TB-Profiler result

Run: SRR11349147

Summary

Run ID: SRR11349147

Sample name:

Date: 2024-03-24T19:42:55.372373

Number of reads: 3032981

Percentage reads mapped: 61.95

Median coverage: 93.0

Strain: lineage4.3.2.1

Spoligotype:

Drug-resistance: RR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4.3 Euro-American (LAM) None 1.0
lineage4.3.2 Euro-American (LAM) None 1.0
lineage4.3.2.1 Euro-American (LAM) RD761 1.0
lineage4 Euro-American None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.Leu452Pro Assoc w R
isoniazid
ethambutol
pyrazinamide
streptomycin rrs n.799C>T Uncertain significance Mutation from literature
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin rrs n.1402C>A Uncertain significance Mutation from literature
n.1484G>T Assoc w R
capreomycin rrs n.1402C>A Uncertain significance Mutation from literature
n.1484G>T Assoc w R
kanamycin rrs n.1402C>A Uncertain significance Mutation from literature
n.1484G>T Assoc w R
cycloserine
ethionamide
clofazimine
para-aminosalicylic_acid
delamanid
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
rpoB 761161 p.Leu452Pro missense_variant 0.85 rifampicin Assoc w R
rrs 1472644 n.799C>T non_coding_transcript_exon_variant 0.9 streptomycin Uncertain significance Mutation from literature
rrs 1473247 n.1402C>A non_coding_transcript_exon_variant 0.89 amikacin Uncertain significance Mutation from literature
capreomycin Uncertain significance Mutation from literature
kanamycin Uncertain significance Mutation from literature
rrs 1473329 n.1484G>T non_coding_transcript_exon_variant 0.9 capreomycin Assoc w R
amikacin Assoc w R
kanamycin Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrB 5520 p.Pro94Leu missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrB 7222 c.1983C>T synonymous_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
rpoB 760991 c.1185G>C synonymous_variant 0.14 rifampicin
rpoB 760997 c.1191G>T synonymous_variant 0.15 rifampicin
rpoB 761015 c.1209G>C synonymous_variant 0.18 rifampicin Not assoc w R - Interim
rpoB 761021 c.1215G>C synonymous_variant 0.2 rifampicin
rpoB 761027 c.1221A>G synonymous_variant 0.22 rifampicin Not assoc w R - Interim
rpoB 761036 c.1230G>C synonymous_variant 0.22 rifampicin Not assoc w R - Interim
rpoB 761037 c.1231T>C synonymous_variant 0.21 rifampicin Not assoc w R - Interim
rpoB 761051 c.1245G>T synonymous_variant 0.22 rifampicin Not assoc w R - Interim
rpoB 761054 c.1248G>C synonymous_variant 0.23 rifampicin Not assoc w R - Interim
rpoB 761057 c.1251G>C synonymous_variant 0.22 rifampicin Not assoc w R - Interim
rpoB 761060 c.1254C>G synonymous_variant 0.22 rifampicin Not assoc w R - Interim
rpoB 761063 c.1257C>A synonymous_variant 0.22 rifampicin
rpoB 761066 c.1260G>C synonymous_variant 0.23 rifampicin
rpoB 761084 c.1278C>A synonymous_variant 0.26 rifampicin Not assoc w R - Interim
rpoB 761088 c.1282_1283delAGinsTC synonymous_variant 0.26 rifampicin
rpoB 761097 c.1291_1293delAGCinsTCG synonymous_variant 0.26 rifampicin
rpoB 761102 c.1296A>G synonymous_variant 0.27 rifampicin
rpoB 761126 c.1320G>C synonymous_variant 0.27 rifampicin
rpoB 761132 c.1326G>C synonymous_variant 0.23 rifampicin Not assoc w R - Interim
rpoB 761133 c.1327T>C synonymous_variant 0.23 rifampicin Not assoc w R - Interim
rpoB 761150 c.1344A>C synonymous_variant 0.19 rifampicin Not assoc w R - Interim
rpoB 761156 c.1350G>C synonymous_variant 0.16 rifampicin
rpoB 761165 c.1359G>T synonymous_variant 0.13 rifampicin Not assoc w R - Interim
rpoC 762917 c.-453C>A upstream_gene_variant 0.12 rifampicin
rpoB 762929 c.3123G>C synonymous_variant 0.1 rifampicin Not assoc w R - Interim
rpoC 762938 c.-432G>C upstream_gene_variant 0.1 rifampicin
rpoC 762947 c.-423C>G upstream_gene_variant 0.11 rifampicin
rpoC 763465 c.96G>A synonymous_variant 0.15 rifampicin
rpoC 763468 c.99G>C synonymous_variant 0.15 rifampicin Not assoc w R - Interim
rpoC 763486 c.117T>C synonymous_variant 0.2 rifampicin Not assoc w R - Interim
rpoC 763492 c.123G>C synonymous_variant 0.22 rifampicin Not assoc w R - Interim
rpoC 763507 c.138G>C synonymous_variant 0.25 rifampicin
rpoC 763528 c.159G>C synonymous_variant 0.28 rifampicin
rpoC 763532 c.163_165delACTinsTC frameshift_variant&missense_variant 0.29 rifampicin
rpoC 763570 c.201G>C synonymous_variant 0.34 rifampicin Not assoc w R - Interim
rpoC 763594 c.225C>T synonymous_variant 0.36 rifampicin Not assoc w R - Interim
rpoC 763603 c.234C>T synonymous_variant 0.35 rifampicin Not assoc w R - Interim
rpoC 763609 c.240C>T synonymous_variant 0.32 rifampicin
rpoC 763612 c.243G>A synonymous_variant 0.31 rifampicin Not assoc w R - Interim
rpoC 763615 c.246G>C synonymous_variant 0.32 rifampicin Not assoc w R - Interim
rpoC 763630 c.261G>C synonymous_variant 0.35 rifampicin
rpoC 763633 c.264T>C synonymous_variant 0.37 rifampicin Not assoc w R - Interim
rpoC 763642 c.273G>C synonymous_variant 0.38 rifampicin Not assoc w R - Interim
rpoC 763657 c.288G>A synonymous_variant 0.36 rifampicin Not assoc w R - Interim
