.17 pyrazinamide
rpsA 1834040 p.Lys167Arg missense_variant 0.15 pyrazinamide
rpsA 1834046 p.Ile169Leu missense_variant 0.11 pyrazinamide
rpsA 1834054 c.513C>G synonymous_variant 0.12 pyrazinamide
rpsA 1834177 c.636A>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
katG 2154724 p.Arg463Leu missense_variant 1.0 isoniazid Not assoc w R
PPE35 2167926 p.Leu896Ser missense_variant 1.0 pyrazinamide Not assoc w R
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
pncA 2289559 c.-318T>G upstream_gene_variant 1.0 pyrazinamide
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
Rv3236c 3612813 p.Thr102Ala missense_variant 1.0 pyrazinamide Not assoc w R - Interim
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
mtrB 3626562 p.Pro18Ser missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
embC 4242241 c.2379C>T synonymous_variant 1.0 ethambutol Not assoc w R - Interim
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
embA 4243460 c.228C>T synonymous_variant 1.0 ethambutol Not assoc w R
aftB 4267647 p.Asp397Gly missense_variant 1.0 ethambutol Not assoc w R
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin
gid 4407588 c.615A>G synonymous_variant 1.0 streptomycin Not assoc w R
gid 4407927 p.Glu92Asp missense_variant 1.0 streptomycin Not assoc w R