TB-Profiler result

Run: ERR369162


Run ID: ERR369162

Sample name:

Date: 01-04-2023 02:44:46

Number of reads: 137391

Percentage reads mapped: 4.97

Strain: lineage4

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6100 c.861G>C synonymous_variant 1.0
gyrB 6115 c.876A>G synonymous_variant 1.0
gyrB 6121 c.882C>T synonymous_variant 1.0
gyrB 6124 c.885C>G synonymous_variant 1.0
gyrB 6127 c.888G>C synonymous_variant 1.0
gyrB 6130 c.891T>C synonymous_variant 1.0
gyrB 6133 c.894G>C synonymous_variant 1.0
gyrB 6178 c.939C>T synonymous_variant 1.0
gyrB 6184 c.945C>G synonymous_variant 1.0
gyrB 6193 c.954G>A synonymous_variant 1.0
gyrB 6196 c.957C>A synonymous_variant 1.0
gyrB 6199 c.960C>T synonymous_variant 1.0
gyrB 6203 p.Ser322Ala missense_variant 1.0
gyrB 6211 c.972G>C synonymous_variant 1.0
gyrB 6215 p.Ser326Thr missense_variant 1.0
gyrB 6223 c.984G>C synonymous_variant 1.0
gyrB 6241 p.Asp334Glu missense_variant 1.0
gyrA 6550 c.-752A>G upstream_gene_variant 1.0
gyrA 6571 c.-731T>C upstream_gene_variant 1.0
gyrA 6577 c.-725T>C upstream_gene_variant 1.0
gyrA 6583 c.-719G>C upstream_gene_variant 1.0
gyrB 6590 p.Arg451Ser missense_variant 1.0
gyrA 6598 c.-704C>G upstream_gene_variant 1.0
gyrA 6604 c.-698G>A upstream_gene_variant 1.0
gyrA 6610 c.-692C>G upstream_gene_variant 1.0
gyrA 6613 c.-689A>G upstream_gene_variant 1.0
gyrA 6616 c.-686A>G upstream_gene_variant 1.0
gyrA 6631 c.-671C>T upstream_gene_variant 1.0
gyrA 6637 c.-665T>G upstream_gene_variant 1.0
gyrA 6640 c.-662A>C upstream_gene_variant 1.0
gyrA 6643 c.-659A>G upstream_gene_variant 1.0
gyrA 6649 c.-653T>C upstream_gene_variant 1.0
gyrA 6655 c.-647T>C upstream_gene_variant 1.0
gyrA 6670 c.-632G>C upstream_gene_variant 1.0
gyrA 6673 c.-629A>C upstream_gene_variant 1.0
gyrA 6676 c.-626T>G upstream_gene_variant 1.0
gyrA 6697 c.-605C>T upstream_gene_variant 1.0
gyrA 6700 c.-602T>C upstream_gene_variant 1.0
gyrA 6703 c.-599G>T upstream_gene_variant 1.0
gyrA 6706 c.-596G>A upstream_gene_variant 1.0
gyrA 6709 c.-593A>G upstream_gene_variant 1.0
gyrA 6715 c.-587C>T upstream_gene_variant 1.0
gyrA 6727 c.-575G>T upstream_gene_variant 1.0
gyrA 6728 c.-574_-572delCTAinsTTG upstream_gene_variant 1.0
gyrA 6745 c.-557T>C upstream_gene_variant 1.0
gyrA 6760 c.-542G>C upstream_gene_variant 1.0
gyrA 6764 c.-538C>T upstream_gene_variant 1.0
gyrA 6772 c.-530C>G upstream_gene_variant 0.98
gyrA 6775 c.-527G>T upstream_gene_variant 1.0
gyrA 6796 c.-506C>T upstream_gene_variant 1.0
gyrB 6798 p.Gly520Ala missense_variant 1.0
gyrA 6808 c.-494C>G upstream_gene_variant 1.0
gyrA 6811 c.-491C>T upstream_gene_variant 1.0
gyrA 6824 c.-478C>T upstream_gene_variant 1.0
gyrA 6841 c.-461T>C upstream_gene_variant 1.0
gyrA 6856 c.-446T>C upstream_gene_variant 1.0
gyrA 6862 c.-440C>G upstream_gene_variant 1.0
gyrA 6866 c.-436C>T upstream_gene_variant 1.0
gyrA 6869 c.-433T>C upstream_gene_variant 1.0
gyrA 6872 c.-430T>C upstream_gene_variant 1.0
gyrA 6889 c.-413G>T upstream_gene_variant 1.0
gyrA 6967 c.-335T>C upstream_gene_variant 1.0
gyrB 6968 p.Asp577Gln missense_variant 1.0
gyrA 6976 c.-326A>G upstream_gene_variant 1.0
gyrA 6982 c.-320A>G upstream_gene_variant 1.0
gyrA 6994 c.-308C>T upstream_gene_variant 1.0
gyrA 7006 c.-296T>G upstream_gene_variant 1.0
gyrB 7010 p.Leu591Met missense_variant 1.0
gyrA 7018 c.-284G>C upstream_gene_variant 1.0
gyrA 7024 c.-278G>C upstream_gene_variant 1.0
gyrA 7033 c.-269G>C upstream_gene_variant 1.0
gyrB 7051 p.Glu604Asp missense_variant 1.0
gyrA 7060 c.-242T>C upstream_gene_variant 1.0
gyrA 7066 c.-236G>C upstream_gene_variant 1.0
gyrA 7078 c.-224A>T upstream_gene_variant 1.0
gyrA 7084 c.-218A>G upstream_gene_variant 1.0
gyrA 7090 c.-212C>T upstream_gene_variant 1.0
gyrA 7093 c.-209T>C upstream_gene_variant 1.0
gyrA 7099 c.-203G>A upstream_gene_variant 1.0
gyrA 7100 c.-202T>C upstream_gene_variant 1.0
gyrA 7120 c.-182T>C upstream_gene_variant 1.0
gyrA 7123 c.-179C>G upstream_gene_variant 1.0
gyrA 7126 c.-176G>C upstream_gene_variant 1.0
gyrA 7129 c.-173T>G upstream_gene_variant 1.0
gyrA 7136 c.-166T>C upstream_gene_variant 1.0
gyrA 7144 c.-158A>G upstream_gene_variant 1.0
gyrA 7150 c.-152G>A upstream_gene_variant 1.0
gyrA 7153 c.-149G>C upstream_gene_variant 1.0
gyrA 7159 c.-143C>T upstream_gene_variant 1.0
gyrA 7162 c.-140C>G upstream_gene_variant 1.0
gyrA 7168 c.-134C>G upstream_gene_variant 1.0
gyrA 7178 c.-124T>C upstream_gene_variant 1.0
gyrA 7186 c.-116C>G upstream_gene_variant 1.0
gyrA 7189 c.-113C>T upstream_gene_variant 1.0
gyrB 7210 p.Asp657Glu missense_variant 1.0
gyrA 7216 c.-86G>C upstream_gene_variant 1.0
gyrA 7225 c.-77T>C upstream_gene_variant 1.0
gyrA 7234 c.-68C>A upstream_gene_variant 1.0
