TB-Profiler result

Run: SRR1180420

Summary

Run ID: SRR1180420

Sample name:

Date: 2024-04-14T08:11:40.416040

Number of reads: 94064

Percentage reads mapped: 3.3

Median coverage: 0.0

Strain: lineage4.9

Spoligotype:

Drug-resistance: Sensitive


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4 Euro-American None 1.0
lineage4.9 Euro-American (H37Rv-like) None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin
isoniazid
ethambutol
pyrazinamide
streptomycin
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide
clofazimine
para-aminosalicylic_acid
delamanid
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrB 6115 c.876A>G synonymous_variant 1.0 levofloxacin
moxifloxacin
gyrB 6122 p.Ala295Ser missense_variant 1.0 levofloxacin
moxifloxacin
gyrB 6127 c.888G>C synonymous_variant 1.0 levofloxacin
moxifloxacin
gyrB 6130 c.891T>C synonymous_variant 1.0 levofloxacin
moxifloxacin
gyrB 6139 c.900G>T synonymous_variant 1.0 levofloxacin
moxifloxacin
gyrB 6190 c.951A>G synonymous_variant 1.0 levofloxacin
moxifloxacin
gyrB 6307 c.1068T>G synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6308 c.1069_1071delGTGinsAC frameshift_variant&missense_variant 1.0 levofloxacin Uncertain significance
moxifloxacin
gyrA 6316 c.-986G>C upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 6326 p.Ser363Ala missense_variant 1.0 levofloxacin
moxifloxacin
gyrA 6331 c.-971A>G upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 6362 c.1123_1125delTTGinsCC frameshift_variant&missense_variant 1.0 levofloxacin Uncertain significance
moxifloxacin
gyrB 6737 p.Thr500Ala missense_variant 1.0 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrA 6742 c.-560A>G upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 6745 c.1506T>C synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6749 p.Ala504Ser missense_variant 1.0 levofloxacin
moxifloxacin
gyrA 6760 c.-542G>C upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 6764 c.1525_1527delCTGinsTC frameshift_variant&missense_variant 1.0 levofloxacin Uncertain significance
moxifloxacin
gyrA 6775 c.-527G>T upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 6793 c.1554T>C synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6797 p.Gly520Ser missense_variant 1.0 levofloxacin
moxifloxacin
gyrA 7538 p.Glu79Asp missense_variant 0.9 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrA 7547 c.246C>T synonymous_variant 0.92 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7569 p.Ala90Ser missense_variant 1.0 levofloxacin
moxifloxacin
gyrA 7574 c.273G>C synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7589 c.288G>C synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7601 c.300C>G synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7607 c.306C>G synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7628 c.327G>C synonymous_variant 1.0 levofloxacin
moxifloxacin
gyrA 7631 c.330G>C synonymous_variant 1.0 levofloxacin
moxifloxacin
fgd1 491542 c.760T>C synonymous_variant 1.0 clofazimine
pretomanid
delamanid
fgd1 491547 c.765A>C synonymous_variant 1.0 clofazimine
pretomanid
delamanid
fgd1 491550 c.768T>G synonymous_variant 1.0 clofazimine
pretomanid
delamanid
fgd1 491590 p.Lys270Ala missense_variant 1.0 clofazimine
pretomanid
delamanid
fgd1 491601 c.819T>C synonymous_variant 1.0 clofazimine
pretomanid
delamanid
fgd1 491610 c.828A>G synonymous_variant 1.0 clofazimine
pretomanid
delamanid
fgd1 491616 c.834A>G synonymous_variant 1.0 clofazimine
pretomanid
delamanid
fgd1 491620 p.Ile280Val missense_variant 1.0 clofazimine
pretomanid
delamanid
fgd1 491631 c.849C>G synonymous_variant 1.0 clofazimine
pretomanid
delamanid
nusG 734472 c.219T>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
nusG 734475 c.222T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
nusG 734502 c.249G>A synonymous_variant 1.0 rifampicin
nusG 734505 c.252G>T synonymous_variant 1.0 rifampicin
nusG 734532 c.279A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
nusG 734541 c.288A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
nusG 734556 c.303C>T synonymous_variant 1.0 rifampicin
nusG 734559 c.306T>C synonymous_variant 1.0 rifampicin
nusG 734565 c.312G>T synonymous_variant 1.0 rifampicin
nusG 734814 c.561G>C synonymous_variant 1.0 rifampicin
nusG 734820 c.567A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
nusG 734826 c.573A>C synonymous_variant 1.0 rifampicin
nusG 734841 c.588G>T synonymous_variant 1.0 rifampicin
nusG 734847 c.594T>C synonymous_variant 1.0 rifampicin
nusG 734850 c.597C>G synonymous_variant 1.0 rifampicin
nusG 734853 c.600A>C synonymous_variant 1.0 rifampicin
nusG 734854 c.601T>C synonymous_variant 1.0 rifampicin
nusG 734862 c.609C>G synonymous_variant 1.0 rifampicin
nusG 734864 p.Thr204Ser missense_variant 1.0 rifampicin
nusG 734886 c.633A>G synonymous_variant 1.0 rifampicin
nusG 734895 c.642A>G synonymous_variant 1.0 rifampicin
rpoB 760106 c.300G>C synonymous_variant 1.0 rifampicin
rpoB 760112 c.306T>G synonymous_variant 1.0 rifampicin
rpoB 760118 c.312T>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760121 c.315T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760130 p.Asp108Glu missense_variant 1.0 rifampicin Uncertain significance
rpoB 760139 c.333A>C synonymous_variant 1.0 rifampicin
rpoB 760140 c.334_336delCCCinsTG frameshift_variant&missense_variant 1.0 rifampicin
rpoB 760172 c.366G>C synonymous_variant 1.0 rifampicin
rpoB 760181 c.375T>G synonymous_variant 1.0 rifampicin
rpoB 760184 c.378A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760235 c.429T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760244 c.438G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760274 p.Glu156Asp missense_variant 1.0 rifampicin Uncertain significance
rpoB 760376 p.Asp190Glu missense_variant 1.0 rifampicin Uncertain significance
rpoB 760382 c.576G>C synonymous_variant 1.0 rifampicin
rpoB 760400 c.594G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760407 p.Ser201Gly missense_variant 1.0 rifampicin Uncertain significance
rpoB 760412 c.606C>T synonymous_variant 1.0 rifampicin
rpoB 760430 c.624T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760457 c.651C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760460 c.654G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760475 c.669A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761051 c.1245G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761057 c.1251G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761084 c.1278C>A synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761088 c.1282_1283delAGinsTC synonymous_variant 1.0 rifampicin
rpoB 761097 c.1291_1293delAGCinsTCG synonymous_variant 1.0 rifampicin
rpoB 761102 c.1296A>G synonymous_variant 1.0 rifampicin
rpoB 761132 c.1326G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761133 c.1327T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761147 c.1341C>T synonymous_variant 0.94 rifampicin Not assoc w R - Interim
rpoB 761150 c.1344A>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761165 c.1359G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761180 c.1374A>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761189 c.1383T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761195 c.1389G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761198 c.1392G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761204 c.1398C>G synonymous_variant 1.0 rifampicin
rpoB 761207 c.1401C>A synonymous_variant 1.0 rifampicin
rpoB 761213 c.1407G>C synonymous_variant 1.0 rifampicin
rpoB 761234 c.1428G>T synonymous_variant 1.0 rifampicin
rpoB 761249 c.1443A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761255 c.1449T>C synonymous_variant 1.0 rifampicin