rpoC 763660 c.291T>G synonymous_variant 0.37 rifampicin Not assoc w R - Interim
rpoC 763666 c.297G>T synonymous_variant 0.35 rifampicin
rpoC 763675 c.306C>G synonymous_variant 0.36 rifampicin Not assoc w R - Interim
rpoC 763699 c.330G>T synonymous_variant 0.34 rifampicin
rpoC 763705 c.336G>C synonymous_variant 0.31 rifampicin
rpoC 763708 c.339G>C synonymous_variant 0.3 rifampicin
rpoC 763714 c.345G>A synonymous_variant 0.3 rifampicin
rpoC 763717 c.348T>C synonymous_variant 0.29 rifampicin Not assoc w R - Interim
rpoC 763720 c.351G>C synonymous_variant 0.3 rifampicin
rpoC 763723 c.354G>T synonymous_variant 0.29 rifampicin
rpoC 763732 c.363C>A synonymous_variant 0.26 rifampicin
rpoC 763744 c.375G>C synonymous_variant 0.22 rifampicin
rpoC 763747 c.378G>A synonymous_variant 0.21 rifampicin
rpoC 763751 p.Ile128Val missense_variant 0.21 rifampicin
rpoC 763765 c.396T>C synonymous_variant 0.2 rifampicin
rpoC 763772 p.Val135Met missense_variant 0.16 rifampicin
rpoC 764405 c.1036_1038delAGGinsCC frameshift_variant&missense_variant 0.12 rifampicin
rpoC 764428 c.1059G>C synonymous_variant 0.13 rifampicin Not assoc w R - Interim
rpoC 764431 c.1062G>C synonymous_variant 0.13 rifampicin Not assoc w R - Interim
rpoC 764434 c.1065A>G synonymous_variant 0.13 rifampicin Not assoc w R - Interim
rpoC 764435 c.1066_1068delAGGinsCC frameshift_variant&missense_variant 0.13 rifampicin
rpoC 764441 c.1072_1074delATCinsCT frameshift_variant&missense_variant 0.13 rifampicin
rpoC 764446 c.1077T>C synonymous_variant 0.13 rifampicin
rpoC 764449 c.1080G>C synonymous_variant 0.13 rifampicin
rpoC 764455 c.1086G>C synonymous_variant 0.14 rifampicin
rpoC 764461 c.1092A>G synonymous_variant 0.13 rifampicin Not assoc w R - Interim
rpoC 764485 c.1116G>C synonymous_variant 0.17 rifampicin
rpoC 764491 c.1122G>T synonymous_variant 0.14 rifampicin
rpoC 764498 p.Ser377Ala missense_variant 0.12 rifampicin
rpoC 764509 c.1140G>C synonymous_variant 0.11 rifampicin Not assoc w R - Interim
rpoC 764521 c.1152T>C synonymous_variant 0.14 rifampicin Not assoc w R - Interim
rpoC 764536 c.1167G>C synonymous_variant 0.19 rifampicin
rpoC 764539 c.1170C>G synonymous_variant 0.22 rifampicin Not assoc w R - Interim
rpoC 764548 c.1179G>A synonymous_variant 0.26 rifampicin
rpoC 764566 c.1197C>G synonymous_variant 0.25 rifampicin Not assoc w R - Interim
rpoC 764572 c.1203G>C synonymous_variant 0.25 rifampicin
rpoC 764575 c.1206T>G synonymous_variant 0.25 rifampicin Not assoc w R - Interim
rpoC 764576 c.1207_1208delTCinsAG synonymous_variant 0.25 rifampicin
rpoC 764581 c.1212T>C synonymous_variant 0.24 rifampicin
rpoC 764582 p.Leu405Met missense_variant 0.25 rifampicin
rpoC 764605 c.1236G>T synonymous_variant 0.32 rifampicin
rpoC 764611 c.1242G>C synonymous_variant 0.36 rifampicin
rpoC 764620 c.1251G>C synonymous_variant 0.36 rifampicin
rpoC 764632 c.1263T>C synonymous_variant 0.34 rifampicin Not assoc w R - Interim
rpoC 764644 c.1275G>C synonymous_variant 0.36 rifampicin Not assoc w R - Interim
rpoC 764650 c.1281G>T synonymous_variant 0.38 rifampicin Not assoc w R - Interim
rpoC 764662 c.1293G>C synonymous_variant 0.37 rifampicin Not assoc w R - Interim
rpoC 764668 c.1299C>T synonymous_variant 0.37 rifampicin Not assoc w R - Interim
rpoC 764677 c.1308C>G synonymous_variant 0.37 rifampicin Not assoc w R - Interim
rpoC 764695 c.1326T>C synonymous_variant 0.33 rifampicin
rpoC 764706 p.Leu446Gln missense_variant 0.35 rifampicin Uncertain significance
rpoC 764713 c.1344G>C synonymous_variant 0.36 rifampicin Not assoc w R - Interim
rpoC 764722 c.1353G>C synonymous_variant 0.38 rifampicin
rpoC 764746 c.1377G>C synonymous_variant 0.36 rifampicin
rpoC 764752 c.1383G>T synonymous_variant 0.34 rifampicin
rpoC 764764 c.1395T>C synonymous_variant 0.29 rifampicin Not assoc w R - Interim
rpoC 764767 c.1398G>C synonymous_variant 0.28 rifampicin
rpoC 764780 c.1411_1413delAGCinsTCG synonymous_variant 0.25 rifampicin
rpoC 764791 c.1422C>G synonymous_variant 0.23 rifampicin Not assoc w R - Interim
rpoC 764804 c.1435_1437delCAGinsTC frameshift_variant&missense_variant 0.18 rifampicin
rpoC 764812 c.1443C>G synonymous_variant 0.16 rifampicin
rpoC 764815 c.1446A>G synonymous_variant 0.16 rifampicin Not assoc w R - Interim
rpoC 764824 c.1455T>C synonymous_variant 0.15 rifampicin Not assoc w R - Interim
rpoC 764837 p.Val490Ile missense_variant 0.15 rifampicin Uncertain significance
rpoC 764843 p.Ala492Thr missense_variant 0.16 rifampicin
rpoC 764848 c.1479G>A synonymous_variant 0.14 rifampicin
rpoC 764995 c.1626C>G synonymous_variant 1.0 rifampicin Not assoc w R