gyrA 7355 c.54T>A synonymous_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7391 c.90C>T synonymous_variant 1.0
gyrA 7394 c.93T>C synonymous_variant 1.0
gyrA 7397 c.96G>C synonymous_variant 1.0
gyrA 7412 c.111C>G synonymous_variant 1.0
gyrA 7421 c.120G>C synonymous_variant 1.0
gyrA 7427 c.126G>C synonymous_variant 1.0
gyrA 7430 c.129G>A synonymous_variant 1.0
gyrA 7442 c.141G>C synonymous_variant 1.0
gyrA 7457 c.156T>C synonymous_variant 1.0
gyrA 7463 c.162G>C synonymous_variant 1.0
gyrA 7466 c.165G>C synonymous_variant 1.0
gyrA 7469 c.168C>T synonymous_variant 1.0
gyrA 7472 c.171T>C synonymous_variant 1.0
gyrA 7475 c.174A>G synonymous_variant 1.0
gyrA 7480 p.Phe60Tyr missense_variant 1.0
gyrA 7484 c.183T>C synonymous_variant 1.0
gyrA 7490 c.189C>G synonymous_variant 1.0
gyrA 7496 c.195C>G synonymous_variant 1.0
gyrA 7499 c.198G>C synonymous_variant 1.0
gyrA 7523 c.222C>G synonymous_variant 1.0
gyrA 7526 c.225G>C synonymous_variant 1.0
gyrA 7532 c.231T>G synonymous_variant 1.0
gyrA 7559 c.258G>A synonymous_variant 1.0
gyrA 7571 c.270G>C synonymous_variant 1.0
gyrA 7574 c.273G>C synonymous_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 7587 c.286C>T synonymous_variant 1.0
gyrA 7595 c.294C>T synonymous_variant 1.0
gyrA 7601 c.300C>G synonymous_variant 1.0
gyrA 7619 c.318C>T synonymous_variant 1.0
gyrA 7640 c.339G>A synonymous_variant 1.0
gyrA 7643 c.342C>A synonymous_variant 1.0
gyrA 7652 c.351C>T synonymous_variant 1.0
gyrA 7658 c.357A>G synonymous_variant 1.0
gyrA 7685 p.Arg128Ser missense_variant 1.0
gyrA 7694 c.393A>G synonymous_variant 1.0
gyrA 7698 c.397C>A synonymous_variant 1.0
gyrA 7706 c.405C>A synonymous_variant 1.0
gyrA 7710 c.409T>C synonymous_variant 1.0
gyrA 7715 c.414G>C synonymous_variant 1.0
gyrA 7721 c.420G>A synonymous_variant 1.0
gyrA 7728 c.427_429delAGGinsCGT synonymous_variant 1.0
gyrA 7760 c.459C>T synonymous_variant 1.0
gyrA 7763 c.462T>C synonymous_variant 1.0
gyrA 7781 c.480G>C synonymous_variant 1.0
gyrA 7782 p.Gln161Met missense_variant 1.0
gyrA 7793 c.492G>C synonymous_variant 1.0
gyrA 7799 c.498A>G synonymous_variant 1.0
gyrA 7802 c.501C>G synonymous_variant 1.0
gyrA 7814 c.513C>G synonymous_variant 1.0
gyrA 7831 c.531_532delGT frameshift_variant 1.0
gyrA 7847 c.546G>C synonymous_variant 1.0
gyrA 7853 c.552C>T synonymous_variant 1.0
gyrA 7859 c.558A>C synonymous_variant 1.0
gyrA 7865 c.564T>C synonymous_variant 1.0
gyrA 7868 p.Ile189Met missense_variant 1.0
gyrA 7890 c.589C>T synonymous_variant 1.0
gyrA 7898 p.Asp199Glu missense_variant 1.0
gyrA 7901 c.600G>C synonymous_variant 1.0
gyrA 7906 p.Phe202Tyr missense_variant 1.0
gyrA 7919 p.Glu206Asp missense_variant 1.0
gyrA 7922 c.621T>C synonymous_variant 1.0
gyrA 7928 p.Asp209Glu missense_variant 1.0
gyrA 8129 c.828T>C synonymous_variant 1.0
gyrA 8168 c.867A>G synonymous_variant 1.0
gyrA 8174 c.873C>G synonymous_variant 1.0
gyrA 8177 c.876A>C synonymous_variant 1.0
gyrA 8187 p.Leu296Ile missense_variant 1.0
gyrA 8192 c.891C>G synonymous_variant 1.0
gyrA 8198 c.897T>C synonymous_variant 1.0
gyrA 8207 c.906T>C synonymous_variant 1.0
gyrA 8210 c.909G>A synonymous_variant 1.0
gyrA 8267 c.966G>C synonymous_variant 1.0
gyrA 8270 c.969G>T synonymous_variant 1.0
gyrA 8283 p.Ile328Leu missense_variant 1.0
gyrA 8288 c.987T>C synonymous_variant 1.0
gyrA 8294 c.993T>C synonymous_variant 1.0
gyrA 8324 c.1023T>C synonymous_variant 1.0
gyrA 8339 c.1038A>G synonymous_variant 1.0
gyrA 8340 p.Ala347Ser missense_variant 1.0
gyrA 8354 c.1053G>C synonymous_variant 1.0
gyrA 8369 c.1068G>A synonymous_variant 1.0
gyrA 8372 c.1071G>C synonymous_variant 1.0
gyrA 8378 c.1077C>T synonymous_variant 1.0
gyrA 8603 c.1302A>C synonymous_variant 1.0
gyrA 8609 c.1308G>C synonymous_variant 1.0
gyrA 8619 c.1318T>C synonymous_variant 1.0
gyrA 8624 c.1323G>T synonymous_variant 1.0
gyrA 8633 c.1332C>A synonymous_variant 1.0
gyrA 8636 c.1335A>C synonymous_variant 1.0
gyrA 8642 c.1341A>G synonymous_variant 1.0
gyrA 8645 c.1344C>G synonymous_variant 1.0
gyrA 8649 p.Arg450Lys missense_variant 1.0
gyrA 8655 p.Ile452Val missense_variant 1.0
gyrA 8672 c.1371A>G synonymous_variant 1.0
gyrA 8693 c.1392T>C synonymous_variant 1.0
gyrA 8696 c.1395G>C synonymous_variant 1.0
gyrA 8699 c.1398A>G synonymous_variant 1.0
gyrA 8837 c.1536C>A synonymous_variant 1.0
gyrA 8840 c.1539C>T synonymous_variant 1.0
gyrA 8852 c.1551T>C synonymous_variant 1.0
gyrA 8858 c.1557T>C synonymous_variant 1.0
gyrA 8870 c.1569G>C synonymous_variant 1.0
gyrA 8897 c.1596T>C synonymous_variant 1.0
gyrA 8915 c.1614A>G synonymous_variant 1.0
gyrA 8924 c.1623C>T synonymous_variant 1.0
gyrA 8945 c.1644G>C synonymous_variant 1.0
gyrA 8946 c.1645_1647delTTGinsCTC synonymous_variant 1.0
gyrA 8967 p.Ala556Lys missense_variant 1.0
