TB-Profiler result

Run: ERR4178309

Summary

Run ID: ERR4178309

Sample name:

Date: 01-04-2023 04:38:43

Number of reads: 874974

Percentage reads mapped: 49.09

Strain: lineage4.1.2.1

Drug-resistance: Other


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 0.98
lineage4.1.2 Euro-American T;H None 1.0
lineage4.1.2.1 Euro-American (Haarlem) T1;H1 RD182 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
folC 2747481 p.Glu40Gln missense_variant 1.0 para-aminosalicylic_acid
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 6550 c.-752A>G upstream_gene_variant 0.26
gyrA 6556 c.-746C>T upstream_gene_variant 0.25
gyrA 6571 c.-731T>C upstream_gene_variant 0.25
gyrA 6577 c.-725T>C upstream_gene_variant 0.29
gyrA 6583 c.-719G>C upstream_gene_variant 0.27
gyrB 6590 p.Arg451Ser missense_variant 0.27
gyrA 6598 c.-704C>G upstream_gene_variant 0.35
gyrA 6610 c.-692C>G upstream_gene_variant 0.42
gyrA 6613 c.-689A>G upstream_gene_variant 0.42
gyrA 6616 c.-686A>G upstream_gene_variant 0.45
gyrA 6631 c.-671C>T upstream_gene_variant 0.51
gyrA 6637 c.-665T>G upstream_gene_variant 0.46
gyrA 6640 c.-662A>T upstream_gene_variant 0.47
gyrA 6643 c.-659A>G upstream_gene_variant 0.47
gyrA 6649 c.-653T>C upstream_gene_variant 0.49
gyrA 6655 c.-647T>C upstream_gene_variant 0.49
gyrA 6670 c.-632G>C upstream_gene_variant 0.48
gyrA 6673 c.-629A>C upstream_gene_variant 0.48
gyrA 6676 c.-626T>G upstream_gene_variant 0.5
gyrA 6697 c.-605C>T upstream_gene_variant 0.51
gyrA 6700 c.-602T>C upstream_gene_variant 0.5
gyrA 6703 c.-599G>T upstream_gene_variant 0.48
gyrA 6706 c.-596G>A upstream_gene_variant 0.48
gyrA 6709 c.-593A>G upstream_gene_variant 0.5
gyrA 6715 c.-587C>T upstream_gene_variant 0.51
gyrA 6727 c.-575G>T upstream_gene_variant 0.49
gyrA 6728 c.-574_-572delCTAinsTTG upstream_gene_variant 0.49
gyrA 6745 c.-557T>C upstream_gene_variant 0.57
gyrA 6760 c.-542G>C upstream_gene_variant 0.54
gyrA 6764 c.-538C>T upstream_gene_variant 0.52
gyrA 6772 c.-530C>G upstream_gene_variant 0.48
gyrA 6775 c.-527G>T upstream_gene_variant 0.47
gyrA 6796 c.-506C>T upstream_gene_variant 0.44
gyrB 6798 p.Gly520Ala missense_variant 0.42
gyrA 6808 c.-494C>G upstream_gene_variant 0.41
gyrA 6811 c.-491C>T upstream_gene_variant 0.37
gyrA 6824 c.-478C>T upstream_gene_variant 0.38
gyrA 6841 c.-461T>C upstream_gene_variant 0.34
gyrA 6856 c.-446T>C upstream_gene_variant 0.35
gyrA 6862 c.-440C>G upstream_gene_variant 0.29
gyrA 6866 c.-436C>T upstream_gene_variant 0.27
gyrA 6869 c.-433T>C upstream_gene_variant 0.25
gyrA 6872 c.-430T>C upstream_gene_variant 0.26
gyrA 6889 c.-413G>T upstream_gene_variant 0.19
gyrA 6976 c.-326A>G upstream_gene_variant 0.16
gyrA 6982 c.-320A>G upstream_gene_variant 0.15
gyrA 7006 c.-296T>G upstream_gene_variant 0.15
gyrB 7010 p.Leu591Met missense_variant 0.19
gyrA 7018 c.-284G>C upstream_gene_variant 0.21
gyrA 7024 c.-278G>C upstream_gene_variant 0.22
gyrA 7033 c.-269G>C upstream_gene_variant 0.23
gyrB 7051 p.Glu604Asp missense_variant 0.25
gyrA 7066 c.-236G>C upstream_gene_variant 0.24
gyrA 7072 c.-230G>A upstream_gene_variant 0.26
gyrA 7078 c.-224A>T upstream_gene_variant 0.26
gyrA 7084 c.-218A>G upstream_gene_variant 0.26
gyrA 7090 c.-212C>T upstream_gene_variant 0.27
gyrA 7093 c.-209T>C upstream_gene_variant 0.27
gyrA 7099 c.-203G>A upstream_gene_variant 0.3
gyrA 7100 c.-202T>C upstream_gene_variant 0.3
gyrA 7120 c.-182T>C upstream_gene_variant 0.32
gyrA 7123 c.-179C>G upstream_gene_variant 0.29
gyrA 7126 c.-176G>C upstream_gene_variant 0.27
gyrA 7129 c.-173T>G upstream_gene_variant 0.26
gyrA 7136 c.-166T>C upstream_gene_variant 0.26
gyrA 7144 c.-158A>G upstream_gene_variant 0.29
gyrA 7150 c.-152G>A upstream_gene_variant 0.31
gyrA 7153 c.-149G>C upstream_gene_variant 0.31
gyrA 7159 c.-143C>T upstream_gene_variant 0.24
gyrA 7162 c.-140C>G upstream_gene_variant 0.23
gyrA 7168 c.-134C>G upstream_gene_variant 0.24
gyrA 7178 c.-124T>C upstream_gene_variant 0.23
gyrA 7186 c.-116C>G upstream_gene_variant 0.21
gyrA 7189 c.-113C>T upstream_gene_variant 0.18
gyrB 7210 p.Asp657Glu missense_variant 0.19
gyrA 7216 c.-86G>C upstream_gene_variant 0.17
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7391 c.90C>T synonymous_variant 0.17
gyrA 7394 c.93T>C synonymous_variant 0.17
gyrA 7397 c.96G>C synonymous_variant 0.17
gyrA 7412 c.111C>G synonymous_variant 0.29
gyrA 7421 c.120G>C synonymous_variant 0.33
gyrA 7427 c.126G>C synonymous_variant 0.38
gyrA 7430 c.129G>A synonymous_variant 0.36
gyrA 7442 c.141G>C synonymous_variant 0.41
gyrA 7457 c.156T>C synonymous_variant 0.44
gyrA 7463 c.162G>C synonymous_variant 0.43
gyrA 7466 c.165G>C synonymous_variant 0.43
gyrA 7469 c.168C>T synonymous_variant 0.43
gyrA 7472 c.171T>C synonymous_variant 0.46
gyrA 7475 c.174A>G synonymous_variant 0.46
gyrA 7480 p.Phe60Tyr missense_variant 0.46
gyrA 7484 c.183T>C synonymous_variant 0.48
gyrA 7490 c.189C>G synonymous_variant 0.48
gyrA 7496 c.195C>G synonymous_variant 0.52
gyrA 7499 c.198G>C synonymous_variant 0.54
gyrA 7523 c.222C>G synonymous_variant 0.47
gyrA 7526 c.225G>C synonymous_variant 0.47
gyrA 7532 c.231T>G synonymous_variant 0.46
gyrA 7559 c.258G>A synonymous_variant 0.41
gyrA 7571 c.270G>C synonymous_variant 0.35
gyrA 7574 c.273G>C synonymous_variant 0.35
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 7587 c.286C>T synonymous_variant 0.26
gyrA 7595 c.294C>T synonymous_variant 0.29
gyrA 7601 c.300C>G synonymous_variant 0.29
gyrA 7619 c.318C>T synonymous_variant 0.34
gyrA 7640 c.339G>A synonymous_variant 0.27
gyrA 7643 c.342C>A synonymous_variant 0.26
gyrA 7652 c.351C>T synonymous_variant 0.21
gyrA 7658 c.357A>G synonymous_variant 0.15
gyrA 7787 c.486G>A synonymous_variant 0.15
gyrA 7793 c.492G>C synonymous_variant 0.19
gyrA 7799 c.498A>G synonymous_variant 0.18
gyrA 7802 c.501C>G synonymous_variant 0.19
gyrA 7814 c.513C>G synonymous_variant 0.19
gyrA 7831 c.531_532delGT frameshift_variant 0.2
gyrA 7847 c.546G>C synonymous_variant 0.19
gyrA 7853 c.552C>T synonymous_variant 0.17
gyrA 7859 c.558A>C synonymous_variant 0.18
gyrA 7865 c.564T>C synonymous_variant 0.18
gyrA 7868 p.Ile189Met missense_variant 0.18
gyrA 7890 c.589C>T synonymous_variant 0.17
gyrA 8837 c.1536C>A synonymous_variant 0.15
gyrA 8852 c.1551T>C synonymous_variant 0.24
gyrA 8858 c.1557T>C synonymous_variant 0.28
gyrA 8870 c.1569G>C synonymous_variant 0.36
gyrA 8897 c.1596T>C synonymous_variant 0.36
gyrA 8915 c.1614A>G synonymous_variant 0.39
gyrA 8924 c.1623C>T synonymous_variant 0.38
gyrA 8945 c.1644G>C synonymous_variant 0.46
gyrA 8946 c.1645_1647delTTGinsCTC synonymous_variant 0.46
gyrA 8967 p.Ala556Lys missense_variant 0.44
gyrA 8990 c.1689C>G synonymous_variant 0.44
gyrA 8993 c.1692C>T synonymous_variant 0.45
gyrA 8996 c.1695T>C synonymous_variant 0.45
gyrA 8998 p.Leu566Trp missense_variant 0.44
gyrA 9018 p.Gln573Lys missense_variant 0.37
gyrA 9023 c.1722A>T synonymous_variant 0.32
gyrA 9026 c.1725G>C synonymous_variant 0.31
gyrA 9029 c.1728T>C synonymous_variant 0.3
gyrA 9032 c.1731T>C synonymous_variant 0.3
gyrA 9035 c.1734G>C synonymous_variant 0.31
gyrA 9044 c.1743C>G synonymous_variant 0.31
gyrA 9051 c.1750T>C synonymous_variant 0.31
gyrA 9063 p.Ser588Ala missense_variant 0.25
gyrA 9068 c.1767G>C synonymous_variant 0.23
gyrA 9071 c.1770G>C synonymous_variant 0.23
gyrA 9080 c.1779G>C synonymous_variant 0.17
gyrA 9304 p.Gly668Asp missense_variant 1.0
gyrA 9753 p.Asn818Asp missense_variant 1.0
fgd1 491591 p.Lys270Met missense_variant 1.0
mshA 575679 p.Asn111Ser missense_variant 1.0
mshA 575705 c.358_360delTTGinsCTA synonymous_variant 0.14
mshA 575734 c.387T>G synonymous_variant 0.13
mshA 575744 p.Ala133Thr missense_variant 0.18
mshA 575756 c.409C>T synonymous_variant 0.17
rpoB 760115 c.309C>T synonymous_variant 0.94
rpoB 760184 c.378A>G synonymous_variant 0.27
rpoB 760196 c.390C>G synonymous_variant 0.28
rpoB 760223 c.417T>C synonymous_variant 0.34
rpoB 760235 c.429T>C synonymous_variant 0.4
rpoB 760244 c.438G>C synonymous_variant 0.46
rpoB 760274 p.Glu156Asp missense_variant 0.47
rpoB 760276 p.Lys157Met missense_variant 0.47
rpoB 760283 c.477G>C synonymous_variant 0.45
rpoB 760298 c.492G>C synonymous_variant 0.44
rpoB 760307 c.501T>C synonymous_variant 0.42
rpoB 760313 c.507G>C synonymous_variant 0.39
rpoB 760316 c.510C>G synonymous_variant 0.39
rpoB 760317 c.511_513delAGCinsTCG synonymous_variant 0.39
rpoB 760325 c.519G>C synonymous_variant 0.38
rpoB 760328 c.522G>C synonymous_variant 0.38
rpoB 760331 c.525G>T synonymous_variant 0.38
rpoB 760340 c.534G>C synonymous_variant 0.42