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472106 n.261G>A non_coding_transcript_exon_variant 0.9 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472108 n.263C>T non_coding_transcript_exon_variant 0.91 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472150 n.305T>A non_coding_transcript_exon_variant 0.97 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472172 n.327T>C non_coding_transcript_exon_variant 0.97 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472251 n.406G>A non_coding_transcript_exon_variant 0.94 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472494 n.649A>G non_coding_transcript_exon_variant 0.91 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472495 n.650C>A non_coding_transcript_exon_variant 0.91 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472498 n.653C>T non_coding_transcript_exon_variant 0.92 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472530 n.685G>A non_coding_transcript_exon_variant 0.95 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472558 n.713G>A non_coding_transcript_exon_variant 0.93 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472569 n.724G>A non_coding_transcript_exon_variant 0.93 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472582 n.737G>T non_coding_transcript_exon_variant 0.94 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472607 n.762G>A non_coding_transcript_exon_variant 0.92 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472655 n.810G>T non_coding_transcript_exon_variant 0.94 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472660 n.815T>C non_coding_transcript_exon_variant 0.88 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472673 n.828T>G non_coding_transcript_exon_variant 0.88 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472674 n.829T>G non_coding_transcript_exon_variant 0.83 streptomycin Uncertain significance
kanamycin
capreomycin
amikacin
rrs 1472675 n.830T>A non_coding_transcript_exon_variant 0.9 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472677 n.832C>A non_coding_transcript_exon_variant 0.9 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472692 n.847T>C non_coding_transcript_exon_variant 0.84 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472714 n.869A>G non_coding_transcript_exon_variant 0.85 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472790 n.945T>C non_coding_transcript_exon_variant 0.69 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472824 n.979T>A non_coding_transcript_exon_variant 0.67 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472825 n.980G>A non_coding_transcript_exon_variant 0.67 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472828 n.983T>C non_coding_transcript_exon_variant 0.67 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472837 n.992C>A non_coding_transcript_exon_variant 0.62 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472840 n.995A>C non_coding_transcript_exon_variant 0.59 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472845 n.1000G>C non_coding_transcript_exon_variant 0.58 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472846 n.1001C>G non_coding_transcript_exon_variant 0.58 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472848 n.1003T>A non_coding_transcript_exon_variant 0.58 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472851 n.1006A>G non_coding_transcript_exon_variant 0.58 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472854 n.1009G>A non_coding_transcript_exon_variant 0.58 streptomycin Uncertain significance
kanamycin
capreomycin
amikacin
rrs 1472856 n.1011T>C non_coding_transcript_exon_variant 0.58 streptomycin
kanamycin Uncertain significance
capreomycin
amikacin Uncertain significance
rrs 1472859 n.1014G>T non_coding_transcript_exon_variant 0.56 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472860 n.1015C>T non_coding_transcript_exon_variant 0.56 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472861 n.1016G>C non_coding_transcript_exon_variant 0.56 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472865 n.1020_1021insA non_coding_transcript_exon_variant 0.54 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472874 n.1029C>T non_coding_transcript_exon_variant 0.54 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472875 n.1030T>G non_coding_transcript_exon_variant 0.54 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472878 n.1033G>T non_coding_transcript_exon_variant 0.58 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472880 n.1035G>A non_coding_transcript_exon_variant 0.66 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472895 n.1050C>T non_coding_transcript_exon_variant 0.81 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472952 n.1107T>C non_coding_transcript_exon_variant 0.89 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472955 n.1110C>T non_coding_transcript_exon_variant 0.9 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472956 n.1111T>C non_coding_transcript_exon_variant 0.9 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472969 n.1124A>G non_coding_transcript_exon_variant 0.88 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472970 n.1125C>G non_coding_transcript_exon_variant 0.88 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472974 n.1129A>G non_coding_transcript_exon_variant 0.89 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472977 n.1132G>C non_coding_transcript_exon_variant 0.89 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472978 n.1133T>C non_coding_transcript_exon_variant 0.89 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472987 n.1142G>A non_coding_transcript_exon_variant 0.89 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472990 n.1145A>G non_coding_transcript_exon_variant 0.89 streptomycin Uncertain significance