gyrA 8990 c.1689C>G synonymous_variant 1.0
gyrA 8993 c.1692C>T synonymous_variant 1.0
gyrA 8996 c.1695T>C synonymous_variant 1.0
gyrA 8998 p.Leu566Trp missense_variant 1.0
gyrA 9018 p.Gln573Lys missense_variant 1.0
gyrA 9023 c.1722A>T synonymous_variant 1.0
gyrA 9026 c.1725G>C synonymous_variant 1.0
gyrA 9029 c.1728T>C synonymous_variant 1.0
gyrA 9032 c.1731T>C synonymous_variant 1.0
gyrA 9035 c.1734G>C synonymous_variant 1.0
gyrA 9044 c.1743C>G synonymous_variant 1.0
gyrA 9051 c.1750T>C synonymous_variant 1.0
gyrA 9063 p.Ser588Ala missense_variant 1.0
gyrA 9068 c.1767G>C synonymous_variant 1.0
gyrA 9071 c.1770G>C synonymous_variant 1.0
gyrA 9080 c.1779G>C synonymous_variant 1.0
gyrA 9086 c.1785C>T synonymous_variant 1.0
gyrA 9089 c.1788G>T synonymous_variant 1.0
gyrA 9092 c.1791C>G synonymous_variant 1.0
gyrA 9099 c.1798_1800delTTAinsCTG synonymous_variant 1.0
gyrA 9119 c.1818A>G synonymous_variant 1.0
gyrA 9128 c.1827C>G synonymous_variant 1.0
fgd1 490935 c.153C>G synonymous_variant 1.0
fgd1 490948 p.Ser56Ala missense_variant 1.0
fgd1 490959 c.177C>G synonymous_variant 1.0
fgd1 490962 c.180T>C synonymous_variant 1.0
fgd1 490971 c.189A>G synonymous_variant 1.0
fgd1 490978 p.Asn66Gln missense_variant 1.0
fgd1 490983 c.201G>C synonymous_variant 1.0
fgd1 490988 p.Leu69Gln missense_variant 1.0
fgd1 490992 c.210G>C synonymous_variant 1.0
fgd1 490998 c.216T>C synonymous_variant 1.0
fgd1 491022 c.240C>G synonymous_variant 1.0
fgd1 491031 c.249C>G synonymous_variant 1.0
fgd1 491034 c.252C>G synonymous_variant 1.0
fgd1 491039 p.Ile86Thr missense_variant 1.0
fgd1 491043 c.261T>A synonymous_variant 1.0
fgd1 491049 c.267T>C synonymous_variant 1.0
fgd1 491064 c.282A>G synonymous_variant 1.0
fgd1 491313 c.531C>T synonymous_variant 1.0
fgd1 491317 p.Pro179Ala missense_variant 1.0
fgd1 491321 p.Ala180Val missense_variant 1.0
fgd1 491325 c.543G>T synonymous_variant 1.0
fgd1 491337 c.555C>G synonymous_variant 1.0
fgd1 491340 c.558C>G synonymous_variant 1.0
fgd1 491343 c.561C>T synonymous_variant 1.0
fgd1 491349 c.567T>C synonymous_variant 1.0
fgd1 491355 c.573C>A synonymous_variant 1.0
fgd1 491364 c.582T>C synonymous_variant 1.0
fgd1 491367 c.585G>C synonymous_variant 1.0
fgd1 491370 c.588C>G synonymous_variant 1.0
fgd1 491388 c.606C>G synonymous_variant 1.0
fgd1 491453 p.Gly224Asp missense_variant 1.0
fgd1 491461 p.Lys227Arg missense_variant 1.0
fgd1 491472 c.690A>G synonymous_variant 1.0
fgd1 491496 c.714C>T synonymous_variant 1.0
fgd1 491503 p.Leu241Lys missense_variant 1.0
fgd1 491508 c.726A>G synonymous_variant 1.0
fgd1 491509 c.727T>C synonymous_variant 1.0
fgd1 491512 p.Asn244Glu missense_variant 1.0
fgd1 491523 c.741G>C synonymous_variant 1.0
fgd1 491526 c.744T>C synonymous_variant 1.0
fgd1 491542 c.760T>C synonymous_variant 1.0
fgd1 491547 c.765A>T synonymous_variant 1.0
fgd1 491548 p.Ala256Pro missense_variant 1.0
fgd1 491569 p.Asp263His missense_variant 1.0
fgd1 491577 c.795G>C synonymous_variant 1.0
fgd1 491590 p.Lys270Arg missense_variant 1.0
fgd1 491601 c.819T>C synonymous_variant 1.0
fgd1 491603 p.Ala274Glu missense_variant 1.0
fgd1 491605 c.823C>T synonymous_variant 1.0
fgd1 491610 c.828A>C synonymous_variant 1.0
fgd1 491620 p.Ile280Val missense_variant 1.0
fgd1 491640 c.858G>C synonymous_variant 1.0
fgd1 491643 c.861G>C synonymous_variant 1.0
fgd1 491646 c.864G>C synonymous_variant 1.0
fgd1 491652 c.870C>G synonymous_variant 1.0
mshA 575695 c.348C>G synonymous_variant 1.0
mshA 575704 c.357T>C synonymous_variant 1.0
mshA 575705 c.358T>C synonymous_variant 1.0
mshA 575734 c.387T>G synonymous_variant 1.0
mshA 575737 c.390T>C synonymous_variant 1.0
mshA 575740 c.393G>A synonymous_variant 1.0
mshA 575744 p.Ala133Thr missense_variant 1.0
mshA 575756 c.409C>T synonymous_variant 1.0
mshA 575779 c.432A>G synonymous_variant 1.0
mshA 575785 c.438T>C synonymous_variant 1.0
mshA 575792 p.Asp149Asn missense_variant 1.0
mshA 575795 p.Ile150Leu missense_variant 1.0
mshA 575800 c.453G>T synonymous_variant 1.0
mshA 575818 c.471G>T synonymous_variant 1.0
mshA 575821 c.474G>C synonymous_variant 1.0
mshA 575829 p.Val161Ala missense_variant 1.0
mshA 575842 c.495G>C synonymous_variant 1.0
mshA 575845 c.498C>G synonymous_variant 1.0
ccsA 620400 c.510C>T synonymous_variant 1.0
ccsA 620412 c.522T>C synonymous_variant 1.0
ccsA 620415 c.525T>C synonymous_variant 1.0
ccsA 620430 c.540C>T synonymous_variant 1.0
ccsA 620436 c.546T>G synonymous_variant 1.0
ccsA 620439 c.549T>G synonymous_variant 1.0
ccsA 620445 c.555A>G synonymous_variant 1.0
ccsA 620454 c.564C>G synonymous_variant 1.0
rpoB 760070 c.264T>G synonymous_variant 1.0
rpoB 760088 c.282C>G synonymous_variant 1.0
rpoB 760091 c.285G>C synonymous_variant 1.0
rpoB 760101 c.295T>C synonymous_variant 1.0