rpoB 761261 c.1455G>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761264 c.1458C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761282 c.1476C>T synonymous_variant 1.0 rifampicin
rpoB 761318 c.1512G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761558 c.1752C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761573 c.1767C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761579 c.1773G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761606 c.1800C>G synonymous_variant 1.0 rifampicin
rpoB 761612 c.1806G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761615 c.1809A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761627 c.1821C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761636 c.1830G>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761648 c.1842T>C synonymous_variant 1.0 rifampicin
rpoB 761657 c.1851C>A synonymous_variant 1.0 rifampicin
rpoB 761666 c.1860G>C synonymous_variant 1.0 rifampicin
rpoB 761948 c.2142G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761954 c.2148C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762002 c.2196C>G synonymous_variant 1.0 rifampicin
rpoB 762003 c.2197_2199delAACinsCG frameshift_variant&missense_variant 1.0 rifampicin
rpoB 762011 c.2205G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762014 c.2208C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762026 c.2220G>C synonymous_variant 1.0 rifampicin
rpoB 762053 c.2247T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762065 c.2259T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762080 c.2274G>C synonymous_variant 1.0 rifampicin
rpoB 762086 c.2280G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762101 c.2295C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762114 p.Ile770Val missense_variant 1.0 rifampicin Uncertain significance
rpoB 762131 c.2325C>G synonymous_variant 1.0 rifampicin
rpoB 762137 c.2331C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762140 c.2334G>C synonymous_variant 1.0 rifampicin
rpoB 762143 c.2337T>C synonymous_variant 1.0 rifampicin
rpoB 762149 c.2343G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762158 c.2352G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762176 c.2370T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762185 c.2379G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762218 c.2412T>C synonymous_variant 1.0 rifampicin
rpoB 762233 c.2427G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762236 c.2430G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762245 c.2439G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762251 c.2445G>C synonymous_variant 1.0 rifampicin
rpoB 762254 c.2448T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762257 c.2451C>G synonymous_variant 1.0 rifampicin
rpoB 762284 c.2478G>T synonymous_variant 1.0 rifampicin
rpoB 762293 c.2487T>G synonymous_variant 1.0 rifampicin
rpoB 762305 c.2499G>T synonymous_variant 1.0 rifampicin
rpoB 762314 c.2508C>T synonymous_variant 1.0 rifampicin
rpoB 762317 c.2511A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762329 c.2523G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762857 c.3051C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762858 p.Thr1018Ser missense_variant 1.0 rifampicin
rpoB 762863 c.3057T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762881 p.Met1025Ile missense_variant 1.0 rifampicin
rpoB 762899 c.3093G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 762917 c.-453C>A upstream_gene_variant 1.0 rifampicin
rpoB 762920 c.3114C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762923 c.3117C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762929 c.3123G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762959 c.3153G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 762971 c.-399G>C upstream_gene_variant 1.0 rifampicin
rpoC 762989 c.-381G>C upstream_gene_variant 1.0 rifampicin
rpoB 762995 c.3189G>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763013 c.-357C>G upstream_gene_variant 1.0 rifampicin
rpoC 763022 c.-348C>G upstream_gene_variant 0.96 rifampicin
rpoB 763028 c.3222T>C synonymous_variant 0.97 rifampicin Not assoc w R - Interim
rpoB 763031 c.3225T>C synonymous_variant 0.97 rifampicin Not assoc w R
rpoB 763053 c.3247_3249delTTGinsCC frameshift_variant&missense_variant 0.98 rifampicin
rpoC 763067 c.-303C>G upstream_gene_variant 0.97 rifampicin
rpoB 763070 c.3264T>C synonymous_variant 0.97 rifampicin Not assoc w R - Interim
rpoB 763074 p.Thr1090Val missense_variant 0.97 rifampicin
rpoB 763088 c.3282C>G synonymous_variant 0.98 rifampicin Not assoc w R - Interim
rpoC 763103 c.-267G>C upstream_gene_variant 0.98 rifampicin
rpoB 763115 c.3309T>C synonymous_variant 0.98 rifampicin Not assoc w R - Interim
rpoB 763127 c.3321G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763148 c.-222G>C upstream_gene_variant 1.0 rifampicin
rpoC 763160 c.-210G>C upstream_gene_variant 1.0 rifampicin
rpoB 763166 c.3360A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763169 c.-201A>G upstream_gene_variant 1.0 rifampicin
rpoB 763172 c.3366G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763411 c.42T>C synonymous_variant 1.0 rifampicin
rpoC 763414 c.45T>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763430 c.61_63delAGGinsCC frameshift_variant&missense_variant 1.0 rifampicin
rpoC 763433 c.64_66delCAAinsAC frameshift_variant&missense_variant 1.0 rifampicin
rpoC 763444 c.75T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763456 c.87A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763468 c.99G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763486 c.117T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763492 c.123G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763507 c.138G>C synonymous_variant 1.0 rifampicin
rpoC 763528 c.159G>C synonymous_variant 1.0 rifampicin
rpoC 763531 c.162G>C synonymous_variant 1.0 rifampicin Not assoc w R
rpoC 763534 c.165T>C synonymous_variant 1.0 rifampicin
rpoC 763537 c.168C>G synonymous_variant 1.0 rifampicin
rpoC 763546 c.177A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763570 c.201G>T synonymous_variant 1.0 rifampicin
rpoC 763573 c.204G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763576 c.207C>G synonymous_variant 1.0 rifampicin
rpoC 763594 c.225C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763618 c.249C>T synonymous_variant 1.0 rifampicin
rpoC 763642 c.273G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763660 c.291T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763663 c.294C>T synonymous_variant 1.0 rifampicin
rpoC 763666 c.297G>T synonymous_variant 1.0 rifampicin
rpoC 763669 c.300C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763702 c.333C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763714 c.345G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763717 c.348T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763726 c.357C>T synonymous_variant 1.0 rifampicin
rpoC 763732 c.363C>T synonymous_variant 1.0 rifampicin
rpoC 763741 c.372C>T synonymous_variant 1.0 rifampicin
rpoC 763744 c.375G>C synonymous_variant 1.0 rifampicin
rpoC 763765 c.396T>C synonymous_variant 1.0 rifampicin
rpoC 763774 c.405G>C synonymous_variant 1.0 rifampicin
rpoC 763776 c.409_410delAC frameshift_variant 1.0 rifampicin
rpoC 763780 c.411C>G synonymous_variant 1.0 rifampicin
rpoC 763783 c.415_416dupGT frameshift_variant 1.0 rifampicin
rpoC 763796 p.Met143Leu missense_variant 1.0 rifampicin
rpoC 763801 c.432C>T synonymous_variant 1.0 rifampicin
rpoC 763807 c.438T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764101 c.732C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764131 c.762T>C synonymous_variant 1.0 rifampicin