rpoB 760343 c.537G>C synonymous_variant 0.39
rpoB 760357 p.Thr184Asn missense_variant 0.42
rpoB 760361 c.555T>C synonymous_variant 0.41
rpoB 760370 c.564C>G synonymous_variant 0.43
rpoB 760376 p.Asp190Glu missense_variant 0.47
rpoB 760382 c.576G>C synonymous_variant 0.41
rpoB 760400 c.594G>C synonymous_variant 0.27
rpoB 760406 c.600G>C synonymous_variant 0.26
rpoB 760407 p.Ser201Gly missense_variant 0.26
rpoB 760412 c.606C>T synonymous_variant 0.28
rpoB 760415 c.609C>T synonymous_variant 0.29
rpoB 760418 c.612G>A synonymous_variant 0.29
rpoB 760430 c.624T>C synonymous_variant 0.28
rpoB 760433 c.627C>T synonymous_variant 0.29
rpoB 760454 c.648C>G synonymous_variant 0.33
rpoB 760457 c.651C>T synonymous_variant 0.33
rpoB 760469 c.663C>T synonymous_variant 0.34
rpoB 760475 c.669A>G synonymous_variant 0.34
rpoB 760478 c.672C>T synonymous_variant 0.34
rpoB 760481 c.675G>T synonymous_variant 0.34
rpoB 760484 c.678A>G synonymous_variant 0.33
rpoB 760487 c.681G>C synonymous_variant 0.32
rpoB 760502 c.696C>G synonymous_variant 0.47
rpoB 760508 c.702G>A synonymous_variant 0.44
rpoB 760511 c.705G>C synonymous_variant 0.47
rpoB 760522 p.Ser239Asn missense_variant 0.5
rpoB 760532 c.726T>C synonymous_variant 0.54
rpoB 760541 c.735G>T synonymous_variant 0.51
rpoB 760561 c.757_758delCG frameshift_variant 0.57
rpoB 760571 c.765G>C synonymous_variant 0.51
rpoB 760588 p.Thr261Ile missense_variant 0.47
rpoB 760591 p.Val262Ala missense_variant 0.46
rpoB 760595 c.789C>T synonymous_variant 0.45
rpoB 760596 p.Thr264Pro missense_variant 0.44
rpoB 760607 c.801G>C synonymous_variant 0.47
rpoB 760611 c.805T>C synonymous_variant 0.47
rpoB 760634 c.828T>C synonymous_variant 0.43
rpoB 760646 c.840C>G synonymous_variant 0.34
rpoB 760655 c.849A>G synonymous_variant 0.31
rpoB 760661 c.855A>C synonymous_variant 0.26
rpoB 760668 p.Thr288Ala missense_variant 0.24
rpoB 760674 c.868T>C synonymous_variant 0.19
rpoB 760679 c.873A>G synonymous_variant 0.18
rpoB 760817 c.1011A>G synonymous_variant 0.24
rpoB 760820 c.1014T>C synonymous_variant 0.29
rpoB 760826 c.1020C>G synonymous_variant 0.29
rpoB 760830 c.1024T>C synonymous_variant 0.32
rpoB 760841 c.1035T>C synonymous_variant 0.35
rpoB 760858 p.Val351Ala missense_variant 0.34
rpoB 760862 c.1056G>C synonymous_variant 0.35
rpoB 760869 p.Val355Leu missense_variant 0.36
rpoB 760877 c.1071G>C synonymous_variant 0.35
rpoB 760883 c.1077G>C synonymous_variant 0.35
rpoB 760886 c.1080A>G synonymous_variant 0.35
rpoB 760887 p.Thr361Val missense_variant 0.35
rpoB 760910 c.1104C>T synonymous_variant 0.42
rpoB 760916 c.1110C>T synonymous_variant 0.47
rpoB 760919 c.1113C>T synonymous_variant 0.47
rpoB 760928 c.1122G>C synonymous_variant 0.43
rpoB 760946 c.1140A>G synonymous_variant 0.49
rpoB 760965 p.Met387Leu missense_variant 0.45
rpoB 760973 c.1167G>T synonymous_variant 0.44
rpoB 760982 c.1176G>C synonymous_variant 0.45
rpoB 760985 c.1179G>C synonymous_variant 0.44
rpoB 760988 c.1182C>G synonymous_variant 0.44
rpoB 760991 c.1185G>T synonymous_variant 0.45
rpoB 760997 c.1191G>C synonymous_variant 0.49
rpoB 761006 c.1200C>T synonymous_variant 0.47
rpoB 761015 c.1209G>C synonymous_variant 0.47
rpoB 761027 c.1221A>C synonymous_variant 0.55
rpoB 761036 c.1230G>C synonymous_variant 0.57
rpoB 761037 c.1231T>C synonymous_variant 0.59
rpoB 761051 c.1245G>T synonymous_variant 0.58
rpoB 761054 c.1248G>C synonymous_variant 0.56
rpoB 761057 c.1251G>C synonymous_variant 0.56
rpoB 761060 c.1254C>G synonymous_variant 0.54
rpoB 761063 c.1257C>G synonymous_variant 0.52
rpoB 761084 c.1278C>A synonymous_variant 0.56
rpoB 761097 c.1291_1293delAGCinsTCG synonymous_variant 0.49
rpoB 761102 c.1296A>G synonymous_variant 0.49
rpoB 761126 c.1320G>T synonymous_variant 0.43
rpoB 761132 c.1326G>T synonymous_variant 0.42
rpoB 761133 c.1327T>C synonymous_variant 0.44
rpoB 761147 c.1341C>T synonymous_variant 0.44
rpoB 761150 c.1344A>T synonymous_variant 0.44
rpoB 761159 c.1353G>T synonymous_variant 0.45
rpoB 761165 c.1359G>C synonymous_variant 0.43
rpoB 761171 c.1365C>T synonymous_variant 0.41
rpoB 761178 p.Ser458Thr missense_variant 0.37
rpoB 761186 p.Glu460Asp missense_variant 0.34
rpoB 761189 c.1383T>C synonymous_variant 0.34
rpoB 761192 c.1386C>T synonymous_variant 0.33
rpoB 761195 c.1389G>C synonymous_variant 0.33
rpoB 761198 c.1392G>T synonymous_variant 0.34
rpoB 761219 c.1413G>C synonymous_variant 0.3
rpoB 761234 c.1428G>C synonymous_variant 0.27
rpoB 761249 c.1443A>G synonymous_variant 0.24
rpoB 761255 c.1449T>G synonymous_variant 0.21
rpoB 761258 c.1452G>A synonymous_variant 0.19
rpoB 761261 c.1455G>C synonymous_variant 0.19
rpoB 761264 c.1458C>G synonymous_variant 0.2
rpoB 761273 c.1467T>C synonymous_variant 0.2
rpoB 761282 c.1476C>T synonymous_variant 0.2
rpoB 761288 c.1482G>T synonymous_variant 0.17
rpoB 761318 c.1512G>C synonymous_variant 0.19
rpoB 761327 c.1521A>G synonymous_variant 0.19
rpoB 761346 p.Val514Ser missense_variant 0.17
rpoB 761351 p.Asp515Glu missense_variant 0.18
rpoB 761354 c.1548C>T synonymous_variant 0.17
rpoB 761357 c.1551G>C synonymous_variant 0.17
rpoB 761360 c.1554T>C synonymous_variant 0.17
rpoB 761362 p.Ser519Thr missense_variant 0.18
rpoB 761373 p.Val523His missense_variant 0.2
rpoB 761393 c.1587G>A synonymous_variant 0.18
rpoB 761408 c.1602G>C synonymous_variant 0.17
rpoB 761537 c.1731C>G synonymous_variant 0.21
rpoB 761555 c.1749G>C synonymous_variant 0.33
rpoB 761558 c.1752C>G synonymous_variant 0.33
rpoB 761564 c.1758G>C synonymous_variant 0.37
rpoB 761570 c.1764T>C synonymous_variant 0.38
rpoB 761573 c.1767C>G synonymous_variant 0.38
rpoB 761579 c.1773G>C synonymous_variant 0.42
rpoB 761612 c.1806G>T synonymous_variant 0.41
rpoB 761615 c.1809A>C synonymous_variant 0.41
rpoB 761636 c.1830G>T synonymous_variant 0.47
rpoB 761645 c.1839C>G synonymous_variant 0.49
rpoB 761648 c.1842T>C synonymous_variant 0.52
rpoB 761666 c.1860G>C synonymous_variant 0.44
rpoB 761669 c.1863C>T synonymous_variant 0.46
rpoB 761675 c.1869G>T synonymous_variant 0.47
rpoB 761687 c.1881C>T synonymous_variant 0.43
rpoB 761690 c.1884G>C synonymous_variant 0.4
rpoB 761693 c.1887G>C synonymous_variant 0.42
rpoB 761717 c.1911C>T synonymous_variant 0.39
rpoB 761727 p.Ser641Gly missense_variant 0.38
rpoB 761728 c.1923dupC frameshift_variant 0.38
rpoB 761732 c.1926C>T synonymous_variant 0.37
rpoB 761741 c.1935G>A synonymous_variant 0.36
rpoB 761750 c.1944G>C synonymous_variant 0.38
rpoB 761760 p.Ile652Val missense_variant 0.37
rpoB 761765 c.1959T>C synonymous_variant 0.36
rpoB 761772 p.His656Ala missense_variant 0.33
rpoB 761778 p.Asn658Asp missense_variant 0.31
rpoB 761789 c.1983G>C synonymous_variant 0.24
rpoB 761791 p.Arg662Gln missense_variant 0.25
rpoB 761794 p.Thr663Ser missense_variant 0.24
rpoB 761802 p.Met666Leu missense_variant 0.26
rpoB 761813 c.2007T>C synonymous_variant 0.22
rpoB 761819 c.2013G>T synonymous_variant 0.16
rpoB 761881 p.Ala692Val missense_variant 0.15
rpoB 761891 c.2085G>C synonymous_variant 0.17
rpoB 761906 c.2100C>T synonymous_variant 0.21
rpoB 761909 c.2103T>C synonymous_variant 0.21
rpoB 761912 c.2106T>C synonymous_variant 0.21
rpoB 761915 p.Asp703Glu missense_variant 0.21
rpoB 761916 p.Asp704Asn missense_variant 0.21
rpoB 761924 c.2118G>A synonymous_variant 0.25
rpoB 761930 c.2124G>C synonymous_variant 0.25
rpoB 761933 c.2127G>C synonymous_variant 0.25
rpoB 761936 c.2130C>T synonymous_variant 0.25
rpoB 761948 c.2142G>C synonymous_variant 0.3
rpoB 761954 c.2148C>T synonymous_variant 0.31
rpoB 761955 p.Ile717Val missense_variant 0.31
rpoB 761969 c.2163G>A synonymous_variant 0.32
rpoB 761990 c.2184G>C synonymous_variant 0.32
rpoB 762008 c.2202C>T synonymous_variant 0.32
rpoB 762014 c.2208C>G synonymous_variant 0.35
rpoB 762038 c.2232C>T synonymous_variant 0.29
rpoB 762047 c.2241G>A synonymous_variant 0.28
rpoB 762053 c.2247T>C synonymous_variant 0.28
rpoB 762056 c.2250G>A synonymous_variant 0.3
rpoB 762065 c.2259T>G synonymous_variant 0.31
rpoB 762083 c.2277T>C synonymous_variant 0.32
rpoB 762086 c.2280G>T synonymous_variant 0.32
rpoB 762101 c.2295C>G synonymous_variant 0.31
rpoB 762114 p.Ile770Val missense_variant 0.31
rpoB 762122 c.2316C>T synonymous_variant 0.29
rpoB 762131 c.2325C>G synonymous_variant 0.29
rpoB 762134 c.2328C>A synonymous_variant 0.29
rpoB 762137 c.2331C>T synonymous_variant 0.29
rpoB 762140 c.2334G>C synonymous_variant 0.29
rpoB 762143 c.2337T>C synonymous_variant 0.34
rpoB 762149 c.2343G>C synonymous_variant 0.36
rpoB 762158 c.2352G>C synonymous_variant 0.4
rpoB 762167 c.2361T>C synonymous_variant 0.41