rpoB 760106 c.300G>C synonymous_variant 1.0
rpoB 760110 c.304_306delTCTinsAGC synonymous_variant 1.0
rpoB 760118 c.312T>G synonymous_variant 1.0
rpoB 760121 c.315T>C synonymous_variant 1.0
rpoB 760130 p.Asp108Glu missense_variant 1.0
rpoB 760184 c.378A>G synonymous_variant 1.0
rpoB 760196 c.390C>G synonymous_variant 1.0
rpoB 760223 c.417T>C synonymous_variant 1.0
rpoB 760235 c.429T>C synonymous_variant 1.0
rpoB 760244 c.438G>C synonymous_variant 1.0
rpoB 760274 p.Glu156Asp missense_variant 1.0
rpoB 760276 p.Lys157Met missense_variant 1.0
rpoB 760283 c.477G>C synonymous_variant 1.0
rpoB 760298 c.492G>C synonymous_variant 1.0
rpoB 760307 c.501T>C synonymous_variant 1.0
rpoB 760313 c.507G>C synonymous_variant 1.0
rpoB 760357 p.Thr184Asn missense_variant 1.0
rpoB 760361 c.555T>C synonymous_variant 1.0
rpoB 760370 c.564C>G synonymous_variant 1.0
rpoB 760376 p.Asp190Glu missense_variant 1.0
rpoB 760382 c.576G>C synonymous_variant 1.0
rpoB 760400 c.594G>C synonymous_variant 1.0
rpoB 760406 c.600G>C synonymous_variant 1.0
rpoB 760407 p.Ser201Gly missense_variant 1.0
rpoB 760412 c.606C>T synonymous_variant 1.0
rpoB 760415 c.609C>T synonymous_variant 1.0
rpoB 760418 c.612G>A synonymous_variant 1.0
rpoB 760430 c.624T>C synonymous_variant 1.0
rpoB 760433 c.627C>T synonymous_variant 1.0
rpoB 760454 c.648C>G synonymous_variant 1.0
rpoB 760457 c.651C>T synonymous_variant 1.0
rpoB 760469 c.663C>T synonymous_variant 1.0
rpoB 760475 c.669A>G synonymous_variant 1.0
rpoB 760478 c.672C>T synonymous_variant 1.0
rpoB 760481 c.675G>T synonymous_variant 1.0
rpoB 760484 c.678A>G synonymous_variant 1.0
rpoB 760487 c.681G>C synonymous_variant 1.0
rpoB 760502 c.696C>G synonymous_variant 1.0
rpoB 760508 c.702G>A synonymous_variant 1.0
rpoB 760511 c.705G>C synonymous_variant 1.0
rpoB 760522 p.Ser239Asn missense_variant 1.0
rpoB 760532 c.726T>C synonymous_variant 1.0
rpoB 760541 c.735G>T synonymous_variant 1.0
rpoB 760561 c.757_758delCG frameshift_variant 1.0
rpoB 760571 c.765G>C synonymous_variant 1.0
rpoB 760588 p.Thr261Ile missense_variant 1.0
rpoB 760591 p.Val262Ala missense_variant 1.0
rpoB 760595 c.789C>T synonymous_variant 1.0
rpoB 760596 p.Thr264Pro missense_variant 1.0
rpoB 760607 c.801G>C synonymous_variant 1.0
rpoB 760611 c.805T>C synonymous_variant 1.0
rpoB 760634 c.828T>C synonymous_variant 1.0
rpoB 760646 c.840C>G synonymous_variant 1.0
rpoB 760655 c.849A>G synonymous_variant 1.0
rpoB 760661 c.855A>C synonymous_variant 1.0
rpoB 760668 p.Thr288Ala missense_variant 1.0
rpoB 760674 c.868T>C synonymous_variant 1.0
rpoB 760679 c.873A>G synonymous_variant 1.0
rpoB 760683 c.877T>C synonymous_variant 1.0
rpoB 760703 c.897C>T synonymous_variant 1.0
rpoB 760721 c.915C>G synonymous_variant 1.0
rpoB 760724 c.918T>C synonymous_variant 1.0
rpoB 760727 c.921C>G synonymous_variant 1.0
rpoB 760730 c.924T>C synonymous_variant 1.0
rpoB 760736 c.930C>G synonymous_variant 1.0
rpoB 760748 c.942C>G synonymous_variant 1.0
rpoB 760751 c.945G>T synonymous_variant 1.0
rpoB 760817 c.1011A>G synonymous_variant 1.0
rpoB 760820 c.1014T>C synonymous_variant 1.0
rpoB 760826 c.1020C>G synonymous_variant 1.0
rpoB 760830 c.1024T>C synonymous_variant 1.0
rpoB 760841 c.1035T>C synonymous_variant 1.0
rpoB 760858 p.Val351Ala missense_variant 1.0
rpoB 760862 c.1056G>C synonymous_variant 1.0
rpoB 760869 p.Val355Leu missense_variant 1.0
rpoB 760877 c.1071G>C synonymous_variant 1.0
rpoB 760883 c.1077G>C synonymous_variant 1.0
rpoB 760886 c.1080A>G synonymous_variant 1.0
rpoB 760887 p.Thr361Val missense_variant 1.0
rpoB 760910 c.1104C>T synonymous_variant 1.0
rpoB 760916 c.1110C>T synonymous_variant 1.0
rpoB 760919 c.1113C>T synonymous_variant 1.0
rpoB 760928 c.1122G>C synonymous_variant 1.0
rpoB 760946 c.1140A>G synonymous_variant 1.0
rpoB 760965 p.Met387Leu missense_variant 1.0
rpoB 760973 c.1167G>T synonymous_variant 1.0
rpoB 760982 c.1176G>C synonymous_variant 1.0
rpoB 760985 c.1179G>C synonymous_variant 1.0
rpoB 760988 c.1182C>G synonymous_variant 1.0
rpoB 760991 c.1185G>T synonymous_variant 1.0
rpoB 760997 c.1191G>C synonymous_variant 1.0
rpoB 761006 c.1200C>T synonymous_variant 1.0
rpoB 761015 c.1209G>C synonymous_variant 1.0
rpoB 761027 c.1221A>C synonymous_variant 1.0
rpoB 761036 c.1230G>C synonymous_variant 1.0
rpoB 761037 c.1231T>C synonymous_variant 1.0
rpoB 761051 c.1245G>T synonymous_variant 1.0
rpoB 761054 c.1248G>C synonymous_variant 1.0
rpoB 761057 c.1251G>C synonymous_variant 1.0
rpoB 761060 c.1254C>G synonymous_variant 1.0
rpoB 761063 c.1257C>G synonymous_variant 1.0
rpoB 761084 c.1278C>A synonymous_variant 1.0
rpoB 761097 c.1291_1293delAGCinsTCG synonymous_variant 1.0
rpoB 761102 c.1296A>G synonymous_variant 1.0