rpoC 764134 c.765C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764149 c.780G>C synonymous_variant 1.0 rifampicin
rpoC 764164 p.Ile265Met missense_variant 1.0 rifampicin
rpoC 764182 p.Asp271Glu missense_variant 1.0 rifampicin Uncertain significance
rpoC 764188 c.819A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764242 c.873C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764245 c.876C>T synonymous_variant 1.0 rifampicin
rpoC 764254 c.885G>C synonymous_variant 1.0 rifampicin
rpoC 764257 c.888G>C synonymous_variant 1.0 rifampicin
rpoC 764263 c.894G>C synonymous_variant 1.0 rifampicin
rpoC 764266 c.897T>C synonymous_variant 1.0 rifampicin
rpoC 764278 c.909A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764308 c.939G>C synonymous_variant 1.0 rifampicin
rpoC 764320 c.951C>T synonymous_variant 1.0 rifampicin
rpoC 764353 c.984G>C synonymous_variant 1.0 rifampicin
rpoC 764365 c.996C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764368 c.999C>T synonymous_variant 1.0 rifampicin
rpoC 764371 c.1002G>T synonymous_variant 1.0 rifampicin
rpoC 764377 c.1008C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764387 c.1018_1020delTTGinsCC frameshift_variant&missense_variant 1.0 rifampicin
rpoC 764405 c.1036_1038delAGGinsCC frameshift_variant&missense_variant 1.0 rifampicin
rpoC 764410 c.1041G>C synonymous_variant 1.0 rifampicin
rpoC 764428 c.1059G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764458 c.1089G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764461 c.1092A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764497 c.1128A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764503 c.1134G>C synonymous_variant 1.0 rifampicin
rpoC 764521 c.1152T>C synonymous_variant 0.92 rifampicin Not assoc w R - Interim
rpoC 764524 c.1155C>T synonymous_variant 0.92 rifampicin
rpoC 764527 c.1158C>T synonymous_variant 0.92 rifampicin Not assoc w R - Interim
rpoC 764530 c.1161C>T synonymous_variant 0.92 rifampicin Not assoc w R - Interim
rpoC 764545 c.1176C>G synonymous_variant 0.9 rifampicin
rpoC 764548 c.1179G>C synonymous_variant 0.96 rifampicin
rpoC 764566 c.1197C>G synonymous_variant 0.97 rifampicin Not assoc w R - Interim
rpoC 764575 c.1206T>G synonymous_variant 0.97 rifampicin Not assoc w R - Interim
rpoC 764605 c.1236G>C synonymous_variant 0.97 rifampicin Not assoc w R - Interim
rpoC 764611 c.1242G>T synonymous_variant 0.97 rifampicin Not assoc w R - Interim
rpoC 764626 c.1257C>T synonymous_variant 0.97 rifampicin Not assoc w R - Interim
rpoC 764650 c.1281G>T synonymous_variant 0.96 rifampicin Not assoc w R - Interim
rpoC 764653 c.1284G>C synonymous_variant 0.96 rifampicin
rpoC 764662 c.1293G>C synonymous_variant 0.96 rifampicin Not assoc w R - Interim
rpoC 764701 c.1332C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764716 c.1347G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764737 c.1368G>C synonymous_variant 1.0 rifampicin
rpoC 764746 c.1377G>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764752 c.1383G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764764 c.1395T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764780 c.1411_1412delAGinsTC synonymous_variant 1.0 rifampicin
rpoC 764785 c.1416C>G synonymous_variant 1.0 rifampicin
rpoC 764797 c.1428G>C synonymous_variant 1.0 rifampicin
rpoC 764803 c.1434C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764812 c.1443C>G synonymous_variant 1.0 rifampicin
rpoC 764815 c.1446A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764827 c.1458G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764843 p.Ala492Asn missense_variant 1.0 rifampicin
rpoC 765040 c.1671T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765041 c.1672T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765047 c.1678T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765052 c.1683C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765055 c.1686C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765844 c.2475C>G synonymous_variant 1.0 rifampicin
rpoC 765875 p.Val836Ile missense_variant 0.93 rifampicin Uncertain significance
rpoC 765890 p.Arg841Lys missense_variant 0.93 rifampicin
rpoC 765904 c.2535C>G synonymous_variant 0.93 rifampicin Not assoc w R - Interim
rpoC 765907 c.2538G>C synonymous_variant 0.93 rifampicin
rpoC 765910 c.2541G>C synonymous_variant 0.93 rifampicin Not assoc w R - Interim
rpoC 765928 c.2559C>G synonymous_variant 0.91 rifampicin Not assoc w R - Interim
rpoC 766837 c.3468G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 766843 c.3474T>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 766858 c.3489C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 766861 c.3492G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 766864 c.3495G>C synonymous_variant 1.0 rifampicin
rpoC 766867 c.3498C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 766894 c.3525T>C synonymous_variant 1.0 rifampicin
rpoC 766895 c.3526T>C synonymous_variant 1.0 rifampicin
rpoC 766900 c.3531T>C synonymous_variant 1.0 rifampicin
rpoC 766996 c.3627C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 767017 c.3648C>G synonymous_variant 1.0 rifampicin
rpoC 767023 c.3654C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 767041 c.3672G>T synonymous_variant 1.0 rifampicin
rpoC 767059 c.3690T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 767093 c.3724_3726delAGCinsTCG synonymous_variant 1.0 rifampicin
rpoC 767098 c.3729T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 767104 c.3735C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 767106 p.Asn1246Ile missense_variant 1.0 rifampicin
rpoC 767113 c.3744G>C synonymous_variant 1.0 rifampicin
rpoC 767119 c.3750A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 767152 c.3783T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 767158 c.3789T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpsL 781802 c.243G>C synonymous_variant 1.0 streptomycin
rpsL 781805 c.246G>C synonymous_variant 1.0 streptomycin
rpsL 781814 c.255C>T synonymous_variant 1.0 streptomycin
rpsL 781817 c.258G>T synonymous_variant 1.0 streptomycin
rpsL 781829 c.270G>C synonymous_variant 1.0 streptomycin
rpsL 781832 c.273T>G synonymous_variant 1.0 streptomycin
rpsL 781859 c.300T>C synonymous_variant 1.0 streptomycin Not assoc w R - Interim
rpsL 781865 c.306G>C synonymous_variant 1.0 streptomycin
rpsL 781868 c.309T>C synonymous_variant 1.0 streptomycin
rpsL 781871 c.312G>C synonymous_variant 1.0 streptomycin
rpsL 781892 c.333A>G synonymous_variant 1.0 streptomycin
rpsL 781898 c.339A>G synonymous_variant 1.0 streptomycin
rpsL 781901 c.342C>T synonymous_variant 1.0 streptomycin
rpsL 781907 c.348T>C synonymous_variant 1.0 streptomycin
rpsL 781916 c.357T>G synonymous_variant 1.0 streptomycin
rplC 800690 c.-119C>T upstream_gene_variant 1.0 linezolid
rplC 800693 c.-116A>T upstream_gene_variant 1.0 linezolid
rplC 800703 c.-106T>C upstream_gene_variant 1.0 linezolid
rplC 800715 c.-94A>C upstream_gene_variant 1.0 linezolid
rplC 800720 c.-89T>C upstream_gene_variant 1.0 linezolid
rplC 800723 c.-86C>G upstream_gene_variant 1.0 linezolid
rplC 800735 c.-74C>G upstream_gene_variant 1.0 linezolid
rplC 800738 c.-71T>C upstream_gene_variant 1.0 linezolid
rplC 800780 c.-29C>G upstream_gene_variant 1.0 linezolid
sigE 1364865 c.453G>C synonymous_variant 1.0 pyrazinamide
sigE 1364866 p.Ala152Asn missense_variant 1.0 pyrazinamide
sigE 1364877 c.465G>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
sigE 1364887 c.475_477delTTAinsCG frameshift_variant&missense_variant 1.0 pyrazinamide Uncertain significance
sigE 1364892 c.480C>G synonymous_variant 1.0 pyrazinamide