kanamycin Not assoc w R
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473026 n.1181T>C non_coding_transcript_exon_variant 0.88 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473035 n.1190G>A non_coding_transcript_exon_variant 0.9 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1473055 n.1210C>T non_coding_transcript_exon_variant 0.88 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473056 n.1211A>T non_coding_transcript_exon_variant 0.88 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1473066 n.1221A>G non_coding_transcript_exon_variant 0.88 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473093 n.1248C>T non_coding_transcript_exon_variant 0.87 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473100 n.1255G>A non_coding_transcript_exon_variant 0.87 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473102 n.1257C>T non_coding_transcript_exon_variant 0.86 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473104 n.1259C>T non_coding_transcript_exon_variant 0.86 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473110 n.1265T>G non_coding_transcript_exon_variant 0.85 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473111 n.1266A>G non_coding_transcript_exon_variant 0.85 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473115 n.1270G>T non_coding_transcript_exon_variant 0.85 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473121 n.1276T>C non_coding_transcript_exon_variant 0.86 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473122 n.1277T>A non_coding_transcript_exon_variant 0.86 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473145 n.1300C>T non_coding_transcript_exon_variant 0.88 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473166 n.1321G>A non_coding_transcript_exon_variant 0.86 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473252 n.1407T>C non_coding_transcript_exon_variant 0.89 streptomycin Uncertain significance
kanamycin Not assoc w R
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473259 n.1414C>T non_coding_transcript_exon_variant 0.91 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1473276 n.1431A>G non_coding_transcript_exon_variant 0.9 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473301 n.1456T>C non_coding_transcript_exon_variant 0.91 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473315 n.1470T>C non_coding_transcript_exon_variant 0.89 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473316 n.1471C>T non_coding_transcript_exon_variant 0.89 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrl 1473871 n.214T>C non_coding_transcript_exon_variant 0.46 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473876 n.219G>A non_coding_transcript_exon_variant 0.5 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474218 n.561T>A non_coding_transcript_exon_variant 0.82 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474249 n.592G>C non_coding_transcript_exon_variant 0.97 capreomycin
linezolid
rrl 1474269 n.612C>T non_coding_transcript_exon_variant 0.97 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474281 n.624A>G non_coding_transcript_exon_variant 0.96 capreomycin
linezolid
rrl 1474286 n.629_630insAG non_coding_transcript_exon_variant 0.96 capreomycin
linezolid
rrl 1474289 n.632C>T non_coding_transcript_exon_variant 0.96 capreomycin
linezolid
rrl 1474290 n.633T>G non_coding_transcript_exon_variant 0.96 capreomycin
linezolid
rrl 1474291 n.634T>A non_coding_transcript_exon_variant 0.96 capreomycin
linezolid
rrl 1474294 n.638_652delCTCTCCGGAGGAGGG non_coding_transcript_exon_variant 0.96 capreomycin
linezolid
rrl 1474316 n.659T>C non_coding_transcript_exon_variant 0.97 capreomycin
linezolid
rrl 1474348 n.691C>T non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474351 n.694G>T non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474353 n.696A>T non_coding_transcript_exon_variant 0.98 capreomycin
linezolid
rrl 1474354 n.697C>T non_coding_transcript_exon_variant 0.98 capreomycin
linezolid
rrl 1474356 n.699T>C non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid
rrl 1474362 n.705A>G non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474381 n.724T>C non_coding_transcript_exon_variant 0.99 capreomycin
linezolid
rrl 1474387 n.730C>T non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474409 n.756_776delACCCACACGCGCATACGCGCG non_coding_transcript_exon_variant 0.98 capreomycin
linezolid
rrl 1474437 n.782_784delATA non_coding_transcript_exon_variant 0.96 capreomycin
linezolid