rpoB 762176 c.2370T>C synonymous_variant 0.44
rpoB 762185 c.2379G>C synonymous_variant 0.43
rpoB 762194 c.2388G>C synonymous_variant 0.47
rpoB 762221 c.2415G>A synonymous_variant 0.44
rpoB 762233 c.2427G>C synonymous_variant 0.43
rpoB 762236 c.2430G>C synonymous_variant 0.43
rpoB 762245 c.2439G>C synonymous_variant 0.44
rpoB 762284 c.2478G>T synonymous_variant 0.28
rpoB 762293 c.2487T>C synonymous_variant 0.27
rpoB 762296 c.2490G>C synonymous_variant 0.17
rpoC 762830 c.-540C>T upstream_gene_variant 0.17
rpoC 762836 c.-534C>T upstream_gene_variant 0.17
rpoC 762857 c.-513C>G upstream_gene_variant 0.26
rpoC 762860 c.-510G>C upstream_gene_variant 0.25
rpoC 762863 c.-507T>C upstream_gene_variant 0.29
rpoB 762879 p.Met1025Leu missense_variant 0.32
rpoC 762894 c.-476C>T upstream_gene_variant 0.33
rpoC 762899 c.-471G>C upstream_gene_variant 0.35
rpoC 762911 c.-459C>T upstream_gene_variant 0.34
rpoC 762917 c.-453C>G upstream_gene_variant 0.31
rpoC 762920 c.-450C>T upstream_gene_variant 0.32
rpoC 762923 c.-447C>G upstream_gene_variant 0.32
rpoC 762959 c.-411G>C upstream_gene_variant 0.33
rpoC 762962 c.-408C>T upstream_gene_variant 0.36
rpoC 762983 c.-387C>T upstream_gene_variant 0.39
rpoC 762989 c.-381G>A upstream_gene_variant 0.39
rpoC 762995 c.-375G>T upstream_gene_variant 0.39
rpoC 763031 c.-339T>G upstream_gene_variant 0.4
rpoC 763034 c.-336C>A upstream_gene_variant 0.4
rpoC 763040 c.-330C>G upstream_gene_variant 0.41
rpoC 763070 c.-300T>C upstream_gene_variant 0.44
rpoC 763082 c.-288C>T upstream_gene_variant 0.48
rpoC 763085 c.-285C>T upstream_gene_variant 0.48
rpoC 763088 c.-282C>G upstream_gene_variant 0.47
rpoC 763094 c.-276G>C upstream_gene_variant 0.5
rpoC 763115 c.-255T>C upstream_gene_variant 0.45
rpoC 763127 c.-243G>C upstream_gene_variant 0.44
rpoC 763136 c.-234C>T upstream_gene_variant 0.39
rpoC 763142 c.-228C>G upstream_gene_variant 0.44
rpoC 763157 c.-213G>T upstream_gene_variant 0.4
rpoC 763166 c.-204A>G upstream_gene_variant 0.38
rpoC 763172 c.-198G>C upstream_gene_variant 0.35
rpoC 763187 c.-183C>G upstream_gene_variant 0.29
rpoC 763193 c.-177C>G upstream_gene_variant 0.26
rpoC 763202 c.-168A>G upstream_gene_variant 0.27
rpoC 763205 c.-165G>C upstream_gene_variant 0.2
rpoB 763207 p.Ser1134Lys missense_variant 0.2
rpoC 763214 c.-156T>C upstream_gene_variant 0.19
rpoC 763217 c.-153G>C upstream_gene_variant 0.21
rpoC 763220 c.-150G>C upstream_gene_variant 0.22
rpoB 763227 p.Leu1141Met missense_variant 0.22
rpoB 763235 p.Glu1143Asp missense_variant 0.2
rpoC 763238 c.-132T>C upstream_gene_variant 0.2
rpoB 763241 p.Glu1145Asp missense_variant 0.2
rpoC 763259 c.-111G>C upstream_gene_variant 0.16
rpoC 763262 c.-108C>T upstream_gene_variant 0.16
rpoC 763265 c.-105G>C upstream_gene_variant 0.16
rpoC 763268 c.-102C>G upstream_gene_variant 0.16
rpoC 763375 c.6C>G synonymous_variant 0.18
rpoC 763402 c.33C>T synonymous_variant 0.24
rpoC 763408 c.39T>C synonymous_variant 0.24
rpoC 763411 c.42T>C synonymous_variant 0.24
rpoC 763414 c.45T>G synonymous_variant 0.24
rpoC 763415 p.Thr16Ser missense_variant 0.24
rpoC 763423 p.Glu18Asp missense_variant 0.24
rpoC 763430 c.61_63delAGGinsCGT synonymous_variant 0.24
rpoC 763433 p.Gln22Asn missense_variant 0.25
rpoC 763443 p.Tyr25Phe missense_variant 0.25
rpoC 763450 c.81G>A synonymous_variant 0.31
rpoC 763456 c.87A>G synonymous_variant 0.33
rpoC 763468 c.99G>C synonymous_variant 0.35
rpoC 763486 c.117T>C synonymous_variant 0.44
rpoC 763492 c.123G>C synonymous_variant 0.5
rpoC 763528 c.159G>A synonymous_variant 0.53
rpoC 763531 c.162G>T synonymous_variant 0.52
rpoC 763546 c.177A>G synonymous_variant 0.55
rpoC 763570 c.201G>C synonymous_variant 0.61
rpoC 763594 c.225C>T synonymous_variant 0.51
rpoC 763618 c.249C>T synonymous_variant 0.48
rpoC 763633 c.264T>C synonymous_variant 0.52
rpoC 763660 c.291T>G synonymous_variant 0.47
rpoC 763666 c.297G>C synonymous_variant 0.47
rpoC 763669 c.300C>G synonymous_variant 0.46
rpoC 763675 c.306C>G synonymous_variant 0.47
rpoC 763699 c.330G>T synonymous_variant 0.42
rpoC 763702 c.333C>G synonymous_variant 0.42
rpoC 763708 c.339G>T synonymous_variant 0.42
rpoC 763711 c.342G>C synonymous_variant 0.41
rpoC 763714 c.345G>A synonymous_variant 0.42
rpoC 763717 c.348T>C synonymous_variant 0.42
rpoC 763723 c.354G>C synonymous_variant 0.42
rpoC 763732 c.363C>G synonymous_variant 0.42
rpoC 763741 c.372C>T synonymous_variant 0.41
rpoC 763747 c.378G>A synonymous_variant 0.39
rpoC 763765 c.396T>C synonymous_variant 0.29
rpoC 763768 c.399C>T synonymous_variant 0.29
rpoC 763774 c.405G>C synonymous_variant 0.3
rpoC 763781 p.Ser138Ala missense_variant 0.26
rpoC 763792 p.Glu141Asp missense_variant 0.19
rpoC 764317 c.948C>G synonymous_variant 0.21
rpoC 764320 c.951C>A synonymous_variant 0.21
rpoC 764339 c.970C>T synonymous_variant 0.28
rpoC 764344 c.975C>T synonymous_variant 0.3
rpoC 764353 c.984G>T synonymous_variant 0.36
rpoC 764365 c.996C>T synonymous_variant 0.44
rpoC 764371 c.1002G>T synonymous_variant 0.44
rpoC 764377 c.1008C>G synonymous_variant 0.41
rpoC 764380 c.1011G>C synonymous_variant 0.39
rpoC 764383 c.1014C>T synonymous_variant 0.39
rpoC 764387 c.1018T>C synonymous_variant 0.39
rpoC 764405 c.1036_1038delAGGinsCGC synonymous_variant 0.42
rpoC 764428 c.1059G>C synonymous_variant 0.45
rpoC 764431 c.1062G>C synonymous_variant 0.45
rpoC 764434 c.1065A>G synonymous_variant 0.44
rpoC 764435 c.1066_1068delAGGinsCGA synonymous_variant 0.45
rpoC 764458 c.1089G>C synonymous_variant 0.51
rpoC 764461 c.1092A>G synonymous_variant 0.5
rpoC 764497 c.1128A>G synonymous_variant 0.41
rpoC 764506 c.1137C>T synonymous_variant 0.37
rpoC 764527 c.1158C>T synonymous_variant 0.41
rpoC 764530 c.1161C>T synonymous_variant 0.42
rpoC 764533 c.1164C>A synonymous_variant 0.42
rpoC 764536 c.1167G>T synonymous_variant 0.41
rpoC 764539 c.1170C>G synonymous_variant 0.41
rpoC 764548 c.1179G>A synonymous_variant 0.4
rpoC 764554 c.1185C>T synonymous_variant 0.39
rpoC 764566 c.1197C>G synonymous_variant 0.44
rpoC 764575 c.1206T>G synonymous_variant 0.41
rpoC 764578 c.1209C>G synonymous_variant 0.38
rpoC 764593 c.1224C>T synonymous_variant 0.37
rpoC 764602 c.1233C>T synonymous_variant 0.35
rpoC 764611 c.1242G>T synonymous_variant 0.31
rpoC 764626 c.1257C>T synonymous_variant 0.3
rpoC 764632 c.1263T>C synonymous_variant 0.3
rpoC 764635 c.1266C>T synonymous_variant 0.31
rpoC 764650 c.1281G>T synonymous_variant 0.42
rpoC 764713 c.1344G>T synonymous_variant 0.47
rpoC 764746 c.1377G>T synonymous_variant 0.54
rpoC 764752 c.1383G>C synonymous_variant 0.55
rpoC 764758 c.1389C>G synonymous_variant 0.52
rpoC 764764 c.1395T>C synonymous_variant 0.55
rpoC 764803 c.1434C>T synonymous_variant 0.46
rpoC 764810 p.Pro481Ala missense_variant 0.46
rpoC 764815 c.1446A>G synonymous_variant 0.49
rpoC 764827 c.1458G>C synonymous_variant 0.47
rpoC 764858 c.1489T>C synonymous_variant 0.54
rpoC 764869 c.1500C>T synonymous_variant 0.53
rpoC 764875 c.1506C>A synonymous_variant 0.49
rpoC 764878 c.1509C>G synonymous_variant 0.47
rpoC 764887 c.1518G>C synonymous_variant 0.46
rpoC 764888 c.1519T>C synonymous_variant 0.46
rpoC 764911 c.1542A>G synonymous_variant 0.39
rpoC 764912 p.Met515Gln missense_variant 0.39
rpoC 764932 c.1563C>A synonymous_variant 0.31
rpoC 764948 c.1579T>C synonymous_variant 0.29
rpoC 764968 c.1599T>C synonymous_variant 0.28
rpoC 765007 c.1638T>G synonymous_variant 0.2
rpoC 765008 c.1639T>C synonymous_variant 0.2
rpoC 765011 c.1642_1644delAGCinsTCG synonymous_variant 0.2
rpoC 765016 c.1647C>G synonymous_variant 0.19
rpoC 765019 c.1650A>G synonymous_variant 0.2
rpoC 765040 c.1671T>C synonymous_variant 0.21
rpoC 765041 c.1672T>C synonymous_variant 0.21
rpoC 765047 c.1678T>C synonymous_variant 0.2
rpoC 765055 c.1686C>G synonymous_variant 0.22
rpoC 765073 c.1704G>C synonymous_variant 0.21
rpoC 765076 c.1707A>G synonymous_variant 0.2
rpoC 765079 c.1710T>G synonymous_variant 0.2
rpoC 765082 c.1713G>C synonymous_variant 0.21
rpoC 765085 c.1716T>C synonymous_variant 0.22
rpoC 765089 c.1720T>C synonymous_variant 0.24
rpoC 765103 c.1734G>T synonymous_variant 0.2
rpoC 765121 c.1752G>T synonymous_variant 0.14
rpoC 765150 p.Gly594Glu missense_variant 0.93
rpoC 765343 c.1974G>A synonymous_variant 0.16
rpoC 765352 c.1983G>C synonymous_variant 0.22
rpoC 765356 p.Met663Val missense_variant 0.24
rpoC 765379 c.2010G>C synonymous_variant 0.31
rpoC 765383 p.Met672Leu missense_variant 0.31
rpoC 765394 c.2025G>A synonymous_variant 0.35
rpoC 765403 c.2034G>C synonymous_variant 0.33
rpoC 765405 p.Leu679His missense_variant 0.31