rpoB 761126 c.1320G>T synonymous_variant 1.0
rpoB 761132 c.1326G>T synonymous_variant 0.89
rpoB 761133 c.1327T>C synonymous_variant 1.0
rpoB 761147 c.1341C>T synonymous_variant 1.0
rpoB 761150 c.1344A>T synonymous_variant 1.0
rpoB 761159 c.1353G>T synonymous_variant 1.0
rpoB 761165 c.1359G>C synonymous_variant 1.0
rpoB 761171 c.1365C>T synonymous_variant 1.0
rpoB 761178 p.Ser458Thr missense_variant 1.0
rpoB 761186 p.Glu460Asp missense_variant 1.0
rpoB 761189 c.1383T>C synonymous_variant 1.0
rpoB 761192 c.1386C>T synonymous_variant 1.0
rpoB 761195 c.1389G>C synonymous_variant 1.0
rpoB 761198 c.1392G>T synonymous_variant 1.0
rpoB 761219 c.1413G>C synonymous_variant 1.0
rpoB 761234 c.1428G>C synonymous_variant 1.0
rpoB 761249 c.1443A>G synonymous_variant 1.0
rpoB 761255 c.1449T>G synonymous_variant 1.0
rpoB 761258 c.1452G>A synonymous_variant 1.0
rpoB 761261 c.1455G>C synonymous_variant 1.0
rpoB 761264 c.1458C>G synonymous_variant 1.0
rpoB 761273 c.1467T>C synonymous_variant 1.0
rpoB 761282 c.1476C>T synonymous_variant 0.96
rpoB 761288 c.1482G>T synonymous_variant 1.0
rpoB 761318 c.1512G>C synonymous_variant 1.0
rpoB 761327 c.1521A>G synonymous_variant 1.0
rpoB 761346 p.Val514Ser missense_variant 1.0
rpoB 761351 p.Asp515Glu missense_variant 1.0
rpoB 761354 c.1548C>T synonymous_variant 1.0
rpoB 761357 c.1551G>C synonymous_variant 1.0
rpoB 761360 c.1554T>C synonymous_variant 1.0
rpoB 761362 p.Ser519Thr missense_variant 1.0
rpoB 761373 p.Val523His missense_variant 1.0
rpoB 761393 c.1587G>A synonymous_variant 1.0
rpoB 761408 c.1602G>C synonymous_variant 1.0
rpoB 761537 c.1731C>G synonymous_variant 1.0
rpoB 761555 c.1749G>C synonymous_variant 1.0
rpoB 761558 c.1752C>G synonymous_variant 1.0
rpoB 761564 c.1758G>C synonymous_variant 1.0
rpoB 761570 c.1764T>C synonymous_variant 1.0
rpoB 761573 c.1767C>G synonymous_variant 1.0
rpoB 761579 c.1773G>C synonymous_variant 1.0
rpoB 761612 c.1806G>T synonymous_variant 0.98
rpoB 761615 c.1809A>C synonymous_variant 1.0
rpoB 761636 c.1830G>T synonymous_variant 1.0
rpoB 761645 c.1839C>G synonymous_variant 1.0
rpoB 761648 c.1842T>C synonymous_variant 1.0
rpoB 761666 c.1860G>C synonymous_variant 1.0
rpoB 761669 c.1863C>T synonymous_variant 1.0
rpoB 761675 c.1869G>T synonymous_variant 1.0
rpoB 761687 c.1881C>T synonymous_variant 1.0
rpoB 761690 c.1884G>C synonymous_variant 1.0
rpoB 761693 c.1887G>C synonymous_variant 1.0
rpoB 761717 c.1911C>T synonymous_variant 1.0
rpoB 761727 p.Ser641Gly missense_variant 1.0
rpoB 761728 c.1923dupC frameshift_variant 1.0
rpoB 761732 c.1926C>T synonymous_variant 1.0
rpoB 761741 c.1935G>A synonymous_variant 1.0
rpoB 761750 c.1944G>C synonymous_variant 1.0
rpoB 761760 p.Ile652Val missense_variant 1.0
rpoB 761765 c.1959T>C synonymous_variant 1.0
rpoB 761772 p.His656Ala missense_variant 1.0
rpoB 761778 p.Asn658Asp missense_variant 1.0
rpoB 761789 c.1983G>C synonymous_variant 1.0
rpoB 761791 p.Arg662Gln missense_variant 1.0
rpoB 761794 p.Thr663Ser missense_variant 1.0
rpoB 761802 p.Met666Leu missense_variant 1.0
rpoB 761813 c.2007T>C synonymous_variant 1.0
rpoB 761819 c.2013G>T synonymous_variant 1.0
rpoB 761834 c.2028T>C synonymous_variant 1.0
rpoB 761847 p.Cys681Lys missense_variant 1.0
rpoB 761863 p.Ala686Glu missense_variant 1.0
rpoB 761868 p.Asp688Gln missense_variant 1.0
rpoB 761873 c.2067A>G synonymous_variant 1.0
rpoB 761881 p.Ala692Val missense_variant 1.0
rpoB 761891 c.2085G>C synonymous_variant 1.0
rpoB 761906 c.2100C>T synonymous_variant 1.0
rpoB 761909 c.2103T>C synonymous_variant 1.0
rpoB 761912 c.2106T>C synonymous_variant 1.0
rpoB 761915 p.Asp703Glu missense_variant 1.0
rpoB 761916 p.Asp704Asn missense_variant 1.0
rpoB 761924 c.2118G>A synonymous_variant 1.0
rpoB 761930 c.2124G>C synonymous_variant 1.0
rpoB 761933 c.2127G>C synonymous_variant 1.0
rpoB 761936 c.2130C>T synonymous_variant 1.0
rpoB 761948 c.2142G>C synonymous_variant 1.0
rpoB 761954 c.2148C>T synonymous_variant 1.0
rpoB 761955 p.Ile717Val missense_variant 1.0
rpoB 761969 c.2163G>A synonymous_variant 1.0
rpoB 761990 c.2184G>C synonymous_variant 1.0
rpoB 762008 c.2202C>T synonymous_variant 1.0
rpoB 762014 c.2208C>G synonymous_variant 1.0
rpoB 762038 c.2232C>T synonymous_variant 1.0
rpoB 762047 c.2241G>A synonymous_variant 1.0
rpoB 762053 c.2247T>C synonymous_variant 1.0
rpoB 762056 c.2250G>A synonymous_variant 1.0
rpoB 762065 c.2259T>G synonymous_variant 1.0
rpoB 762071 c.2265C>T synonymous_variant 1.0
rpoB 762083 c.2277T>C synonymous_variant 1.0
rpoB 762086 c.2280G>T synonymous_variant 1.0
rpoB 762101 c.2295C>G synonymous_variant 1.0
rpoB 762114 p.Ile770Val missense_variant 1.0
rpoB 762122 c.2316C>T synonymous_variant 1.0
rpoB 762131 c.2325C>G synonymous_variant 1.0
rpoB 762134 c.2328C>A synonymous_variant 1.0