rrl 1474450 n.793T>A non_coding_transcript_exon_variant 0.96 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474454 n.797G>A non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474466 n.809G>A non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474488 n.831G>T non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474496 n.839C>A non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474497 n.840G>C non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474506 n.849C>G non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474507 n.850G>T non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474516 n.859C>A non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474529 n.872A>C non_coding_transcript_exon_variant 0.99 capreomycin
linezolid
rrl 1474530 n.873G>A non_coding_transcript_exon_variant 0.99 capreomycin
linezolid
rrl 1474537 n.880G>A non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474539 n.882C>T non_coding_transcript_exon_variant 0.97 capreomycin
linezolid
rrl 1474540 n.883T>G non_coding_transcript_exon_variant 0.98 capreomycin
linezolid
rrl 1474583 n.926C>T non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474632 n.975G>T non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474636 n.979A>T non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid
rrl 1474637 n.980C>T non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid
rrl 1474638 n.981C>T non_coding_transcript_exon_variant 0.99 capreomycin
linezolid
rrl 1474639 n.982G>C non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474663 n.1006C>T non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474664 n.1007G>A non_coding_transcript_exon_variant 0.98 capreomycin
linezolid
rrl 1474676 n.1019T>A non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474709 n.1053_1056delTGGT non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474717 n.1060_1061insGTGAG non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474722 n.1065T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1474723 n.1066G>A non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474734 n.1077G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474736 n.1079C>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474749 n.1092C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474751 n.1094G>A non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474753 n.1097delC non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474760 n.1103A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474777 n.1120T>C non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1474779 n.1122G>A non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474782 n.1125G>A non_coding_transcript_exon_variant 0.99 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1474783 n.1126G>A non_coding_transcript_exon_variant 0.99 capreomycin
linezolid
rrl 1474794 n.1137C>T non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474823 n.1166C>G non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474827 n.1170C>T non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474830 n.1173A>T non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474831 n.1174A>C non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474864 n.1207C>T non_coding_transcript_exon_variant 0.98 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1474869 n.1212G>A non_coding_transcript_exon_variant 0.98 capreomycin
linezolid
rrl 1474904 n.1247G>C non_coding_transcript_exon_variant 0.96 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474905 n.1248T>C non_coding_transcript_exon_variant 0.96 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474913 n.1256T>C non_coding_transcript_exon_variant 0.95 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474932 n.1275C>T non_coding_transcript_exon_variant 0.97 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475060 n.1404delC non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475065 n.1408G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475067 n.1410A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475068 n.1411A>G non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1475076 n.1419C>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475078 n.1421T>C non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1475079 n.1422T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475081 n.1424C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475090 n.1433A>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475093 n.1436C>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1475104 n.1447T>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475108 n.1451C>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1475111 n.1454G>A non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1475114 n.1457C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475116 n.1459G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475119 n.1462C>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1475124 n.1467A>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475129 n.1472G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475548 n.1891C>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1475599 n.1942A>G non_coding_transcript_exon_variant 0.95 capreomycin