rpoC 765409 c.2040T>G synonymous_variant 0.32
rpoC 765412 c.2043T>C synonymous_variant 0.32
rpoC 765421 c.2052C>G synonymous_variant 0.32
rpoC 765449 p.Ala694Ser missense_variant 0.36
rpoC 765454 c.2085C>G synonymous_variant 0.37
rpoC 765469 c.2100G>C synonymous_variant 0.37
rpoC 765478 c.2109T>G synonymous_variant 0.31
rpoC 765480 p.Tyr704Phe missense_variant 0.32
rpoC 765496 c.2127C>T synonymous_variant 0.32
rpoC 765499 c.2130C>G synonymous_variant 0.29
rpoC 765529 c.2160C>T synonymous_variant 0.26
rpoC 765533 p.Tyr722His missense_variant 0.25
rpoC 765868 c.2499G>A synonymous_variant 0.21
rpoC 765871 c.2502T>G synonymous_variant 0.21
rpoC 765875 p.Val836Ile missense_variant 0.22
rpoC 765886 c.2517C>G synonymous_variant 0.24
rpoC 765907 c.2538G>T synonymous_variant 0.28
rpoC 765928 c.2559C>G synonymous_variant 0.31
rpoC 765937 c.2568T>C synonymous_variant 0.32
rpoC 765940 c.2571A>T synonymous_variant 0.33
rpoC 765946 c.2577C>T synonymous_variant 0.33
rpoC 765947 c.2578T>C synonymous_variant 0.33
rpoC 765962 c.2593_2595delTTGinsCTT synonymous_variant 0.36
rpoC 765973 c.2604C>T synonymous_variant 0.39
rpoC 765979 c.2610C>G synonymous_variant 0.37
rpoC 765982 c.2613C>T synonymous_variant 0.38
rpoC 765994 c.2625A>T synonymous_variant 0.34
rpoC 766009 c.2640G>C synonymous_variant 0.23
rpoC 766012 c.2643C>G synonymous_variant 0.23
rpoC 766021 c.2652G>C synonymous_variant 0.2
rpoC 766027 c.2658G>C synonymous_variant 0.16
rpoC 766309 c.2940G>C synonymous_variant 0.15
rpoC 766312 c.2943T>C synonymous_variant 0.15
rpoC 766321 c.2952C>A synonymous_variant 0.16
rpoC 766333 c.2964G>T synonymous_variant 0.21
rpoC 766348 c.2979A>G synonymous_variant 0.19
rpoC 766351 c.2982C>G synonymous_variant 0.2
rpoC 766353 p.Val995Ala missense_variant 0.2
rpoC 766369 c.3000C>A synonymous_variant 0.17
rpoC 766375 c.3006C>G synonymous_variant 0.16
rpoC 766381 c.3012C>T synonymous_variant 0.17
rpoC 766384 c.3015A>G synonymous_variant 0.16
rpoC 766435 p.Glu1022Asp missense_variant 0.16
rpoC 766693 c.3324C>A synonymous_variant 0.15
rpoC 766702 c.3333G>C synonymous_variant 0.15
rpoC 766942 c.3573C>T synonymous_variant 0.15
rpoC 766945 c.3576A>C synonymous_variant 0.19
rpoC 766961 p.Gly1198Asn missense_variant 0.22
rpoC 766996 c.3627C>T synonymous_variant 0.19
rpoC 767002 c.3633G>C synonymous_variant 0.24
rpoC 767008 c.3639G>A synonymous_variant 0.26
rpoC 767044 c.3675G>C synonymous_variant 0.35
rpoC 767080 c.3711G>C synonymous_variant 0.29
rpoC 767098 c.3729T>C synonymous_variant 0.21
rpoC 767100 p.Lys1244Arg missense_variant 0.2
rpoC 767104 c.3735C>G synonymous_variant 0.2
rpoC 767107 c.3738C>T synonymous_variant 0.23
rpoC 767119 c.3750A>G synonymous_variant 0.27
rpoC 767125 c.3756G>C synonymous_variant 0.26
rpoC 767128 c.3759C>T synonymous_variant 0.27
rpoC 767134 c.3765C>T synonymous_variant 0.28
rpoC 767138 c.3769C>T synonymous_variant 0.28
rpoC 767149 c.3780C>T synonymous_variant 0.28
rpoC 767167 c.3798C>T synonymous_variant 0.35
rpoC 767180 p.Ala1271Ser missense_variant 0.33
rpoC 767188 c.3819G>A synonymous_variant 0.33
rpoC 767191 c.3822C>G synonymous_variant 0.33
rpoC 767197 c.3828G>A synonymous_variant 0.35
rpoC 767203 c.3834C>G synonymous_variant 0.36
rpoC 767206 c.3837C>G synonymous_variant 0.36
rpoC 767209 c.3840T>C synonymous_variant 0.38
rpoC 767212 c.3843G>C synonymous_variant 0.4
rpoC 767221 c.3852C>G synonymous_variant 0.41
rpoC 767230 c.3861G>T synonymous_variant 0.44
rpoC 767233 c.3864T>C synonymous_variant 0.43
rpoC 767254 c.3885G>C synonymous_variant 0.4
rpoC 767263 c.3894T>C synonymous_variant 0.37
rpoC 767264 p.Ala1299Ser missense_variant 0.37
rpoC 767267 p.Ala1300Asn missense_variant 0.35
rpoC 767281 c.3912C>G synonymous_variant 0.36
rpoC 767284 c.3915C>G synonymous_variant 0.34
rpoC 767302 c.3933C>A synonymous_variant 0.3
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rpsL 781572 p.Gln5Asn missense_variant 0.22
rpsL 781586 c.27C>T synonymous_variant 0.27
rpsL 781595 c.36T>C synonymous_variant 0.32
rpsL 781608 p.Ser17Ala missense_variant 0.27
rpsL 781616 c.57C>G synonymous_variant 0.29
rpsL 781628 c.69T>C synonymous_variant 0.29
rpsL 781631 c.72G>T synonymous_variant 0.29
rpsL 781649 c.90T>C synonymous_variant 0.33
rpsL 781655 c.96T>C synonymous_variant 0.3
rpsL 781658 c.99A>G synonymous_variant 0.31
rpsL 781670 c.111G>C synonymous_variant 0.31
rpsL 781682 c.123T>C synonymous_variant 0.34
rpsL 781706 c.147T>G synonymous_variant 0.32
rpsL 781715 c.156T>G synonymous_variant 0.31
rpsL 781721 c.162C>T synonymous_variant 0.27
rpsL 781725 p.Lys56Arg missense_variant 0.24
rpsL 781728 c.169T>C synonymous_variant 0.24
rpsL 781733 c.174G>C synonymous_variant 0.24
rpsL 781736 c.177T>C synonymous_variant 0.24
rpsL 781737 p.Gln60Ala missense_variant 0.24
rpsL 781742 c.183C>G synonymous_variant 0.26
rpsL 781751 c.192G>C synonymous_variant 0.26
rpsL 781754 c.195G>T synonymous_variant 0.28
rpsL 781760 c.201T>C synonymous_variant 0.27
rpsL 781763 c.204C>G synonymous_variant 0.27
rpsL 781766 c.207C>T synonymous_variant 0.27
rpsL 781802 c.243G>C synonymous_variant 0.43
rpsL 781808 c.249C>T synonymous_variant 0.34
rpsL 781811 c.252C>T synonymous_variant 0.34
rpsL 781814 c.255C>T synonymous_variant 0.33
rpsL 781817 c.258G>T synonymous_variant 0.32
rpsL 781829 c.270G>C synonymous_variant 0.24
rpsL 781832 c.273T>C synonymous_variant 0.26
rpsL 781859 c.300T>C synonymous_variant 0.23
rpsL 781868 c.309T>C synonymous_variant 0.22
rpsL 781871 c.312G>C synonymous_variant 0.22
rpsL 781877 c.318T>A synonymous_variant 0.22
rpsL 781892 c.333A>G synonymous_variant 0.22
rpsL 781898 c.339A>T synonymous_variant 0.24
rpsL 781907 c.348T>C synonymous_variant 0.22
rpsL 781916 c.357T>C synonymous_variant 0.19
rpsL 781929 p.Gly124Ser missense_variant 0.16
rpsL 781933 c.374G>A splice_region_variant&stop_retained_variant 0.16
rplC 800639 c.-170C>T upstream_gene_variant 0.2
rplC 800645 c.-164C>G upstream_gene_variant 0.22
rplC 800648 c.-161A>G upstream_gene_variant 0.21
rplC 800654 c.-155T>C upstream_gene_variant 0.26
rplC 800666 c.-143C>T upstream_gene_variant 0.26
rplC 800672 c.-137G>C upstream_gene_variant 0.26
rplC 800693 c.-116A>C upstream_gene_variant 0.24
rplC 800703 c.-106_-104delTTGinsCTC upstream_gene_variant 0.26
rplC 800715 c.-94A>C upstream_gene_variant 0.25
rplC 800720 c.-89T>C upstream_gene_variant 0.26
rplC 800723 c.-86C>G upstream_gene_variant 0.26
rplC 800735 c.-74C>G upstream_gene_variant 0.24
rplC 800747 c.-62C>T upstream_gene_variant 0.24
rplC 800762 c.-47T>G upstream_gene_variant 0.14
fbiC 1304502 c.1572G>A synonymous_variant 1.0
atpE 1461077 c.33C>T synonymous_variant 0.2
atpE 1461086 c.42A>G synonymous_variant 0.21
atpE 1461087 c.43C>T synonymous_variant 0.22
atpE 1461101 c.57T>C synonymous_variant 0.29
atpE 1461107 c.63C>G synonymous_variant 0.29
atpE 1461113 c.69C>T synonymous_variant 0.26
atpE 1461132 p.Val30Ile missense_variant 0.35
atpE 1461146 c.102G>C synonymous_variant 0.38
atpE 1461149 c.105T>G synonymous_variant 0.38
atpE 1461155 c.111C>G synonymous_variant 0.38
atpE 1461161 c.117C>G synonymous_variant 0.42
atpE 1461167 c.123G>T synonymous_variant 0.4
atpE 1461170 c.126A>G synonymous_variant 0.4
atpE 1461179 c.135G>T synonymous_variant 0.36
atpE 1461182 c.138A>G synonymous_variant 0.36
atpE 1461183 p.Gly47Ser missense_variant 0.36
atpE 1461197 c.153A>C synonymous_variant 0.32
atpE 1461219 c.175T>C synonymous_variant 0.29
atpE 1461233 c.189A>G synonymous_variant 0.17
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1471922 n.78delT non_coding_transcript_exon_variant 0.26
rrs 1471925 n.80T>C non_coding_transcript_exon_variant 0.26
rrs 1471931 n.87delA non_coding_transcript_exon_variant 0.28
rrs 1471934 n.89A>G non_coding_transcript_exon_variant 0.28
rrs 1471985 n.140T>C non_coding_transcript_exon_variant 0.39
rrs 1471986 n.141C>T non_coding_transcript_exon_variant 0.37
rrs 1472030 n.185G>A non_coding_transcript_exon_variant 0.2
rrs 1472031 n.186G>C non_coding_transcript_exon_variant 0.2
rrs 1472032 n.187G>A non_coding_transcript_exon_variant 0.2
rrs 1472033 n.188A>C non_coding_transcript_exon_variant 0.19
rrs 1472035 n.190G>T non_coding_transcript_exon_variant 0.19
rrs 1472040 n.195T>G non_coding_transcript_exon_variant 0.2
rrs 1472041 n.196C>T non_coding_transcript_exon_variant 0.2
rrs 1472042 n.197T>G non_coding_transcript_exon_variant 0.2
rrs 1472043 n.198T>A non_coding_transcript_exon_variant 0.2
rrs 1472050 n.205G>C non_coding_transcript_exon_variant 0.22
rrs 1472053 n.211_212delGC non_coding_transcript_exon_variant 0.22