rrs 1471918 n.73A>T non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1471923 n.78T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1471925 n.80T>C non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1471932 n.87A>G non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1471934 n.89A>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1471938 n.93T>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1471985 n.140T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1471986 n.141C>T non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472075 n.230A>G non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472106 n.261G>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472108 n.263C>T non_coding_transcript_exon_variant 0.89 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472148 n.303T>C non_coding_transcript_exon_variant 0.82 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472150 n.305T>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472172 n.327T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472225 n.380C>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Uncertain significance
rrs 1472251 n.406G>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472286 n.441C>G non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472289 n.444T>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472290 n.445C>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472297 n.453_465delGTCCGGGTTCTCT non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472312 n.467_468insA non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472315 n.470T>G non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472324 n.479G>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin
capreomycin
amikacin
rrs 1472325 n.480G>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin
capreomycin
amikacin
rrs 1472328 n.483G>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin
capreomycin
amikacin
rrs 1472422 n.577T>C non_coding_transcript_exon_variant 0.99 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Uncertain significance
rrs 1472435 n.590T>C non_coding_transcript_exon_variant 0.98 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472438 n.593T>C non_coding_transcript_exon_variant 0.98 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472446 n.601T>A non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472449 n.604C>T non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472450 n.605A>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472451 n.606C>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472456 n.611T>C non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472460 n.615T>C non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472461 n.616G>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472462 n.617T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472463 n.618G>A non_coding_transcript_exon_variant 0.96 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472467 n.622G>T non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472489 n.644A>T non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472530 n.685G>A non_coding_transcript_exon_variant 0.99 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472612 n.767G>T non_coding_transcript_exon_variant 0.86 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472660 n.815T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472661 n.816A>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472682 n.837T>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472683 n.838T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472713 n.868T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472714 n.869A>G non_coding_transcript_exon_variant 0.98 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472956 n.1111T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472957 n.1112C>T non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472958 n.1113A>G non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472969 n.1124A>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472978 n.1133T>C non_coding_transcript_exon_variant 0.99 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472988 n.1143T>C non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472989 n.1144G>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472990 n.1145A>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Not assoc w R
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473026 n.1181T>C non_coding_transcript_exon_variant 0.97 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473088 n.1243A>G non_coding_transcript_exon_variant 0.97 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473100 n.1255G>A non_coding_transcript_exon_variant 0.97 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473104 n.1259C>T non_coding_transcript_exon_variant 0.97 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473110 n.1265T>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473111 n.1266A>G non_coding_transcript_exon_variant 0.98 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473121 n.1276T>C non_coding_transcript_exon_variant 0.94 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473123 n.1278A>T non_coding_transcript_exon_variant 0.96 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473276 n.1431A>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473290 n.1445C>T non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473291 n.1446_1447insT non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473301 n.1456T>C non_coding_transcript_exon_variant 0.99 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrl 1473668 n.11C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1473673 n.16G>A non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1473677 n.20C>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1473679 n.22T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473696 n.39T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1473698 n.41G>A non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1473699 n.42A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1473717 n.60G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473731 n.74T>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473756 n.99G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473757 n.100T>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473758 n.101G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473770 n.113T>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473791 n.134A>C non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1473792 n.135C>A non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1473793 n.136G>C non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1473802 n.145C>G non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1473803 n.146G>T non_coding_transcript_exon_variant 0.95 capreomycin
linezolid