linezolid Uncertain significance
rrl 1475602 n.1945G>C non_coding_transcript_exon_variant 0.95 capreomycin Uncertain significance
linezolid
rrl 1475603 n.1946G>C non_coding_transcript_exon_variant 0.95 capreomycin
linezolid
rrl 1475604 n.1950_1951delAT non_coding_transcript_exon_variant 0.95 capreomycin
linezolid
rrl 1475608 n.1951T>C non_coding_transcript_exon_variant 0.93 capreomycin Uncertain significance
linezolid
rrl 1475610 n.1953G>T non_coding_transcript_exon_variant 0.93 capreomycin
linezolid
rrl 1475618 n.1961_1962insA non_coding_transcript_exon_variant 0.93 capreomycin
linezolid
rrl 1475623 n.1966_1967insT non_coding_transcript_exon_variant 0.93 capreomycin
linezolid
rrl 1475631 n.1975delC non_coding_transcript_exon_variant 0.95 capreomycin
linezolid
rrl 1475639 n.1982delCinsGG non_coding_transcript_exon_variant 0.93 capreomycin
linezolid
rrl 1475642 n.1985T>C non_coding_transcript_exon_variant 0.93 capreomycin
linezolid
rrl 1475649 n.1992A>G non_coding_transcript_exon_variant 0.94 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475655 n.1998T>G non_coding_transcript_exon_variant 0.94 capreomycin Uncertain significance
linezolid
rrl 1475657 n.2000A>G non_coding_transcript_exon_variant 0.94 capreomycin
linezolid
rrl 1475659 n.2002G>A non_coding_transcript_exon_variant 0.94 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475722 n.2065G>T non_coding_transcript_exon_variant 0.96 capreomycin
linezolid
rrl 1475753 n.2096C>G non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid
rrl 1475758 n.2101A>G non_coding_transcript_exon_variant 0.97 capreomycin
linezolid
rrl 1475766 n.2109G>C non_coding_transcript_exon_variant 0.97 capreomycin
linezolid
rrl 1475769 n.2112T>C non_coding_transcript_exon_variant 0.98 capreomycin
linezolid
rrl 1475775 n.2118G>T non_coding_transcript_exon_variant 0.97 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475869 n.2212C>A non_coding_transcript_exon_variant 0.91 capreomycin
linezolid
rrl 1475881 n.2224T>C non_coding_transcript_exon_variant 0.9 capreomycin
linezolid
rrl 1475883 n.2226A>C non_coding_transcript_exon_variant 0.89 capreomycin Uncertain significance
linezolid
rrl 1475884 n.2227A>G non_coding_transcript_exon_variant 0.89 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475899 n.2242G>A non_coding_transcript_exon_variant 0.88 capreomycin Uncertain significance
linezolid
rrl 1475916 n.2259C>G non_coding_transcript_exon_variant 0.88 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475943 n.2286G>A non_coding_transcript_exon_variant 0.88 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475952 n.2295A>G non_coding_transcript_exon_variant 0.84 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475963 n.2306G>A non_coding_transcript_exon_variant 0.84 capreomycin
linezolid
rrl 1475970 n.2313C>T non_coding_transcript_exon_variant 0.82 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475975 n.2318C>T non_coding_transcript_exon_variant 0.77 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475977 n.2320A>G non_coding_transcript_exon_variant 0.75 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475978 n.2321C>T non_coding_transcript_exon_variant 0.75 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475988 n.2331A>G non_coding_transcript_exon_variant 0.74 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1475996 n.2339T>A non_coding_transcript_exon_variant 0.62 capreomycin
linezolid
rrl 1475997 n.2340A>G non_coding_transcript_exon_variant 0.62 capreomycin
linezolid
rrl 1475998 n.2341C>T non_coding_transcript_exon_variant 0.62 capreomycin
linezolid Uncertain significance
rrl 1476001 n.2344T>C non_coding_transcript_exon_variant 0.68 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476024 n.2367T>G non_coding_transcript_exon_variant 0.64 capreomycin
linezolid
rrl 1476025 n.2368G>T non_coding_transcript_exon_variant 0.64 capreomycin
linezolid
rrl 1476030 n.2373A>G non_coding_transcript_exon_variant 0.64 capreomycin Uncertain significance
linezolid
rrl 1476033 n.2376T>C non_coding_transcript_exon_variant 0.64 capreomycin Uncertain significance
linezolid
rrl 1476034 n.2377C>G non_coding_transcript_exon_variant 0.64 capreomycin Uncertain significance
linezolid
rrl 1476045 n.2388G>C non_coding_transcript_exon_variant 0.72 capreomycin
linezolid