rrs 1472061 n.216A>T non_coding_transcript_exon_variant 0.23
rrs 1472106 n.261G>A non_coding_transcript_exon_variant 0.33
rrs 1472108 n.263C>T non_coding_transcript_exon_variant 0.33
rrs 1472113 n.268T>C non_coding_transcript_exon_variant 0.31
rrs 1472150 n.305T>A non_coding_transcript_exon_variant 0.43
rrs 1472251 n.406G>A non_coding_transcript_exon_variant 0.37
rrs 1472286 n.441C>G non_coding_transcript_exon_variant 0.17
rrs 1472287 n.442C>T non_coding_transcript_exon_variant 0.17
rrs 1472289 n.444T>G non_coding_transcript_exon_variant 0.17
rrs 1472290 n.445C>G non_coding_transcript_exon_variant 0.17
rrs 1472297 n.453_465delGTCCGGGTTCTCT non_coding_transcript_exon_variant 0.22
rrs 1472315 n.470T>G non_coding_transcript_exon_variant 0.17
rrs 1472324 n.479G>C non_coding_transcript_exon_variant 0.17
rrs 1472325 n.480G>C non_coding_transcript_exon_variant 0.17
rrs 1472327 n.482G>A non_coding_transcript_exon_variant 0.17
rrs 1472328 n.483G>C non_coding_transcript_exon_variant 0.17
rrs 1472337 n.492C>G non_coding_transcript_exon_variant 0.19
rrs 1472380 n.535G>C non_coding_transcript_exon_variant 0.39
rrs 1472446 n.601T>A non_coding_transcript_exon_variant 0.47
rrs 1472452 n.607G>A non_coding_transcript_exon_variant 0.48
rrs 1472464 n.619A>G non_coding_transcript_exon_variant 0.59
rrs 1472612 n.767G>T non_coding_transcript_exon_variant 0.59
rrs 1472734 n.889C>T non_coding_transcript_exon_variant 0.48
rrs 1472741 n.896G>A non_coding_transcript_exon_variant 0.51
rrs 1472846 n.1001C>T non_coding_transcript_exon_variant 0.53
rrs 1472847 n.1002G>A non_coding_transcript_exon_variant 0.55
rrs 1472848 n.1003T>C non_coding_transcript_exon_variant 0.59
rrs 1472860 n.1015C>T non_coding_transcript_exon_variant 0.63
rrs 1472861 n.1016G>A non_coding_transcript_exon_variant 0.63
rrs 1472956 n.1111T>C non_coding_transcript_exon_variant 0.55
rrs 1472957 n.1112C>T non_coding_transcript_exon_variant 0.55
rrs 1472969 n.1124A>G non_coding_transcript_exon_variant 0.52
rrs 1472970 n.1125C>G non_coding_transcript_exon_variant 0.54
rrs 1472977 n.1132G>C non_coding_transcript_exon_variant 0.52
rrs 1472978 n.1133T>C non_coding_transcript_exon_variant 0.52
rrs 1472989 n.1144G>A non_coding_transcript_exon_variant 0.53
rrs 1472990 n.1145A>G non_coding_transcript_exon_variant 0.53
rrs 1473082 n.1237G>A non_coding_transcript_exon_variant 0.66
rrs 1473088 n.1243A>G non_coding_transcript_exon_variant 0.66
rrs 1473099 n.1254T>A non_coding_transcript_exon_variant 0.66
rrs 1473105 n.1260G>A non_coding_transcript_exon_variant 0.61
rrs 1473110 n.1265T>G non_coding_transcript_exon_variant 0.58
rrs 1473111 n.1266A>G non_coding_transcript_exon_variant 0.56
rrs 1473121 n.1276T>C non_coding_transcript_exon_variant 0.54
rrs 1473123 n.1278A>T non_coding_transcript_exon_variant 0.59
rrs 1473129 n.1284C>T non_coding_transcript_exon_variant 0.65
rrs 1473145 n.1300C>T non_coding_transcript_exon_variant 0.67
rrs 1473166 n.1321G>A non_coding_transcript_exon_variant 0.65
rrs 1473288 n.1443C>T non_coding_transcript_exon_variant 0.52
rrs 1473290 n.1445C>T non_coding_transcript_exon_variant 0.54
rrs 1473291 n.1446G>T non_coding_transcript_exon_variant 0.54
rrl 1473707 n.50T>A non_coding_transcript_exon_variant 0.21
rrl 1473717 n.60G>A non_coding_transcript_exon_variant 0.25
rrl 1473731 n.74T>A non_coding_transcript_exon_variant 0.24
rrl 1473746 n.89T>C non_coding_transcript_exon_variant 0.22
rrl 1473756 n.99G>T non_coding_transcript_exon_variant 0.24
rrl 1473758 n.101G>T non_coding_transcript_exon_variant 0.24
rrl 1473770 n.113T>G non_coding_transcript_exon_variant 0.35
rrl 1473806 n.149C>T non_coding_transcript_exon_variant 0.38
rrl 1473812 n.155G>A non_coding_transcript_exon_variant 0.41
rrl 1473814 n.157A>T non_coding_transcript_exon_variant 0.41
rrl 1473815 n.158T>G non_coding_transcript_exon_variant 0.41
rrl 1473829 n.172G>C non_coding_transcript_exon_variant 0.45
rrl 1473831 n.174G>T non_coding_transcript_exon_variant 0.45
rrl 1473832 n.175C>T non_coding_transcript_exon_variant 0.45
rrl 1473839 n.182G>A non_coding_transcript_exon_variant 0.43
rrl 1473876 n.219G>A non_coding_transcript_exon_variant 0.4
rrl 1473887 n.230T>C non_coding_transcript_exon_variant 0.37
rrl 1473888 n.231T>C non_coding_transcript_exon_variant 0.37
rrl 1473898 n.241C>T non_coding_transcript_exon_variant 0.39
rrl 1473899 n.242A>G non_coding_transcript_exon_variant 0.39
rrl 1473916 n.259C>A non_coding_transcript_exon_variant 0.27
rrl 1473923 n.266C>G non_coding_transcript_exon_variant 0.2
rrl 1473924 n.267_268insT non_coding_transcript_exon_variant 0.2
rrl 1473937 n.280C>T non_coding_transcript_exon_variant 0.15
rrl 1474056 n.399T>C non_coding_transcript_exon_variant 0.19
rrl 1474061 n.404T>C non_coding_transcript_exon_variant 0.28
rrl 1474074 n.417C>T non_coding_transcript_exon_variant 0.28
rrl 1474089 n.432C>T non_coding_transcript_exon_variant 0.24
rrl 1474093 n.436G>A non_coding_transcript_exon_variant 0.23
rrl 1474100 n.443C>T non_coding_transcript_exon_variant 0.22
rrl 1474103 n.446A>C non_coding_transcript_exon_variant 0.23
rrl 1474106 n.449_450insCT non_coding_transcript_exon_variant 0.17
rrl 1474109 n.453_454delAT non_coding_transcript_exon_variant 0.18
rrl 1474130 n.473C>T non_coding_transcript_exon_variant 0.23
rrl 1474140 n.483C>T non_coding_transcript_exon_variant 0.27
rrl 1474151 n.494C>T non_coding_transcript_exon_variant 0.29
rrl 1474181 n.524_525insT non_coding_transcript_exon_variant 0.23
rrl 1474184 n.527C>A non_coding_transcript_exon_variant 0.23
rrl 1474185 n.529delA non_coding_transcript_exon_variant 0.23
rrl 1474249 n.592G>T non_coding_transcript_exon_variant 0.26
rrl 1474263 n.606G>A non_coding_transcript_exon_variant 0.25
rrl 1474282 n.625G>A non_coding_transcript_exon_variant 0.2
rrl 1474356 n.699T>C non_coding_transcript_exon_variant 0.32
rrl 1474362 n.705A>G non_coding_transcript_exon_variant 0.38
rrl 1474376 n.719T>A non_coding_transcript_exon_variant 0.31
rrl 1474387 n.730C>T non_coding_transcript_exon_variant 0.32
rrl 1474413 n.756A>C non_coding_transcript_exon_variant 0.31
rrl 1474415 n.759_781delCACACGCGCATACGCGCGTGTGA non_coding_transcript_exon_variant 0.31
rrl 1474496 n.839C>G non_coding_transcript_exon_variant 0.4
rrl 1474497 n.840G>C non_coding_transcript_exon_variant 0.41
rrl 1474506 n.849C>G non_coding_transcript_exon_variant 0.41
rrl 1474507 n.850G>C non_coding_transcript_exon_variant 0.41
rrl 1474626 n.969T>C non_coding_transcript_exon_variant 0.31
rrl 1474630 n.973T>C non_coding_transcript_exon_variant 0.29
rrl 1474632 n.975G>T non_coding_transcript_exon_variant 0.29
rrl 1474636 n.979A>T non_coding_transcript_exon_variant 0.28
rrl 1474637 n.980C>T non_coding_transcript_exon_variant 0.28
rrl 1474638 n.981C>G non_coding_transcript_exon_variant 0.28
rrl 1474639 n.982G>T non_coding_transcript_exon_variant 0.28
rrl 1474640 n.983C>T non_coding_transcript_exon_variant 0.28
rrl 1474717 n.1060A>G non_coding_transcript_exon_variant 0.27
rrl 1474722 n.1065T>C non_coding_transcript_exon_variant 0.27
rrl 1474743 n.1086T>G non_coding_transcript_exon_variant 0.28
rrl 1474760 n.1103A>G non_coding_transcript_exon_variant 0.27
rrl 1474794 n.1137C>T non_coding_transcript_exon_variant 0.38
rrl 1474803 n.1146G>A non_coding_transcript_exon_variant 0.41
rrl 1474812 n.1155G>A non_coding_transcript_exon_variant 0.41
rrl 1474913 n.1256T>C non_coding_transcript_exon_variant 0.29
rrl 1474932 n.1275C>T non_coding_transcript_exon_variant 0.23
rrl 1475061 n.1406delA non_coding_transcript_exon_variant 0.2
rrl 1475076 n.1419C>A non_coding_transcript_exon_variant 0.29
rrl 1475090 n.1433A>T non_coding_transcript_exon_variant 0.29
rrl 1475114 n.1457C>T non_coding_transcript_exon_variant 0.32
rrl 1475120 n.1463G>T non_coding_transcript_exon_variant 0.35
rrl 1475129 n.1472G>A non_coding_transcript_exon_variant 0.33
rrl 1475202 n.1545G>C non_coding_transcript_exon_variant 0.24
rrl 1475209 n.1552G>A non_coding_transcript_exon_variant 0.21
rrl 1475213 n.1556C>T non_coding_transcript_exon_variant 0.17
rrl 1475220 n.1563G>T non_coding_transcript_exon_variant 0.18
rrl 1475315 n.1658A>T non_coding_transcript_exon_variant 0.19
rrl 1475337 n.1680C>T non_coding_transcript_exon_variant 0.19
rrl 1475343 n.1686A>G non_coding_transcript_exon_variant 0.18
rrl 1475346 n.1689C>T non_coding_transcript_exon_variant 0.17
rrl 1475353 n.1696A>T non_coding_transcript_exon_variant 0.16
rrl 1475355 n.1698C>T non_coding_transcript_exon_variant 0.17
rrl 1475358 n.1701T>C non_coding_transcript_exon_variant 0.18