rpoB 762137 c.2331C>T synonymous_variant 1.0
rpoB 762140 c.2334G>C synonymous_variant 1.0
rpoB 762143 c.2337T>C synonymous_variant 1.0
rpoB 762149 c.2343G>T synonymous_variant 1.0
rpoB 762158 c.2352G>C synonymous_variant 1.0
rpoB 762167 c.2361T>C synonymous_variant 1.0
rpoB 762176 c.2370T>C synonymous_variant 1.0
rpoB 762185 c.2379G>C synonymous_variant 1.0
rpoB 762194 c.2388G>C synonymous_variant 1.0
rpoB 762221 c.2415G>A synonymous_variant 1.0
rpoB 762233 c.2427G>C synonymous_variant 0.98
rpoB 762236 c.2430G>C synonymous_variant 1.0
rpoB 762245 c.2439G>C synonymous_variant 1.0
rpoB 762284 c.2478G>T synonymous_variant 1.0
rpoB 762293 c.2487T>C synonymous_variant 1.0
rpoB 762296 c.2490G>T synonymous_variant 1.0
rpoB 762314 c.2508C>T synonymous_variant 1.0
rpoB 762317 c.2511A>G synonymous_variant 1.0
rpoB 762329 c.2523G>C synonymous_variant 1.0
rpoC 762434 c.-936T>C upstream_gene_variant 1.0
rpoC 762449 c.-921C>A upstream_gene_variant 1.0
rpoC 762452 c.-918G>C upstream_gene_variant 1.0
rpoC 762470 c.-900G>C upstream_gene_variant 1.0
rpoC 762488 c.-882G>C upstream_gene_variant 1.0
rpoC 762491 c.-879T>C upstream_gene_variant 1.0
rpoC 762509 c.-861T>G upstream_gene_variant 1.0
rpoB 762510 p.Ala902Pro missense_variant 1.0
rpoC 762515 c.-855C>T upstream_gene_variant 1.0
rpoC 762533 c.-837T>C upstream_gene_variant 1.0
rpoC 762536 c.-834T>C upstream_gene_variant 1.0
rpoC 762537 c.-833T>C upstream_gene_variant 1.0
rpoC 762551 c.-819C>T upstream_gene_variant 1.0
rpoC 762560 c.-810A>T upstream_gene_variant 1.0
rpoC 762563 c.-807G>T upstream_gene_variant 1.0
rpoC 762581 c.-789T>C upstream_gene_variant 1.0
rpoC 762582 c.-788T>C upstream_gene_variant 1.0
rpoC 762812 c.-558C>A upstream_gene_variant 1.0
rpoB 762813 p.Met1003Arg missense_variant 1.0
rpoC 762818 c.-552C>G upstream_gene_variant 1.0
rpoC 762827 c.-543G>C upstream_gene_variant 1.0
rpoC 762830 c.-540C>T upstream_gene_variant 1.0
rpoC 762836 c.-534C>T upstream_gene_variant 1.0
rpoC 762857 c.-513C>G upstream_gene_variant 1.0
rpoC 762860 c.-510G>C upstream_gene_variant 1.0
rpoC 762863 c.-507T>C upstream_gene_variant 1.0
rpoB 762879 p.Met1025Leu missense_variant 1.0
rpoC 762894 c.-476C>T upstream_gene_variant 1.0
rpoC 762899 c.-471G>C upstream_gene_variant 1.0
rpoC 762911 c.-459C>T upstream_gene_variant 1.0
rpoC 762917 c.-453C>G upstream_gene_variant 1.0
rpoC 762920 c.-450C>T upstream_gene_variant 1.0
rpoC 762923 c.-447C>G upstream_gene_variant 1.0
rpoC 762959 c.-411G>C upstream_gene_variant 1.0
rpoC 762962 c.-408C>T upstream_gene_variant 1.0
rpoC 762983 c.-387C>T upstream_gene_variant 1.0
rpoC 762989 c.-381G>A upstream_gene_variant 1.0
rpoC 762995 c.-375G>T upstream_gene_variant 1.0
rpoC 763031 c.-339T>G upstream_gene_variant 1.0
rpoC 763034 c.-336C>A upstream_gene_variant 1.0
rpoC 763040 c.-330C>G upstream_gene_variant 1.0
rpoC 763070 c.-300T>C upstream_gene_variant 1.0
rpoC 763082 c.-288C>T upstream_gene_variant 1.0
rpoC 763085 c.-285C>T upstream_gene_variant 1.0
rpoC 763088 c.-282C>G upstream_gene_variant 1.0
rpoC 763094 c.-276G>C upstream_gene_variant 1.0
rpoC 763115 c.-255T>C upstream_gene_variant 1.0
rpoC 763127 c.-243G>C upstream_gene_variant 1.0
rpoC 763136 c.-234C>T upstream_gene_variant 1.0
rpoC 763142 c.-228C>G upstream_gene_variant 1.0
rpoC 763157 c.-213G>T upstream_gene_variant 1.0
rpoC 763166 c.-204A>G upstream_gene_variant 1.0
rpoC 763172 c.-198G>C upstream_gene_variant 1.0
rpoC 763187 c.-183C>G upstream_gene_variant 1.0
rpoC 763193 c.-177C>G upstream_gene_variant 1.0
rpoC 763202 c.-168A>G upstream_gene_variant 1.0
rpoC 763205 c.-165G>C upstream_gene_variant 1.0
rpoB 763207 p.Ser1134Lys missense_variant 1.0
rpoC 763214 c.-156T>C upstream_gene_variant 1.0
rpoC 763217 c.-153G>C upstream_gene_variant 1.0
rpoC 763220 c.-150G>C upstream_gene_variant 1.0
rpoB 763227 p.Leu1141Met missense_variant 1.0
rpoB 763235 p.Glu1143Asp missense_variant 1.0
rpoC 763238 c.-132T>C upstream_gene_variant 1.0
rpoB 763241 p.Glu1145Asp missense_variant 1.0
rpoC 763402 c.33C>T synonymous_variant 1.0
rpoC 763408 c.39T>C synonymous_variant 1.0
rpoC 763411 c.42T>C synonymous_variant 1.0
rpoC 763414 c.45T>G synonymous_variant 1.0
rpoC 763415 p.Thr16Ser missense_variant 1.0
rpoC 763423 p.Glu18Asp missense_variant 1.0
rpoC 763430 c.61_63delAGGinsCGT synonymous_variant 1.0
rpoC 763433 p.Gln22Asn missense_variant 1.0
rpoC 763443 p.Tyr25Phe missense_variant 1.0
rpoC 763450 c.81G>A synonymous_variant 1.0
rpoC 763456 c.87A>G synonymous_variant 1.0
rpoC 763468 c.99G>C synonymous_variant 1.0
rpoC 763486 c.117T>C synonymous_variant 1.0
rpoC 763492 c.123G>C synonymous_variant 1.0
rpoC 763528 c.159G>A synonymous_variant 1.0
rpoC 763531 c.162G>T synonymous_variant 1.0