rrl 1476049 n.2392C>T non_coding_transcript_exon_variant 0.72 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476056 n.2399G>A non_coding_transcript_exon_variant 0.68 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476058 n.2401T>C non_coding_transcript_exon_variant 0.68 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476130 n.2473G>A non_coding_transcript_exon_variant 0.65 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476131 n.2474C>T non_coding_transcript_exon_variant 0.64 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476165 n.2508T>A non_coding_transcript_exon_variant 0.88 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476194 n.2537A>G non_coding_transcript_exon_variant 0.92 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476200 n.2543A>T non_coding_transcript_exon_variant 0.92 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476201 n.2544C>T non_coding_transcript_exon_variant 0.93 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476214 n.2557G>T non_coding_transcript_exon_variant 0.93 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476224 n.2567A>G non_coding_transcript_exon_variant 0.93 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476245 n.2588C>T non_coding_transcript_exon_variant 0.91 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476250 n.2593C>G non_coding_transcript_exon_variant 0.93 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476251 n.2594T>A non_coding_transcript_exon_variant 0.93 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476252 n.2595T>G non_coding_transcript_exon_variant 0.9 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476256 n.2599A>T non_coding_transcript_exon_variant 0.91 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476257 n.2600G>C non_coding_transcript_exon_variant 0.93 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 0.93 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476281 n.2624T>C non_coding_transcript_exon_variant 0.93 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476294 n.2637_2643delACCCCCGinsGGTAC non_coding_transcript_exon_variant 0.92 capreomycin
linezolid
rrl 1476308 n.2651G>T non_coding_transcript_exon_variant 0.92 capreomycin
linezolid
rrl 1476311 n.2654G>C non_coding_transcript_exon_variant 0.92 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476312 n.2655T>C non_coding_transcript_exon_variant 0.93 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476337 n.2680C>T non_coding_transcript_exon_variant 0.95 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476359 n.2702C>G non_coding_transcript_exon_variant 0.94 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476381 n.2724G>C non_coding_transcript_exon_variant 0.93 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 0.97 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476466 n.2809C>T non_coding_transcript_exon_variant 0.9 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476506 n.2849T>C non_coding_transcript_exon_variant 0.89 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476515 n.2858C>T non_coding_transcript_exon_variant 0.84 capreomycin Uncertain significance
linezolid
rrl 1476523 n.2866T>C non_coding_transcript_exon_variant 0.8 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476524 n.2867C>A non_coding_transcript_exon_variant 0.78 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476525 n.2868A>G non_coding_transcript_exon_variant 0.78 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476530 n.2873C>T non_coding_transcript_exon_variant 0.8 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476536 n.2879G>A non_coding_transcript_exon_variant 0.75 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476538 n.2881A>G non_coding_transcript_exon_variant 0.74 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476539 n.2882A>G non_coding_transcript_exon_variant 0.74 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476540 n.2883C>G non_coding_transcript_exon_variant 0.71 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476547 n.2890C>T non_coding_transcript_exon_variant 0.71 capreomycin Uncertain significance
linezolid Uncertain significance
rpsA 1833709 c.168C>T synonymous_variant 0.12 pyrazinamide
rpsA 1833724 c.183C>T synonymous_variant 0.22 pyrazinamide
rpsA 1833727 c.186G>C synonymous_variant 0.22 pyrazinamide
rpsA 1833734 p.Ala65Ser missense_variant 0.22 pyrazinamide
rpsA 1833742 c.201A>G synonymous_variant 0.23 pyrazinamide
rpsA 1833745 c.204G>T synonymous_variant 0.23 pyrazinamide
rpsA 1833763 c.222C>T synonymous_variant 0.23 pyrazinamide Not assoc w R - Interim
rpsA 1833770 p.Asn77Gly missense_variant 0.23 pyrazinamide
rpsA 1833775 c.234G>A synonymous_variant 0.24 pyrazinamide
rpsA 1833778 c.237C>T synonymous_variant 0.24 pyrazinamide
rpsA 1833781 c.240T>C synonymous_variant 0.24 pyrazinamide
rpsA 1833790 c.249T>C synonymous_variant 0.23 pyrazinamide
rpsA 1833793 c.252C>T synonymous_variant 0.23 pyrazinamide
rpsA 1833794 p.Glu85Gln missense_variant 0.22 pyrazinamide
rpsA 1833823 c.282G>A synonymous_variant 0.24 pyrazinamide
rpsA 1833832 c.291G>A synonymous_variant 0.26 pyrazinamide
rpsA 1833838 c.297G>C synonymous_variant 0.26 pyrazinamide
rpsA 1833841 c.300C>G synonymous_variant 0.26 pyrazinamide
rpsA 1833856 c.315A>G synonymous_variant 0.2 pyrazinamide
rpsA 1833862 c.321G>T synonymous_variant 0.13 pyrazinamide