rrl 1475361 n.1704G>A non_coding_transcript_exon_variant 0.18
rrl 1475369 n.1712G>C non_coding_transcript_exon_variant 0.2
rrl 1475374 n.1719_1722delAGAG non_coding_transcript_exon_variant 0.2
rrl 1475382 n.1726_1727insGTCT non_coding_transcript_exon_variant 0.19
rrl 1475387 n.1730C>T non_coding_transcript_exon_variant 0.18
rrl 1475395 n.1738T>G non_coding_transcript_exon_variant 0.17
rrl 1475396 n.1739C>A non_coding_transcript_exon_variant 0.18
rrl 1475397 n.1740G>C non_coding_transcript_exon_variant 0.19
rrl 1475398 n.1741C>G non_coding_transcript_exon_variant 0.19
rrl 1475402 n.1745C>T non_coding_transcript_exon_variant 0.19
rrl 1475406 n.1749T>G non_coding_transcript_exon_variant 0.19
rrl 1475429 n.1772G>A non_coding_transcript_exon_variant 0.33
rrl 1475443 n.1786G>A non_coding_transcript_exon_variant 0.43
rrl 1475452 n.1795C>A non_coding_transcript_exon_variant 0.37
rrl 1475475 n.1818C>T non_coding_transcript_exon_variant 0.35
rrl 1475479 n.1822C>T non_coding_transcript_exon_variant 0.37
rrl 1475480 n.1823A>T non_coding_transcript_exon_variant 0.37
rrl 1475505 n.1848G>A non_coding_transcript_exon_variant 0.5
rrl 1475526 n.1869C>A non_coding_transcript_exon_variant 0.53
rrl 1475531 n.1874C>T non_coding_transcript_exon_variant 0.5
rrl 1475573 n.1916G>A non_coding_transcript_exon_variant 0.45
rrl 1475649 n.1992A>G non_coding_transcript_exon_variant 0.14
rrl 1475659 n.2002G>A non_coding_transcript_exon_variant 0.26
rrl 1475760 n.2105_2106delGC non_coding_transcript_exon_variant 0.48
rrl 1475764 n.2107A>T non_coding_transcript_exon_variant 0.47
rrl 1475765 n.2108A>T non_coding_transcript_exon_variant 0.48
rrl 1475975 n.2318C>T non_coding_transcript_exon_variant 0.39
rrl 1475977 n.2320A>G non_coding_transcript_exon_variant 0.38
rrl 1475988 n.2331A>G non_coding_transcript_exon_variant 0.32
rrl 1475989 n.2332T>C non_coding_transcript_exon_variant 0.32
rrl 1475993 n.2336C>T non_coding_transcript_exon_variant 0.32
rrl 1475997 n.2340A>T non_coding_transcript_exon_variant 0.3
rrl 1476030 n.2373A>G non_coding_transcript_exon_variant 0.12
rrl 1476131 n.2474C>T non_coding_transcript_exon_variant 0.32
rrl 1476160 n.2503T>C non_coding_transcript_exon_variant 0.38
rrl 1476214 n.2557G>T non_coding_transcript_exon_variant 0.43
rrl 1476215 n.2558C>T non_coding_transcript_exon_variant 0.41
rrl 1476221 n.2564T>C non_coding_transcript_exon_variant 0.45
rrl 1476224 n.2567A>G non_coding_transcript_exon_variant 0.44
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 0.52
rrl 1476281 n.2624T>C non_coding_transcript_exon_variant 0.42
rrl 1476295 n.2638C>T non_coding_transcript_exon_variant 0.39
rrl 1476297 n.2640C>T non_coding_transcript_exon_variant 0.39
rrl 1476299 n.2642C>T non_coding_transcript_exon_variant 0.39
rrl 1476311 n.2654G>A non_coding_transcript_exon_variant 0.39
rrl 1476584 n.2927C>T non_coding_transcript_exon_variant 0.44
rrl 1476594 n.2937C>T non_coding_transcript_exon_variant 0.39
rrl 1476597 n.2940G>A non_coding_transcript_exon_variant 0.38
rrl 1476603 n.2946G>A non_coding_transcript_exon_variant 0.4
rrl 1476608 n.2951C>G non_coding_transcript_exon_variant 0.4
rrl 1476619 n.2962C>T non_coding_transcript_exon_variant 0.42
rrl 1476628 n.2971T>A non_coding_transcript_exon_variant 0.38
rrl 1476665 n.3008T>A non_coding_transcript_exon_variant 0.32
rrl 1476666 n.3009C>T non_coding_transcript_exon_variant 0.32
rrl 1476674 n.3017T>C non_coding_transcript_exon_variant 0.32
rrl 1476684 n.3027C>T non_coding_transcript_exon_variant 0.2
inhA 1673748 c.-454A>G upstream_gene_variant 0.16
inhA 1673772 c.-430C>G upstream_gene_variant 0.22
inhA 1673778 c.-424C>G upstream_gene_variant 0.21
inhA 1673784 c.-418G>A upstream_gene_variant 0.22
inhA 1673787 c.-415G>A upstream_gene_variant 0.22
inhA 1673799 c.-403T>C upstream_gene_variant 0.22
inhA 1673802 c.-400A>G upstream_gene_variant 0.19
inhA 1673808 c.-394A>G upstream_gene_variant 0.2
fabG1 1673816 p.Ser126Thr missense_variant 0.19
fabG1 1673870 p.Ser144Thr missense_variant 0.19
rpsA 1833547 c.6G>A synonymous_variant 0.16
rpsA 1833559 c.18C>G synonymous_variant 0.16
rpsA 1833583 c.42C>T synonymous_variant 0.21
rpsA 1833589 c.48A>C synonymous_variant 0.21
rpsA 1833595 c.54T>G synonymous_variant 0.2
rpsA 1833596 p.Ser19Ala missense_variant 0.2
rpsA 1833604 c.63C>T synonymous_variant 0.37
rpsA 1833616 c.75A>T synonymous_variant 0.34
rpsA 1833619 c.78A>C synonymous_variant 0.35
rpsA 1833625 c.84A>G synonymous_variant 0.39
rpsA 1833661 c.120A>G synonymous_variant 0.45
rpsA 1833664 c.123C>G synonymous_variant 0.47
rpsA 1833676 c.135A>G synonymous_variant 0.49
rpsA 1833679 c.138G>T synonymous_variant 0.46
rpsA 1833685 c.144G>C synonymous_variant 0.45
rpsA 1833691 c.150G>A synonymous_variant 0.45
rpsA 1833694 c.153G>T synonymous_variant 0.44
rpsA 1833697 c.156C>T synonymous_variant 0.42
rpsA 1833700 c.159C>T synonymous_variant 0.41
rpsA 1833709 c.168C>T synonymous_variant 0.46
rpsA 1833724 c.183C>T synonymous_variant 0.43
rpsA 1833727 c.186G>C synonymous_variant 0.41
rpsA 1833733 c.192C>G synonymous_variant 0.43
rpsA 1833734 p.Ala65Ser missense_variant 0.44
rpsA 1833748 c.207C>G synonymous_variant 0.47
rpsA 1833751 c.210C>T synonymous_variant 0.4
rpsA 1833760 c.219C>T synonymous_variant 0.39
rpsA 1833787 c.246C>G synonymous_variant 0.48
rpsA 1833790 c.249T>C synonymous_variant 0.47
rpsA 1833802 c.261A>G synonymous_variant 0.53
rpsA 1833811 c.270G>C synonymous_variant 0.5
rpsA 1833829 c.288A>G synonymous_variant 0.5
rpsA 1833832 c.291G>A synonymous_variant 0.5
rpsA 1833838 c.297G>T synonymous_variant 0.5
rpsA 1833841 c.300C>G synonymous_variant 0.5
rpsA 1833847 c.306C>G synonymous_variant 0.51
rpsA 1833856 c.315A>G synonymous_variant 0.56
rpsA 1833862 c.321G>T synonymous_variant 0.57
rpsA 1833874 c.333T>G synonymous_variant 0.56
rpsA 1833886 c.345C>G synonymous_variant 0.54
rpsA 1833892 c.351G>A synonymous_variant 0.54
rpsA 1833894 p.Ala118Glu missense_variant 0.56
rpsA 1833928 c.387G>C synonymous_variant 0.57
rpsA 1833949 c.408T>C synonymous_variant 0.49
rpsA 1833970 c.429G>C synonymous_variant 0.5
rpsA 1833979 c.438T>C synonymous_variant 0.48
rpsA 1833991 c.450C>G synonymous_variant 0.47
rpsA 1834000 c.459G>C synonymous_variant 0.47
rpsA 1834009 c.468C>T synonymous_variant 0.49
rpsA 1834012 c.471G>T synonymous_variant 0.49
rpsA 1834015 c.474G>C synonymous_variant 0.47
rpsA 1834021 c.480C>T synonymous_variant 0.5
rpsA 1834030 c.489C>G synonymous_variant 0.49
rpsA 1834033 c.492C>T synonymous_variant 0.48
rpsA 1834069 c.528G>C synonymous_variant 0.42
rpsA 1834073 p.Lys178Arg missense_variant 0.37
rpsA 1834097 c.556_557delTCinsAG synonymous_variant 0.47
rpsA 1834150 c.609G>C synonymous_variant 0.27
rpsA 1834165 c.624A>G synonymous_variant 0.16
rpsA 1834168 c.627C>T synonymous_variant 0.16
rpsA 1834169 p.Thr210Ala missense_variant 0.2
rpsA 1834177 c.636A>C synonymous_variant 0.19
rpsA 1834228 c.687C>A synonymous_variant 0.27
rpsA 1834231 c.690T>G synonymous_variant 0.27
rpsA 1834234 c.693G>T synonymous_variant 0.27
rpsA 1834240 c.699T>C synonymous_variant 0.28
rpsA 1834246 c.705G>T synonymous_variant 0.32
rpsA 1834249 c.708T>C synonymous_variant 0.32
rpsA 1834252 c.711C>G synonymous_variant 0.32
rpsA 1834261 c.720A>G synonymous_variant 0.38
rpsA 1834264 c.723G>C synonymous_variant 0.38
rpsA 1834297 c.756C>T synonymous_variant 0.47
rpsA 1834303 c.762T>G synonymous_variant 0.5
rpsA 1834306 c.765T>C synonymous_variant 0.52
rpsA 1834339 c.798C>T synonymous_variant 0.54
rpsA 1834348 c.807T>C synonymous_variant 0.54
rpsA 1834366 c.825A>G synonymous_variant 0.61
rpsA 1834375 c.834G>A synonymous_variant 0.6
rpsA 1834378 c.837T>C synonymous_variant 0.62
rpsA 1834396 c.855G>T synonymous_variant 0.65
rpsA 1834405 c.864C>T synonymous_variant 0.63
rpsA 1834408 c.867C>T synonymous_variant 0.63
rpsA 1834411 c.870T>C synonymous_variant 0.63
rpsA 1834417 c.876G>C synonymous_variant 0.62
rpsA 1834423 c.882G>C synonymous_variant 0.65
rpsA 1834435 c.894G>C synonymous_variant 0.61
rpsA 1834451 c.910T>C synonymous_variant 0.6
rpsA 1834456 c.915T>G synonymous_variant 0.61
rpsA 1834468 c.927A>G synonymous_variant 0.57
rpsA 1834480 c.939C>G synonymous_variant 0.53
rpsA 1834483 c.942G>A synonymous_variant 0.49
rpsA 1834489 c.948T>C synonymous_variant 0.48
rpsA 1834498 c.957C>T synonymous_variant 0.51
rpsA 1834520 p.Ala327Ser missense_variant 0.49
rpsA 1834528 c.987T>C synonymous_variant 0.5
rpsA 1834543 c.1002C>G synonymous_variant 0.49
rpsA 1834552 c.1011G>T synonymous_variant 0.47
rpsA 1834555 c.1014T>G synonymous_variant 0.48