rpoC 763546 c.177A>G synonymous_variant 1.0
rpoC 763570 c.201G>C synonymous_variant 1.0
rpoC 763594 c.225C>T synonymous_variant 1.0
rpoC 763618 c.249C>T synonymous_variant 1.0
rpoC 763633 c.264T>C synonymous_variant 1.0
rpoC 763660 c.291T>G synonymous_variant 1.0
rpoC 763666 c.297G>C synonymous_variant 1.0
rpoC 763669 c.300C>G synonymous_variant 1.0
rpoC 763675 c.306C>G synonymous_variant 1.0
rpoC 763699 c.330G>T synonymous_variant 1.0
rpoC 763702 c.333C>G synonymous_variant 1.0
rpoC 763708 c.339G>T synonymous_variant 1.0
rpoC 763711 c.342G>C synonymous_variant 1.0
rpoC 763714 c.345G>A synonymous_variant 1.0
rpoC 763717 c.348T>C synonymous_variant 1.0
rpoC 763723 c.354G>C synonymous_variant 1.0
rpoC 763732 c.363C>G synonymous_variant 1.0
rpoC 763741 c.372C>T synonymous_variant 1.0
rpoC 763747 c.378G>A synonymous_variant 1.0
rpoC 763765 c.396T>C synonymous_variant 1.0
rpoC 763768 c.399C>T synonymous_variant 1.0
rpoC 763774 c.405G>C synonymous_variant 1.0
rpoC 763781 p.Ser138Ala missense_variant 1.0
rpoC 763792 p.Glu141Asp missense_variant 1.0
rpoC 763796 p.Met143Leu missense_variant 1.0
rpoC 763801 c.432C>T synonymous_variant 1.0
rpoC 763807 c.438T>C synonymous_variant 1.0
rpoC 763816 c.447C>G synonymous_variant 1.0
rpoC 763861 c.492C>T synonymous_variant 1.0
rpoC 763872 p.Gly168Ala missense_variant 1.0
rpoC 763876 p.Glu169Asp missense_variant 1.0
rpoC 763879 c.510A>G synonymous_variant 1.0
rpoC 763888 c.519G>C synonymous_variant 1.0
rpoC 763891 c.522G>C synonymous_variant 1.0
rpoC 763894 c.525A>G synonymous_variant 1.0
rpoC 763900 c.531G>C synonymous_variant 1.0
rpoC 763921 c.552G>C synonymous_variant 1.0
rpoC 763933 c.564C>T synonymous_variant 1.0
rpoC 763940 p.Ala191Ser missense_variant 1.0
rpoC 763947 p.Ala193Val missense_variant 1.0
rpoC 763951 c.582G>C synonymous_variant 1.0
rpoC 763960 c.591T>G synonymous_variant 1.0
rpoC 763963 c.594C>T synonymous_variant 1.0
rpoC 763969 c.600C>T synonymous_variant 1.0
rpoC 763987 c.618C>T synonymous_variant 1.0
rpoC 764040 p.Ser224Thr missense_variant 1.0
rpoC 764044 c.675T>C synonymous_variant 1.0
rpoC 764059 c.690G>T synonymous_variant 1.0
rpoC 764077 c.708C>G synonymous_variant 1.0
rpoC 764083 c.714A>G synonymous_variant 1.0
rpoC 764084 p.Asn239Val missense_variant 1.0
rpoC 764098 c.729A>G synonymous_variant 1.0
rpoC 764101 c.732C>G synonymous_variant 1.0
rpoC 764104 c.735C>G synonymous_variant 1.0
rpoC 764110 c.741C>T synonymous_variant 1.0
rpoC 764140 c.771C>T synonymous_variant 1.0
rpoC 764143 c.774G>C synonymous_variant 1.0
rpoC 764317 c.948C>G synonymous_variant 1.0
rpoC 764320 c.951C>A synonymous_variant 1.0
rpoC 764339 c.970C>T synonymous_variant 1.0
rpoC 764344 c.975C>T synonymous_variant 1.0
rpoC 764353 c.984G>T synonymous_variant 1.0
rpoC 764365 c.996C>T synonymous_variant 1.0
rpoC 764371 c.1002G>T synonymous_variant 1.0
rpoC 764377 c.1008C>G synonymous_variant 1.0
rpoC 764380 c.1011G>C synonymous_variant 1.0
rpoC 764383 c.1014C>T synonymous_variant 1.0
rpoC 764387 c.1018T>C synonymous_variant 1.0
rpoC 764405 c.1036_1038delAGGinsCGC synonymous_variant 1.0
rpoC 764428 c.1059G>C synonymous_variant 1.0
rpoC 764431 c.1062G>C synonymous_variant 1.0
rpoC 764434 c.1065A>G synonymous_variant 1.0
rpoC 764435 c.1066_1068delAGGinsCGA synonymous_variant 1.0
rpoC 764458 c.1089G>C synonymous_variant 1.0
rpoC 764461 c.1092A>G synonymous_variant 1.0
rpoC 764497 c.1128A>G synonymous_variant 1.0
rpoC 764506 c.1137C>T synonymous_variant 1.0
rpoC 764527 c.1158C>T synonymous_variant 1.0
rpoC 764530 c.1161C>T synonymous_variant 1.0
rpoC 764533 c.1164C>A synonymous_variant 1.0
rpoC 764536 c.1167G>T synonymous_variant 1.0
rpoC 764539 c.1170C>G synonymous_variant 1.0
rpoC 764548 c.1179G>A synonymous_variant 1.0
rpoC 764554 c.1185C>T synonymous_variant 1.0
rpoC 764566 c.1197C>G synonymous_variant 1.0
rpoC 764575 c.1206T>G synonymous_variant 1.0
rpoC 764578 c.1209C>G synonymous_variant 1.0
rpoC 764593 c.1224C>T synonymous_variant 1.0
rpoC 764602 c.1233C>T synonymous_variant 1.0
rpoC 764611 c.1242G>T synonymous_variant 1.0
rpoC 764626 c.1257C>T synonymous_variant 1.0
rpoC 764632 c.1263T>C synonymous_variant 1.0
rpoC 764635 c.1266C>T synonymous_variant 1.0
rpoC 764650 c.1281G>T synonymous_variant 1.0
rpoC 764713 c.1344G>T synonymous_variant 1.0
rpoC 764746 c.1377G>T synonymous_variant 1.0
rpoC 764752 c.1383G>C synonymous_variant 1.0
rpoC 764758 c.1389C>G synonymous_variant 1.0
rpoC 764764 c.1395T>C synonymous_variant 1.0
rpoC 764803 c.1434C>T synonymous_variant 1.0
rpoC 764810 p.Pro481Ala missense_variant 1.0
rpoC 764815 c.1446A>G synonymous_variant 1.0
rpoC 764827 c.1458G>C synonymous_variant 1.0
rpoC 764858 c.1489T>C synonymous_variant 1.0
rpoC 764869 c.1500C>T synonymous_variant 1.0