rrl 1473804 n.147T>G non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1473806 n.149C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473814 n.157A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473815 n.158T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473830 n.173T>C non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1473832 n.175C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1473833 n.176_177insT non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473844 n.187C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473870 n.213G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473871 n.214T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473876 n.219G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473887 n.230delTinsCA non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1473898 n.241C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473899 n.242A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473916 n.259C>A non_coding_transcript_exon_variant 0.88 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473923 n.266C>G non_coding_transcript_exon_variant 0.8 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474135 n.478G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474140 n.483C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474151 n.494C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474153 n.496C>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474166 n.509G>A non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474174 n.517A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474183 n.526T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474184 n.527C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474186 n.529A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474201 n.544T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474218 n.561T>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474249 n.592G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474266 n.609T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474269 n.612C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474288 n.631delCinsGCGCCA non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474306 n.649A>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474310 n.655dupG non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474348 n.691C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474351 n.694G>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1474353 n.696A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474362 n.705A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474387 n.730C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474402 n.745T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474409 n.756_776delACCCACACGCGCATACGCGCG non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474435 n.778G>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474437 n.781_782delAA non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1474447 n.790G>A non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474454 n.797G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474496 n.839C>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474497 n.840G>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474506 n.849C>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474507 n.850G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474537 n.880G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474626 n.969T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474632 n.975G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474638 n.981C>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474639 n.982G>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474640 n.983C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1474673 n.1016T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474676 n.1019T>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474709 n.1052G>A non_coding_transcript_exon_variant 0.99 capreomycin
linezolid
rrl 1474710 n.1053T>G non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474711 n.1054G>A non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474716 n.1059_1060delAAinsGAG non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474722 n.1065T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1474734 n.1077G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474749 n.1092C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474753 n.1097delC non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474760 n.1103A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474794 n.1137C>T non_coding_transcript_exon_variant 0.94 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474803 n.1146G>A non_coding_transcript_exon_variant 0.9 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474812 n.1155G>A non_coding_transcript_exon_variant 0.88 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474823 n.1166C>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474824 n.1167A>G non_coding_transcript_exon_variant 0.84 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474830 n.1173A>G non_coding_transcript_exon_variant 0.82 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474903 n.1246T>C non_coding_transcript_exon_variant 0.75 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474904 n.1247G>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474913 n.1256T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474932 n.1275C>T non_coding_transcript_exon_variant 0.91 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475060 n.1404delC non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475065 n.1408G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475067 n.1410A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475076 n.1419C>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475079 n.1422T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475081 n.1424C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475090 n.1433A>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475113 n.1456C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475114 n.1457C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475116 n.1459G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475414 n.1757G>C non_coding_transcript_exon_variant 0.96 capreomycin
linezolid
rrl 1475419 n.1762C>T non_coding_transcript_exon_variant 0.96 capreomycin Uncertain significance
linezolid
rrl 1475422 n.1765A>G non_coding_transcript_exon_variant 0.97 capreomycin
linezolid
rrl 1475429 n.1772G>A non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475443 n.1786G>A non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475452 n.1795C>A non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475460 n.1803A>G non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475480 n.1823A>T non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475481 n.1824C>T non_coding_transcript_exon_variant 0.99 capreomycin
linezolid
rrl 1475482 n.1825A>T non_coding_transcript_exon_variant 0.99 capreomycin
linezolid
rrl 1475526 n.1869C>A non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475531 n.1874C>T non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475538 n.1881T>A non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475539 n.1882A>T non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475550 n.1893A>G non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475649 n.1992A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475655 n.1998T>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475659 n.2002G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475699 n.2042C>T non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475753 n.2096C>G non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid
rrl 1475758 n.2101A>G non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1475761 n.2104C>A non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1475763 n.2106C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1475766 n.2109G>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1475769 n.2112T>C non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1475775 n.2118G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475883 n.2226A>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475884 n.2227A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475897 n.2240T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475916 n.2259C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475975 n.2318C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475977 n.2320A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475988 n.2331A>G non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1475997 n.2340A>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476030 n.2373A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1476032 n.2375C>G non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1476033 n.2376T>G non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1476034 n.2377C>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1476035 n.2378G>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1476044 n.2387T>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1476045 n.2388G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1476046 n.2389G>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1476047 n.2390G>C non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1476049 n.2392C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476086 n.2429G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476099 n.2442A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476103 n.2446C>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1476105 n.2450delA non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1476110 n.2453G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476115 n.2458T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476131 n.2474C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476160 n.2503T>C non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476194 n.2537A>G non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476200 n.2543A>T non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476201 n.2544C>T non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476214 n.2557G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476221 n.2564T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476224 n.2567A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476245 n.2588C>T non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476252 n.2595T>G non_coding_transcript_exon_variant 0.97 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476256 n.2599A>G non_coding_transcript_exon_variant 0.97 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476281 n.2624T>C non_coding_transcript_exon_variant 0.97 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476297 n.2640C>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476298 n.2641C>G non_coding_transcript_exon_variant 0.96 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476300 n.2643G>A non_coding_transcript_exon_variant 0.97 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476309 n.2652G>C non_coding_transcript_exon_variant 0.97 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476383 n.2726T>A non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476408 n.2751G>A non_coding_transcript_exon_variant 0.35 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476425 n.2768G>A non_coding_transcript_exon_variant 0.31 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476524 n.2867C>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1476539 n.2882A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476540 n.2883C>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476584 n.2927C>T non_coding_transcript_exon_variant 0.88 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476585 n.2928A>G non_coding_transcript_exon_variant 0.88 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476594 n.2937C>T non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476603 n.2946G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476608 n.2951C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476614 n.2957A>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1476619 n.2962C>T non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476628 n.2971T>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476629 n.2972C>A non_coding_transcript_exon_variant 0.83 capreomycin Uncertain significance
linezolid
rrl 1476630 n.2973A>G non_coding_transcript_exon_variant 0.99 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476661 n.3004A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476665 n.3008T>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476666 n.3009C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476675 n.3018C>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rpsA 1833589 c.48A>C synonymous_variant 1.0 pyrazinamide
rpsA 1833595 c.54T>C synonymous_variant 1.0 pyrazinamide
rpsA 1833596 p.Ser19Ala missense_variant 1.0 pyrazinamide
rpsA 1833607 c.66T>C synonymous_variant 1.0 pyrazinamide
rpsA 1833616 c.75A>C synonymous_variant 1.0 pyrazinamide
rpsA 1833619 c.78A>C synonymous_variant 1.0 pyrazinamide
rpsA 1833623 p.Lys28Ala missense_variant 0.9 pyrazinamide
rpsA 1833694 c.153G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833697 c.156C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833709 c.168C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833727 c.186G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833733 c.192C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833734 p.Ala65Ser missense_variant 1.0 pyrazinamide
rpsA 1833739 c.198C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833742 c.201A>G synonymous_variant 1.0 pyrazinamide
rpsA 1833745 c.204G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833781 c.240T>C synonymous_variant 1.0 pyrazinamide
rpsA 1833787 c.246C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833790 c.249T>C synonymous_variant 1.0 pyrazinamide
rpsA 1833793 c.252C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833811 c.270G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833829 c.288A>G synonymous_variant 1.0 pyrazinamide
rpsA 1833832 c.291G>A synonymous_variant 1.0 pyrazinamide
rpsA 1833838 c.297G>T synonymous_variant 1.0 pyrazinamide
rpsA 1833841 c.300C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833847 c.306C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833850 c.309C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833856 c.315A>G synonymous_variant 1.0 pyrazinamide
rpsA 1833862 c.321G>T synonymous_variant 1.0 pyrazinamide
rpsA 1833894 p.Ala118Glu missense_variant 1.0 pyrazinamide
rpsA 1833928 c.387G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833955 c.414G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833970 c.429G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833976 c.435C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833979 c.438T>C synonymous_variant 1.0 pyrazinamide
rpsA 1833985 c.444G>T synonymous_variant 1.0 pyrazinamide
rpsA 1833991 c.450C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833997 c.456G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834000 c.459G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834009 c.468C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834012 c.471G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834015 c.474G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834024 c.483G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834030 c.489C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834034 p.Ile165Val missense_variant 1.0 pyrazinamide
rpsA 1834069 c.528G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834093 c.552G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834099 c.558C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834105 c.564C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834108 c.567C>A synonymous_variant 1.0 pyrazinamide
rpsA 1834114 c.573G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834246 c.705G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834249 c.708T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834261 c.720A>C synonymous_variant 1.0 pyrazinamide
rpsA 1834264 c.723G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834279 c.738C>T synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
rpsA 1834327 c.786G>T synonymous_variant 1.0 pyrazinamide
rpsA 1834340 p.Met267Leu missense_variant 1.0 pyrazinamide Uncertain significance