rpsA 1833952 c.411C>T synonymous_variant 0.19 pyrazinamide
rpsA 1833955 c.414G>T synonymous_variant 0.2 pyrazinamide
rpsA 1833970 c.429G>C synonymous_variant 0.22 pyrazinamide
rpsA 1833979 c.438T>C synonymous_variant 0.24 pyrazinamide
rpsA 1833991 c.450C>A synonymous_variant 0.23 pyrazinamide
rpsA 1833994 c.453G>C synonymous_variant 0.24 pyrazinamide
rpsA 1833997 c.456G>C synonymous_variant 0.24 pyrazinamide
rpsA 1834000 c.459G>C synonymous_variant 0.24 pyrazinamide
rpsA 1834012 c.471G>C synonymous_variant 0.22 pyrazinamide
rpsA 1834025 p.Gln162Ala missense_variant 0.23 pyrazinamide
rpsA 1834030 c.489C>G synonymous_variant 0.22 pyrazinamide
rpsA 1834040 p.Lys167Gln missense_variant 0.21 pyrazinamide
rpsA 1834043 p.Glu168Gln missense_variant 0.21 pyrazinamide
rpsA 1834051 c.510G>A synonymous_variant 0.21 pyrazinamide
rpsA 1834246 c.705G>T synonymous_variant 0.12 pyrazinamide
rpsA 1834249 c.708T>C synonymous_variant 0.12 pyrazinamide
rpsA 1834261 c.720A>G synonymous_variant 0.14 pyrazinamide Not assoc w R - Interim
rpsA 1834264 c.723G>C synonymous_variant 0.14 pyrazinamide
rpsA 1834294 c.753G>T synonymous_variant 0.14 pyrazinamide
rpsA 1834298 p.Gln253Glu missense_variant 0.14 pyrazinamide
rpsA 1834306 c.765T>C synonymous_variant 0.13 pyrazinamide
rpsA 1834307 c.766_768delGACinsCG frameshift_variant&missense_variant 0.13 pyrazinamide Uncertain significance
rpsA 1834312 c.771G>A synonymous_variant 0.13 pyrazinamide
rpsA 1834327 c.786G>C synonymous_variant 0.14 pyrazinamide
rpsA 1834333 p.Asp264Glu missense_variant 0.13 pyrazinamide
rpsA 1834336 c.795C>G synonymous_variant 0.15 pyrazinamide
rpsA 1834340 p.Met267Leu missense_variant 0.13 pyrazinamide Uncertain significance
rpsA 1834348 c.807T>C synonymous_variant 0.12 pyrazinamide Not assoc w R - Interim
rpsA 1834360 c.819G>C synonymous_variant 0.11 pyrazinamide
rpsA 1834361 c.820T>C synonymous_variant 0.11 pyrazinamide
rpsA 1834366 c.825A>G synonymous_variant 0.1 pyrazinamide Not assoc w R - Interim
rpsA 1834378 c.837T>G synonymous_variant 0.11 pyrazinamide
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
PPE35 2168433 p.Gly727Glu missense_variant 1.0 pyrazinamide
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
Rv2752c 3064773 c.1419C>A synonymous_variant 1.0 ethambutol Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
levofloxacin Not assoc w R - Interim
rifampicin Not assoc w R - Interim
isoniazid Not assoc w R - Interim
thyA 3073868 p.Thr202Ala missense_variant 1.0 para-aminosalicylic_acid
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
lpqB 3623883 p.Met343Thr missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Uncertain significance
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
clpC1 4038287 c.2418C>T synonymous_variant 1.0 pyrazinamide Not assoc w R
clpC1 4039714 p.Tyr331His missense_variant 0.15 pyrazinamide
clpC1 4039875 p.Asn277Arg missense_variant 0.12 pyrazinamide
clpC1 4039889 c.816G>C synonymous_variant 0.17 pyrazinamide
clpC1 4039904 c.801A>G synonymous_variant 0.19 pyrazinamide
clpC1 4039907 c.798G>A synonymous_variant 0.21 pyrazinamide Not assoc w R - Interim
clpC1 4039925 c.780C>T synonymous_variant 0.21 pyrazinamide Not assoc w R - Interim
clpC1 4039929 c.775_776delAGinsTC synonymous_variant 0.22 pyrazinamide
clpC1 4039931 c.774T>C synonymous_variant 0.21 pyrazinamide
clpC1 4039934 c.771G>A synonymous_variant 0.21 pyrazinamide
clpC1 4039943 c.762G>C synonymous_variant 0.21 pyrazinamide
clpC1 4039946 c.759A>C synonymous_variant 0.22 pyrazinamide
clpC1 4039949 c.756G>C synonymous_variant 0.22 pyrazinamide
clpC1 4039952 c.753T>C synonymous_variant 0.24 pyrazinamide
clpC1 4039958 c.747G>C synonymous_variant 0.25 pyrazinamide
clpC1 4039981 p.Leu242Ile missense_variant 0.26 pyrazinamide
clpC1 4039982 c.723G>C synonymous_variant 0.27 pyrazinamide
clpC1 4039991 c.714G>C synonymous_variant 0.3 pyrazinamide
clpC1 4039994 p.Glu237Asp missense_variant 0.3 pyrazinamide
clpC1 4040001 p.His235Arg missense_variant 0.3 pyrazinamide
clpC1 4040009 c.696C>G synonymous_variant 0.3 pyrazinamide
clpC1 4040015 c.690G>C synonymous_variant 0.29 pyrazinamide
clpC1 4040021 c.684A>C synonymous_variant 0.26 pyrazinamide Not assoc w R - Interim
clpC1 4040033 c.672G>C synonymous_variant 0.21 pyrazinamide
clpC1 4040063 c.642G>C synonymous_variant 0.17 pyrazinamide Not assoc w R - Interim
clpC1 4040066 c.639G>C synonymous_variant 0.16 pyrazinamide
clpC1 4040087 c.618G>C synonymous_variant 0.14 pyrazinamide
clpC1 4040090 c.615T>C synonymous_variant 0.14 pyrazinamide Not assoc w R - Interim
clpC1 4040096 c.609G>C synonymous_variant 0.15 pyrazinamide
clpC1 4040108 c.597G>C synonymous_variant 0.11 pyrazinamide
clpC1 4040114 p.Ile197Met missense_variant 0.11 pyrazinamide
clpC1 4040117 c.588A>G synonymous_variant 0.11 pyrazinamide
clpC1 4040122 p.Lys195Gln missense_variant 0.11 pyrazinamide
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin
gid 4408156 p.Leu16Arg missense_variant 1.0 streptomycin Not assoc w R