rpsA 1834557 p.Ala339Gly missense_variant 0.48
rpsA 1834606 c.1065C>T synonymous_variant 0.45
rpsA 1834609 c.1068T>C synonymous_variant 0.44
rpsA 1834612 c.1071G>C synonymous_variant 0.44
rpsA 1834619 c.1078T>C synonymous_variant 0.4
rpsA 1834622 c.1081_1083delTCGinsAGC synonymous_variant 0.4
rpsA 1834633 c.1092A>G synonymous_variant 0.44
rpsA 1834639 c.1098T>C synonymous_variant 0.45
rpsA 1834666 c.1125G>C synonymous_variant 0.36
rpsA 1834667 p.Ala376Ser missense_variant 0.38
rpsA 1834684 c.1143C>G synonymous_variant 0.32
rpsA 1834690 c.1149T>C synonymous_variant 0.28
rpsA 1834700 p.Gln387Ala missense_variant 0.26
rpsA 1834720 c.1179C>G synonymous_variant 0.24
rpsA 1834726 c.1185C>T synonymous_variant 0.24
rpsA 1834732 c.1191T>C synonymous_variant 0.19
rpsA 1834733 p.Ala398Ser missense_variant 0.19
rpsA 1834738 c.1197A>G synonymous_variant 0.17
rpsA 1834741 c.1200C>G synonymous_variant 0.17
rpsA 1834747 c.1206A>G synonymous_variant 0.16
rpsA 1834753 c.1212T>C synonymous_variant 0.15
rpsA 1834756 c.1215G>A synonymous_variant 0.15
rpsA 1834765 p.Glu408Asp missense_variant 0.16
rpsA 1834789 c.1248T>C synonymous_variant 0.16
rpsA 1834810 c.1269C>T synonymous_variant 0.19
rpsA 1834813 c.1272G>T synonymous_variant 0.19
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2517917 c.-198G>C upstream_gene_variant 0.34
kasA 2517941 c.-174C>G upstream_gene_variant 0.34
kasA 2517953 c.-162C>T upstream_gene_variant 0.26
kasA 2517959 c.-156C>T upstream_gene_variant 0.26
kasA 2517962 c.-153C>G upstream_gene_variant 0.26
kasA 2517974 c.-141T>G upstream_gene_variant 0.18
kasA 2518076 c.-39C>T upstream_gene_variant 1.0
kasA 2518756 c.642G>C synonymous_variant 0.19
kasA 2518771 c.657C>A synonymous_variant 0.19
kasA 2518774 c.660C>T synonymous_variant 0.21
kasA 2518777 c.663C>T synonymous_variant 0.21
kasA 2518783 c.669T>G synonymous_variant 0.21
kasA 2518787 p.Arg225Lys missense_variant 0.21
kasA 2518792 c.678C>T synonymous_variant 0.21
kasA 2518795 c.681C>T synonymous_variant 0.2
kasA 2518798 c.684G>T synonymous_variant 0.21
kasA 2518801 c.687G>T synonymous_variant 0.2
kasA 2518822 c.708C>A synonymous_variant 0.18
kasA 2518825 c.711T>C synonymous_variant 0.19
kasA 2518843 c.729T>C synonymous_variant 0.17
kasA 2518849 c.735G>C synonymous_variant 0.19
kasA 2518853 p.Leu247Val missense_variant 0.19
kasA 2518864 c.750G>C synonymous_variant 0.16
kasA 2518867 c.753G>A synonymous_variant 0.15
ahpC 2726600 c.408T>C synonymous_variant 0.18
ahpC 2726613 p.Asn141Asp missense_variant 0.22
ahpC 2726619 p.Glu143Ile missense_variant 0.22
ahpC 2726630 c.438C>T synonymous_variant 0.22
ahpC 2726636 c.444G>C synonymous_variant 0.21
ahpC 2726638 p.Ala149Val missense_variant 0.21
ahpC 2726645 c.453C>G synonymous_variant 0.21
ahpC 2726657 c.465A>C synonymous_variant 0.21
ahpC 2726669 c.477T>C synonymous_variant 0.23
ahpC 2726675 c.483A>G synonymous_variant 0.25
ahpC 2726678 c.486G>C synonymous_variant 0.26
ahpC 2726681 c.489A>T synonymous_variant 0.27
ahpC 2726693 c.501C>G synonymous_variant 0.26
ahpC 2726696 c.504C>G synonymous_variant 0.26
ahpC 2726717 c.525A>C synonymous_variant 0.22
ahpC 2726735 c.543C>T synonymous_variant 0.14
thyA 3074010 c.462C>T synonymous_variant 0.18
thyA 3074022 c.450C>T synonymous_variant 0.17
thyA 3074031 c.441T>C synonymous_variant 0.15
thyA 3074037 c.435C>G synonymous_variant 0.15
thyA 3074045 c.427C>T synonymous_variant 0.16
thyA 3074053 p.Arg140Gln missense_variant 0.16
thyA 3074056 p.Glu139Pro missense_variant 0.16
thyA 3074061 c.411A>G synonymous_variant 0.17
thyA 3074067 c.405C>G synonymous_variant 0.17
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
rpoA 3877542 c.966C>A synonymous_variant 0.21
rpoA 3877545 c.963G>C synonymous_variant 0.22
rpoA 3877554 c.954G>C synonymous_variant 0.23
rpoA 3877557 c.951C>G synonymous_variant 0.22
rpoA 3877560 c.948C>T synonymous_variant 0.23
rpoA 3877569 p.Pro313Thr missense_variant 0.31
rpoA 3877587 c.921A>G synonymous_variant 0.36
rpoA 3877596 c.912G>C synonymous_variant 0.38
rpoA 3877602 c.906C>T synonymous_variant 0.4
rpoA 3877656 c.852T>G synonymous_variant 0.53
rpoA 3877662 c.846C>T synonymous_variant 0.54
rpoA 3877665 c.843C>G synonymous_variant 0.57
rpoA 3877668 c.840A>G synonymous_variant 0.56
rpoA 3877677 c.831G>C synonymous_variant 0.58
rpoA 3877680 c.828G>T synonymous_variant 0.59
rpoA 3877686 c.822A>G synonymous_variant 0.59
rpoA 3877692 c.816G>C synonymous_variant 0.57
rpoA 3877704 c.804G>T synonymous_variant 0.56
rpoA 3877728 c.780C>G synonymous_variant 0.53
rpoA 3877734 c.774G>C synonymous_variant 0.5
rpoA 3877737 c.771G>C synonymous_variant 0.51
rpoA 3877743 c.765T>C synonymous_variant 0.5
rpoA 3877752 p.Asp252Glu missense_variant 0.54
rpoA 3877758 c.750G>C synonymous_variant 0.53
rpoA 3877764 c.744C>G synonymous_variant 0.52
rpoA 3877770 c.738A>G synonymous_variant 0.52
rpoA 3877773 c.735G>C synonymous_variant 0.52
rpoA 3877776 c.732T>C synonymous_variant 0.52
rpoA 3877782 c.726T>C synonymous_variant 0.54
rpoA 3877785 c.723C>A synonymous_variant 0.55
rpoA 3877818 c.690A>G synonymous_variant 0.55
rpoA 3877839 c.669G>T synonymous_variant 0.54
rpoA 3877848 c.660C>T synonymous_variant 0.56
rpoA 3877856 c.652T>C synonymous_variant 0.5
rpoA 3877860 c.648C>T synonymous_variant 0.52
rpoA 3877875 c.633T>C synonymous_variant 0.56
rpoA 3877881 c.627G>C synonymous_variant 0.54
rpoA 3877887 c.621G>C synonymous_variant 0.57
rpoA 3877893 c.615C>T synonymous_variant 0.6
rpoA 3877900 p.Ser203Thr missense_variant 0.53
rpoA 3877905 c.603A>G synonymous_variant 0.53
rpoA 3877908 c.600T>C synonymous_variant 0.53
rpoA 3877920 c.588G>C synonymous_variant 0.52
rpoA 3877923 c.585C>T synonymous_variant 0.52
rpoA 3877929 p.Ile193Val missense_variant 0.5
rpoA 3877962 c.546G>C synonymous_variant 0.43
rpoA 3877974 c.534G>C synonymous_variant 0.42
rpoA 3877977 p.Lys177Asn missense_variant 0.4
rpoA 3877983 c.525C>G synonymous_variant 0.38
rpoA 3877986 c.522G>C synonymous_variant 0.37
rpoA 3877989 c.519A>G synonymous_variant 0.39
rpoA 3878001 c.507A>G synonymous_variant 0.47
rpoA 3878019 c.489A>C synonymous_variant 0.38
rpoA 3878022 c.486T>C synonymous_variant 0.38
rpoA 3878025 c.483C>T synonymous_variant 0.38
rpoA 3878028 c.480G>T synonymous_variant 0.37
rpoA 3878031 c.477T>C synonymous_variant 0.37
rpoA 3878034 c.474A>G synonymous_variant 0.39
rpoA 3878046 c.462T>C synonymous_variant 0.41
rpoA 3878050 p.Arg153Lys missense_variant 0.41
rpoA 3878055 c.453A>G synonymous_variant 0.42
rpoA 3878061 c.447G>C synonymous_variant 0.44
rpoA 3878070 c.438T>C synonymous_variant 0.5
rpoA 3878079 c.429C>T synonymous_variant 0.53
rpoA 3878082 c.426T>C synonymous_variant 0.55
rpoA 3878102 p.Val136Ile missense_variant 0.63
rpoA 3878103 c.405A>G synonymous_variant 0.62
rpoA 3878118 c.390T>C synonymous_variant 0.63
rpoA 3878127 c.381G>C synonymous_variant 0.64
rpoA 3878130 c.378C>G synonymous_variant 0.63
rpoA 3878143 p.Gly122Asp missense_variant 0.59
rpoA 3878160 c.348C>G synonymous_variant 0.62
rpoA 3878169 c.339G>C synonymous_variant 0.69
rpoA 3878175 c.333G>T synonymous_variant 0.71
rpoA 3878184 c.324C>T synonymous_variant 0.67
rpoA 3878193 c.315T>C synonymous_variant 0.67
rpoA 3878196 p.Glu104Ala missense_variant 0.67
rpoA 3878205 c.303T>A synonymous_variant 0.69
rpoA 3878217 c.291A>G synonymous_variant 0.69
rpoA 3878259 c.249G>C synonymous_variant 0.67
rpoA 3878271 c.237T>C synonymous_variant 0.69
rpoA 3878274 c.234G>C synonymous_variant 0.67
rpoA 3878283 p.Glu75Asp missense_variant 0.67
rpoA 3878292 c.216T>C synonymous_variant 0.69
rpoA 3878298 c.210A>G synonymous_variant 0.69
rpoA 3878301 c.207C>G synonymous_variant 0.65
rpoA 3878310 c.198G>T synonymous_variant 0.62
rpoA 3878313 c.195G>C synonymous_variant 0.62
rpoA 3878322 c.186A>G synonymous_variant 0.62
rpoA 3878331 c.177A>G synonymous_variant 0.61
rpoA 3878334 c.174T>C synonymous_variant 0.63
rpoA 3878337 c.171T>C synonymous_variant 0.63
rpoA 3878346 c.162T>C synonymous_variant 0.66
rpoA 3878364 c.144A>C synonymous_variant 0.67
rpoA 3878367 c.141C>G synonymous_variant 0.61
rpoA 3878370 c.138T>C synonymous_variant 0.61
rpoA 3878373 c.135G>C synonymous_variant 0.61
rpoA 3878391 c.117T>G synonymous_variant 0.6
rpoA 3878400 c.108T>C synonymous_variant 0.5
rpoA 3878424 c.84G>C synonymous_variant 0.4
rpoA 3878433 c.75G>C synonymous_variant 0.18
rpoA 3878436 c.72A>G synonymous_variant 0.18
rpoA 3878698 c.-191A>G upstream_gene_variant 0.57
rpoA 3878701 c.-194C>G upstream_gene_variant 0.53
ddn 3986648 c.-196C>G upstream_gene_variant 0.18