rpsA 1834348 c.807T>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
rpsA 1834384 c.843A>G synonymous_variant 1.0 pyrazinamide
rpsA 1834396 c.855G>T synonymous_variant 1.0 pyrazinamide
rpsA 1834399 p.His286Gln missense_variant 1.0 pyrazinamide
rpsA 1834411 c.870T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834423 c.882G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834432 c.891G>T synonymous_variant 1.0 pyrazinamide
rpsA 1834451 c.910T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834465 c.924T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834468 c.927A>G synonymous_variant 1.0 pyrazinamide
rpsA 1834489 c.948T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834528 c.987T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834534 c.993C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834540 c.999G>T synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
rpsA 1834543 c.1002C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834546 c.1005T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834552 c.1011G>T synonymous_variant 1.0 pyrazinamide
rpsA 1834555 c.1014T>G synonymous_variant 1.0 pyrazinamide
rpsA 1834557 p.Ala339Gly missense_variant 1.0 pyrazinamide
rpsA 1834570 c.1029C>T synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
rpsA 1834574 c.1033_1035delATGinsCC frameshift_variant&missense_variant 1.0 pyrazinamide Uncertain significance
rpsA 1834609 c.1068T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834612 c.1071G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834619 c.1078T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834627 c.1086C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834636 c.1095C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834639 c.1098T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834650 p.Thr370Asn missense_variant 1.0 pyrazinamide
rpsA 1834653 p.Glu371Ala missense_variant 1.0 pyrazinamide
rpsA 1834663 c.1122C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834667 c.1126_1128delGCGinsTC frameshift_variant&missense_variant 1.0 pyrazinamide Uncertain significance
rpsA 1834688 c.1147_1149delAGTinsTCG synonymous_variant 1.0 pyrazinamide
rpsA 1834733 p.Ala398Pro missense_variant 1.0 pyrazinamide
rpsA 1834738 c.1197A>G synonymous_variant 1.0 pyrazinamide
kasA 2517941 c.-174C>G upstream_gene_variant 1.0 isoniazid
kasA 2517959 c.-156C>T upstream_gene_variant 1.0 isoniazid
kasA 2517962 c.-153C>G upstream_gene_variant 1.0 isoniazid
Rv2477c 2783605 c.438T>C synonymous_variant 1.0 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783611 c.432C>G synonymous_variant 1.0 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783628 p.Ala139Ser missense_variant 1.0 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783656 c.387G>C synonymous_variant 1.0 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783659 c.384A>G synonymous_variant 1.0 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783665 c.378A>G synonymous_variant 1.0 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783668 c.375G>C synonymous_variant 1.0 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783672 p.Arg124Lys missense_variant 1.0 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783674 c.369T>C synonymous_variant 1.0 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783683 c.360A>G synonymous_variant 1.0 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783698 c.343_345delACCinsTG frameshift_variant&missense_variant 1.0 ethambutol Uncertain significance
moxifloxacin Uncertain significance
streptomycin Uncertain significance
levofloxacin Uncertain significance
kanamycin Uncertain significance
rifampicin Uncertain significance
amikacin Uncertain significance
Rv2477c 2783920 c.123G>C synonymous_variant 0.91 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783926 c.117C>G synonymous_variant 0.92 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783932 c.111C>G synonymous_variant 0.93 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783935 c.108C>G synonymous_variant 0.94 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783956 c.87T>C synonymous_variant 1.0 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783962 c.81T>C synonymous_variant 1.0 ethambutol Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
streptomycin Not assoc w R - Interim
levofloxacin
kanamycin Not assoc w R - Interim
rifampicin Not assoc w R - Interim
amikacin Not assoc w R - Interim
Rv2477c 2783967 p.Leu26Met missense_variant 0.94 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783968 c.75G>C synonymous_variant 0.94 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783971 c.72G>C synonymous_variant 0.94 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783983 c.60C>T synonymous_variant 0.93 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783986 c.57G>C synonymous_variant 0.93 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783992 c.51T>C synonymous_variant 0.93 ethambutol Not assoc w R - Interim
moxifloxacin
streptomycin Not assoc w R - Interim
levofloxacin Not assoc w R - Interim
kanamycin Not assoc w R - Interim
rifampicin Not assoc w R - Interim
amikacin
Rv2477c 2783998 c.45C>T synonymous_variant 0.93 ethambutol Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
streptomycin Not assoc w R - Interim
levofloxacin
kanamycin Not assoc w R - Interim
rifampicin Not assoc w R - Interim
amikacin Not assoc w R - Interim
Rv2477c 2784010 c.33C>G synonymous_variant 0.92 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2784016 c.27G>A synonymous_variant 0.9 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
mtrA 3627080 c.270T>C synonymous_variant 1.0 bedaquiline
rifampicin Not assoc w R - Interim
mtrB 3627083 c.-470G>C upstream_gene_variant 1.0 bedaquiline
rifampicin
mtrB 3627092 c.-479C>G upstream_gene_variant 1.0 bedaquiline
rifampicin
mtrA 3627098 c.252A>C synonymous_variant 1.0 bedaquiline
rifampicin Not assoc w R - Interim
rpoA 3877704 c.804G>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3877731 c.777G>T synonymous_variant 1.0 rifampicin
rpoA 3877734 c.774G>T synonymous_variant 1.0 rifampicin
rpoA 3877743 c.765T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3878322 c.186A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3878331 c.177A>C synonymous_variant 1.0 rifampicin
rpoA 3878334 c.174T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3878337 c.171T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3878346 c.162T>C synonymous_variant 1.0 rifampicin
rpoA 3878358 c.150C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3878361 c.147G>T synonymous_variant 1.0 rifampicin
rpoA 3878364 c.144A>C synonymous_variant 1.0 rifampicin
rpoA 3878391 c.117T>C synonymous_variant 1.0 rifampicin
rpoA 3878406 c.102G>C synonymous_variant 1.0 rifampicin
rpoA 3879136 c.-629A>G upstream_gene_variant 1.0 rifampicin
rpoA 3879145 c.-638G>C upstream_gene_variant 1.0 rifampicin
clpC1 4038740 c.1965G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038746 c.1959C>T synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4038749 c.1956C>T synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4038755 c.1950G>T synonymous_variant 1.0 pyrazinamide
clpC1 4038767 c.1938G>T synonymous_variant 1.0 pyrazinamide
clpC1 4038773 c.1932T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038791 c.1914G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038795 p.Ser637Thr missense_variant 1.0 pyrazinamide
clpC1 4038812 c.1893T>C synonymous_variant 0.96 pyrazinamide
clpC1 4038815 c.1890G>A synonymous_variant 1.0 pyrazinamide
clpC1 4038839 c.1866G>C synonymous_variant 0.84 pyrazinamide
clpC1 4038860 c.1845G>C synonymous_variant 0.74 pyrazinamide Not assoc w R - Interim