ddn 3986651 c.-193G>A upstream_gene_variant 0.17
ddn 3986661 c.-183C>A upstream_gene_variant 0.17
ddn 3986672 c.-172G>T upstream_gene_variant 0.16
ddn 3986673 c.-171C>T upstream_gene_variant 0.17
ddn 3986687 c.-157C>T upstream_gene_variant 0.17
ddn 3986690 c.-154C>T upstream_gene_variant 0.19
ddn 3986693 c.-151C>T upstream_gene_variant 0.19
ddn 3986696 c.-148G>C upstream_gene_variant 0.18
ddn 3986699 c.-145C>G upstream_gene_variant 0.18
clpC1 4038725 c.1980C>T synonymous_variant 0.29
clpC1 4038737 c.1968C>T synonymous_variant 0.31
clpC1 4038740 c.1965G>C synonymous_variant 0.31
clpC1 4038743 c.1962G>A synonymous_variant 0.32
clpC1 4038749 c.1956C>T synonymous_variant 0.32
clpC1 4038755 c.1950G>C synonymous_variant 0.31
clpC1 4038767 c.1938G>T synonymous_variant 0.32
clpC1 4038770 c.1935C>A synonymous_variant 0.32
clpC1 4038773 c.1932T>C synonymous_variant 0.32
clpC1 4038782 c.1923G>C synonymous_variant 0.36
clpC1 4038790 c.1915C>T synonymous_variant 0.35
clpC1 4038795 p.Ser637Thr missense_variant 0.36
clpC1 4038812 c.1893T>C synonymous_variant 0.41
clpC1 4038818 c.1887G>A synonymous_variant 0.42
clpC1 4038842 c.1863G>T synonymous_variant 0.4
clpC1 4038845 c.1858_1860delTCGinsAGC synonymous_variant 0.39
clpC1 4038860 c.1845G>T synonymous_variant 0.39
clpC1 4038878 c.1827A>G synonymous_variant 0.24
clpC1 4038881 c.1824C>A synonymous_variant 0.25
clpC1 4038884 c.1821C>T synonymous_variant 0.28
clpC1 4038890 c.1815G>A synonymous_variant 0.24
clpC1 4038896 c.1809C>A synonymous_variant 0.23
clpC1 4038908 c.1797C>G synonymous_variant 0.25
clpC1 4038911 c.1794G>T synonymous_variant 0.23
clpC1 4038914 c.1791G>T synonymous_variant 0.23
clpC1 4038917 c.1788C>T synonymous_variant 0.23
clpC1 4038923 c.1782A>T synonymous_variant 0.23
clpC1 4038928 c.1777C>A synonymous_variant 0.23
clpC1 4038929 c.1776G>A synonymous_variant 0.22
clpC1 4038932 c.1773G>T synonymous_variant 0.22
clpC1 4038941 c.1764G>C synonymous_variant 0.26
clpC1 4038953 c.1752A>G synonymous_variant 0.25
clpC1 4038956 c.1749T>C synonymous_variant 0.26
clpC1 4038965 c.1740T>C synonymous_variant 0.21
clpC1 4038971 c.1734T>C synonymous_variant 0.2
clpC1 4038974 c.1731T>C synonymous_variant 0.2
clpC1 4038989 c.1716T>C synonymous_variant 0.26
clpC1 4038997 c.1708T>C synonymous_variant 0.27
clpC1 4039064 c.1641C>T synonymous_variant 0.32
clpC1 4039070 c.1635G>C synonymous_variant 0.32
clpC1 4039077 p.Lys543Arg missense_variant 0.3
clpC1 4039079 c.1626C>G synonymous_variant 0.3
clpC1 4039082 c.1623C>T synonymous_variant 0.32
clpC1 4039085 c.1620A>G synonymous_variant 0.32
clpC1 4039091 c.1614G>T synonymous_variant 0.33
clpC1 4039097 c.1608G>T synonymous_variant 0.36
clpC1 4039100 c.1605C>G synonymous_variant 0.36
clpC1 4039106 c.1599G>C synonymous_variant 0.4
clpC1 4039112 c.1593C>G synonymous_variant 0.41
clpC1 4039118 c.1587C>G synonymous_variant 0.4
clpC1 4039121 c.1584T>C synonymous_variant 0.39
clpC1 4039139 c.1566G>A synonymous_variant 0.35
clpC1 4039142 c.1563A>G synonymous_variant 0.33
clpC1 4039145 c.1560G>C synonymous_variant 0.35
clpC1 4039166 c.1539G>A synonymous_variant 0.35
clpC1 4039169 c.1536A>G synonymous_variant 0.33
clpC1 4039172 c.1533A>G synonymous_variant 0.33
clpC1 4039178 c.1527G>C synonymous_variant 0.29
clpC1 4039183 c.1522T>C synonymous_variant 0.28
clpC1 4039190 c.1515C>T synonymous_variant 0.31
clpC1 4039196 c.1509G>A synonymous_variant 0.32
clpC1 4039199 p.Ala502Glu missense_variant 0.29
clpC1 4039208 c.1497C>G synonymous_variant 0.34
clpC1 4039220 c.1485G>C synonymous_variant 0.33
clpC1 4039238 c.1467C>T synonymous_variant 0.41
clpC1 4039265 c.1440C>T synonymous_variant 0.43
clpC1 4039274 c.1431G>C synonymous_variant 0.44
clpC1 4039277 c.1428C>G synonymous_variant 0.44
clpC1 4039280 c.1425G>T synonymous_variant 0.42
clpC1 4039283 c.1422C>T synonymous_variant 0.42
clpC1 4039286 c.1419T>G synonymous_variant 0.41
clpC1 4039292 c.1413C>T synonymous_variant 0.42
clpC1 4039316 p.Glu463Asp missense_variant 0.37
clpC1 4039319 c.1386T>A synonymous_variant 0.37
clpC1 4039322 c.1383T>G synonymous_variant 0.37
clpC1 4039328 c.1377A>G synonymous_variant 0.37
clpC1 4039336 c.1369C>T synonymous_variant 0.35
clpC1 4039338 p.Thr456Gln missense_variant 0.35
clpC1 4039346 p.Arg453Ser missense_variant 0.37
clpC1 4039360 p.Ser449Arg missense_variant 0.38
clpC1 4039361 c.1344C>G synonymous_variant 0.39
clpC1 4039391 c.1314T>C synonymous_variant 0.41
clpC1 4039397 c.1308A>G synonymous_variant 0.33
clpC1 4039409 c.1296T>C synonymous_variant 0.28
clpC1 4039412 c.1293T>G synonymous_variant 0.28
clpC1 4039415 p.Glu430Asp missense_variant 0.28
clpC1 4039430 c.1275T>C synonymous_variant 0.28
clpC1 4039442 c.1263A>G synonymous_variant 0.25
clpC1 4039451 c.1254G>A synonymous_variant 0.2
clpC1 4039454 c.1251A>T synonymous_variant 0.21
clpC1 4039457 c.1248C>T synonymous_variant 0.21
clpC1 4039463 c.1242C>G synonymous_variant 0.21
clpC1 4039466 c.1239T>C synonymous_variant 0.21
clpC1 4039469 c.1236T>C synonymous_variant 0.21
clpC1 4039472 c.1233G>C synonymous_variant 0.22
clpC1 4039478 c.1227G>C synonymous_variant 0.22
clpC1 4039481 c.1224T>C synonymous_variant 0.24
clpC1 4039484 c.1221T>A synonymous_variant 0.23
clpC1 4039487 c.1218G>C synonymous_variant 0.23
clpC1 4039517 c.1188C>G synonymous_variant 0.24
clpC1 4039522 c.1183C>T synonymous_variant 0.28
clpC1 4039541 c.1164C>G synonymous_variant 0.29
clpC1 4039544 c.1161C>T synonymous_variant 0.26
clpC1 4039553 c.1152C>T synonymous_variant 0.28
clpC1 4039556 c.1149G>C synonymous_variant 0.27
clpC1 4039559 c.1146C>G synonymous_variant 0.27
clpC1 4039562 c.1143C>G synonymous_variant 0.27
clpC1 4039565 c.1140G>C synonymous_variant 0.27
clpC1 4039570 p.Met379Leu missense_variant 0.28
clpC1 4039574 p.Ala377Gly missense_variant 0.29
clpC1 4039577 c.1128T>C synonymous_variant 0.28
clpC1 4039586 c.1119G>C synonymous_variant 0.28
clpC1 4039589 c.1116G>C synonymous_variant 0.29
clpC1 4039610 c.1095G>T synonymous_variant 0.34
clpC1 4039616 c.1089G>C synonymous_variant 0.38
clpC1 4039622 c.1083C>T synonymous_variant 0.41
clpC1 4039649 c.1056G>T synonymous_variant 0.46
clpC1 4039652 c.1053G>T synonymous_variant 0.45
clpC1 4039682 c.1023C>G synonymous_variant 0.38
clpC1 4039694 c.1011G>C synonymous_variant 0.36
clpC1 4039724 c.981A>G synonymous_variant 0.36
clpC1 4039733 c.972G>C synonymous_variant 0.35
clpC1 4039739 c.966C>G synonymous_variant 0.35
clpC1 4039745 c.960C>T synonymous_variant 0.4
clpC1 4039751 c.954A>G synonymous_variant 0.38
clpC1 4039757 c.948A>G synonymous_variant 0.38
clpC1 4039769 c.936C>G synonymous_variant 0.32
clpC1 4039775 c.930G>C synonymous_variant 0.33
clpC1 4039778 c.927A>G synonymous_variant 0.33
clpC1 4039793 c.912C>G synonymous_variant 0.43
clpC1 4039805 c.900C>T synonymous_variant 0.41
clpC1 4039814 c.891C>G synonymous_variant 0.38
clpC1 4039817 c.888A>C synonymous_variant 0.37
clpC1 4039820 c.885T>G synonymous_variant 0.39
clpC1 4039826 c.879C>G synonymous_variant 0.37
clpC1 4039831 c.874T>C synonymous_variant 0.36
clpC1 4039850 c.855T>C synonymous_variant 0.36
clpC1 4039865 c.840T>C synonymous_variant 0.38
clpC1 4039874 c.831C>T synonymous_variant 0.41
clpC1 4039904 c.801A>G synonymous_variant 0.44
clpC1 4039907 c.798G>A synonymous_variant 0.37
clpC1 4039931 c.774T>C synonymous_variant 0.38
clpC1 4039934 c.771G>C synonymous_variant 0.35
clpC1 4039943 c.762G>C synonymous_variant 0.34
clpC1 4039946 c.759A>G synonymous_variant 0.31
clpC1 4039949 c.756G>C synonymous_variant 0.32
clpC1 4039952 c.753T>C synonymous_variant 0.31
clpC1 4039958 c.747G>C synonymous_variant 0.32
clpC1 4039964 c.741C>G synonymous_variant 0.33
clpC1 4039975 p.Asp244Asn missense_variant 0.34
clpC1 4039979 c.726C>G synonymous_variant 0.37
clpC1 4039982 c.723G>A synonymous_variant 0.38
clpC1 4040000 c.705C>T synonymous_variant 0.52
clpC1 4040021 c.684A>C synonymous_variant 0.5
clpC1 4040024 c.681A>G synonymous_variant 0.5
clpC1 4040033 c.672G>C synonymous_variant 0.5
clpC1 4040042 c.663C>T synonymous_variant 0.5
clpC1 4040051 c.654C>T synonymous_variant 0.47
clpC1 4040057 c.648C>T synonymous_variant 0.5
clpC1 4040087 c.618G>T synonymous_variant 0.36
clpC1 4040090 c.613_615delTCTinsAGC synonymous_variant 0.32
clpC1 4040093 c.612C>G synonymous_variant 0.32
clpC1 4040126 c.579C>T synonymous_variant 0.23
clpC1 4040132 c.573C>T synonymous_variant 0.18
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
embB 4248236 p.Met575Leu missense_variant 0.14
embB 4248245 p.Ile578Val missense_variant 0.14
whiB6 4338595 c.-75delG upstream_gene_variant 1.0