clpC1 4038878 c.1827A>G synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4038881 c.1824C>T synonymous_variant 0.31 pyrazinamide
clpC1 4038885 p.Gly607Ala missense_variant 0.32 pyrazinamide
clpC1 4038890 c.1815G>A synonymous_variant 0.68 pyrazinamide
clpC1 4038905 c.1800A>C synonymous_variant 0.67 pyrazinamide
clpC1 4038911 c.1794G>T synonymous_variant 0.67 pyrazinamide
clpC1 4038914 c.1791G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038917 c.1788C>T synonymous_variant 0.74 pyrazinamide
clpC1 4038923 c.1782A>G synonymous_variant 1.0 pyrazinamide
clpC1 4038926 c.1779G>T synonymous_variant 1.0 pyrazinamide
clpC1 4038953 c.1752A>G synonymous_variant 1.0 pyrazinamide
clpC1 4038956 c.1749T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038965 c.1740T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038971 c.1734T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038974 c.1731T>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4038997 c.1708T>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4039004 c.1701C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039007 c.1698G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039022 c.1683A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039073 c.1632C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039079 c.1626C>G synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4039082 c.1623C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039085 c.1620A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039091 c.1614G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039097 c.1608G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039106 c.1599G>T synonymous_variant 1.0 pyrazinamide
clpC1 4039112 c.1593C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039121 c.1584T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039142 c.1563A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039145 c.1560G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039169 c.1536A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039172 c.1533A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039178 c.1527G>T synonymous_variant 1.0 pyrazinamide
clpC1 4039181 c.1522_1524delTTGinsCC frameshift_variant&missense_variant 1.0 pyrazinamide
clpC1 4039187 c.1518G>T synonymous_variant 1.0 pyrazinamide
clpC1 4039190 c.1515C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039199 p.Ala502Glu missense_variant 1.0 pyrazinamide
clpC1 4039217 c.1488G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039226 c.1479T>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4039274 c.1431G>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4039279 p.Val476Ile missense_variant 1.0 pyrazinamide
clpC1 4039280 c.1425G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039283 c.1422C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039286 c.1419T>G synonymous_variant 1.0 pyrazinamide
clpC1 4039292 c.1413C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039295 c.1410A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039310 c.1395A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039313 c.1392C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039319 c.1386T>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4039328 c.1377A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039334 c.1371G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039337 c.1368A>C synonymous_variant 1.0 pyrazinamide
clpC1 4039347 p.Arg453Lys missense_variant 1.0 pyrazinamide
clpC1 4039355 c.1350G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039359 p.Ser449Asn missense_variant 1.0 pyrazinamide
clpC1 4039361 c.1344C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039382 c.1323C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039391 c.1314T>G synonymous_variant 1.0 pyrazinamide
clpC1 4039394 c.1311G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039397 c.1308A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039442 c.1263A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039589 c.1116G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039592 c.1113G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039610 c.1095G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039616 c.1089G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039622 c.1083C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039649 c.1056G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039664 c.1041G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039682 c.1023C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039691 c.1014G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039694 c.1011G>C synonymous_variant 0.97 pyrazinamide
clpC1 4039700 c.1005C>T synonymous_variant 0.97 pyrazinamide Not assoc w R - Interim
clpC1 4039724 c.981A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039733 c.972G>C synonymous_variant 0.97 pyrazinamide
clpC1 4039742 c.963C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039748 c.957G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039751 c.954A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039757 c.948A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039766 c.939T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039769 c.936C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039778 c.927A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039781 c.924G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039793 c.912C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039802 c.903G>T synonymous_variant 1.0 pyrazinamide
clpC1 4039814 c.891C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039817 c.888A>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4039820 c.885T>G synonymous_variant 1.0 pyrazinamide
clpC1 4039831 c.874T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039832 c.873C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039850 c.855T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039865 c.840T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039889 c.816G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039898 c.807C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039904 c.801A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039931 c.774T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039934 c.771G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039937 c.768G>T synonymous_variant 1.0 pyrazinamide
clpC1 4039946 c.759A>T synonymous_variant 1.0 pyrazinamide
clpC1 4039952 c.753T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039964 c.741C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039982 c.723G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039988 c.717C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039991 c.714G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040002 p.His235Asn missense_variant 1.0 pyrazinamide
clpC1 4040003 c.702G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040018 c.687G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040021 c.684A>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4040024 c.681A>G synonymous_variant 1.0 pyrazinamide
clpC1 4040051 c.654C>G synonymous_variant 1.0 pyrazinamide
clpC1 4040057 c.648C>T synonymous_variant 1.0 pyrazinamide
clpC1 4040066 c.639G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040069 c.636G>T synonymous_variant 1.0 pyrazinamide
clpC1 4040108 c.597G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040117 c.588A>G synonymous_variant 1.0 pyrazinamide
clpC1 4040124 p.Glu194Ser missense_variant 1.0 pyrazinamide
clpC1 4040486 c.219G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040495 c.210C>T synonymous_variant 1.0 pyrazinamide
clpC1 4040516 c.189C>A synonymous_variant 1.0 pyrazinamide