rpoC 764875 c.1506C>A synonymous_variant 1.0
rpoC 764878 c.1509C>G synonymous_variant 1.0
rpoC 764887 c.1518G>C synonymous_variant 1.0
rpoC 764888 c.1519T>C synonymous_variant 1.0
rpoC 764911 c.1542A>G synonymous_variant 1.0
rpoC 764912 p.Met515Gln missense_variant 1.0
rpoC 764932 c.1563C>A synonymous_variant 1.0
rpoC 764948 c.1579T>C synonymous_variant 1.0
rpoC 764968 c.1599T>C synonymous_variant 1.0
rpoC 765000 p.His544Pro missense_variant 0.33
rpoC 765007 c.1638T>G synonymous_variant 1.0
rpoC 765008 c.1639T>C synonymous_variant 1.0
rpoC 765011 c.1642_1644delAGCinsTCG synonymous_variant 1.0
rpoC 765016 c.1647C>G synonymous_variant 1.0
rpoC 765019 c.1650A>G synonymous_variant 1.0
rpoC 765040 c.1671T>C synonymous_variant 1.0
rpoC 765041 c.1672T>C synonymous_variant 1.0
rpoC 765047 c.1678T>C synonymous_variant 1.0
rpoC 765055 c.1686C>G synonymous_variant 1.0
rpoC 765073 c.1704G>C synonymous_variant 1.0
rpoC 765076 c.1707A>G synonymous_variant 1.0
rpoC 765079 c.1710T>G synonymous_variant 1.0
rpoC 765082 c.1713G>C synonymous_variant 1.0
rpoC 765085 c.1716T>C synonymous_variant 1.0
rpoC 765089 c.1720T>C synonymous_variant 1.0
rpoC 765103 c.1734G>T synonymous_variant 1.0
rpoC 765121 c.1752G>T synonymous_variant 1.0
rpoC 765129 p.Tyr587Phe missense_variant 1.0
rpoC 765151 c.1782G>C synonymous_variant 1.0
rpoC 765283 c.1914C>G synonymous_variant 1.0
rpoC 765288 p.Leu640Gln missense_variant 1.0
rpoC 765292 c.1923G>T synonymous_variant 0.67
rpoC 765300 p.Val644Ala missense_variant 1.0
rpoC 765305 p.Ile646Val missense_variant 1.0
rpoC 765319 c.1950A>G synonymous_variant 1.0
rpoC 765323 c.1955_1957delGCC disruptive_inframe_deletion 1.0
rpoC 765328 p.His653Gln missense_variant 1.0
rpoC 765330 p.Ser654Asn missense_variant 1.0
rpoC 765334 c.1965C>T synonymous_variant 1.0
rpoC 765343 c.1974G>A synonymous_variant 1.0
rpoC 765352 c.1983G>C synonymous_variant 1.0
rpoC 765356 p.Met663Val missense_variant 1.0
rpoC 765379 c.2010G>C synonymous_variant 1.0
rpoC 765383 p.Met672Leu missense_variant 1.0
rpoC 765394 c.2025G>A synonymous_variant 1.0
rpoC 765403 c.2034G>C synonymous_variant 1.0
rpoC 765405 p.Leu679His missense_variant 1.0
rpoC 765409 c.2040T>G synonymous_variant 1.0
rpoC 765412 c.2043T>C synonymous_variant 1.0
rpoC 765421 c.2052C>G synonymous_variant 1.0
rpoC 765449 p.Ala694Ser missense_variant 1.0
rpoC 765454 c.2085C>G synonymous_variant 1.0
rpoC 765469 c.2100G>C synonymous_variant 1.0
rpoC 765478 c.2109T>G synonymous_variant 1.0
rpoC 765480 p.Tyr704Phe missense_variant 1.0
rpoC 765496 c.2127C>T synonymous_variant 1.0
rpoC 765499 c.2130C>G synonymous_variant 1.0
rpoC 765529 c.2160C>T synonymous_variant 1.0
rpoC 765533 p.Tyr722His missense_variant 1.0
rpoC 765544 c.2175C>G synonymous_variant 1.0
rpoC 765547 c.2178C>T synonymous_variant 1.0
rpoC 765548 c.2179_2181delAGCinsTCG synonymous_variant 1.0
rpoC 765553 c.2184C>T synonymous_variant 1.0
rpoC 765556 c.2187G>C synonymous_variant 1.0
rpoC 765562 c.2193G>C synonymous_variant 1.0
rpoC 765591 p.Arg741Gln missense_variant 1.0
rpoC 765596 p.Lys743Ala missense_variant 0.83
rpoC 765607 c.2238C>G synonymous_variant 1.0
rpoC 765648 p.Phe760Tyr missense_variant 1.0
rpoC 765658 c.2289C>T synonymous_variant 1.0
rpoC 765668 p.His767Asn missense_variant 1.0
rpoC 765671 p.Asp768Gln missense_variant 1.0
rpoC 765679 c.2310C>T synonymous_variant 1.0
rpoC 765680 p.Asn771Arg missense_variant 1.0
rpoC 765685 p.Glu772Asp missense_variant 1.0
rpoC 765694 c.2325G>C synonymous_variant 1.0
rpoC 765695 p.Glu776Lys missense_variant 1.0
rpoC 765700 c.2331T>C synonymous_variant 1.0
rpoC 765704 p.Lys779Gln missense_variant 1.0
rpoC 765728 p.Gln787Lys missense_variant 1.0
rpoC 765734 c.2365T>C synonymous_variant 1.0
rpoC 765737 p.Arg790Glu missense_variant 1.0
rpoC 765823 c.2454C>G synonymous_variant 1.0
rpoC 765826 c.2457T>C synonymous_variant 1.0
rpoC 765835 c.2466C>T synonymous_variant 1.0
rpoC 765861 p.Phe831Tyr missense_variant 1.0
rpoC 765868 c.2499G>A synonymous_variant 1.0
rpoC 765871 c.2502T>G synonymous_variant 1.0
rpoC 765875 p.Val836Ile missense_variant 1.0
rpoC 765886 c.2517C>G synonymous_variant 1.0
rpoC 765907 c.2538G>T synonymous_variant 1.0
rpoC 765928 c.2559C>G synonymous_variant 1.0
rpoC 765937 c.2568T>C synonymous_variant 1.0
rpoC 765940 c.2571A>T synonymous_variant 1.0
rpoC 765946 c.2577C>T synonymous_variant 1.0
rpoC 765947 c.2578T>C synonymous_variant 1.0
rpoC 765962 c.2593_2595delTTGinsCTT synonymous_variant 1.0
rpoC 765973 c.2604C>T synonymous_variant 1.0
rpoC 765979 c.2610C>G synonymous_variant 1.0
rpoC 765982 c.2613C>T synonymous_variant 1.0
rpoC 765994 c.2625A>T synonymous_variant 1.0
rpoC 766009 c.2640G>C synonymous_variant 1.0
rpoC 766012 c.2643C>G synonymous_variant 1.0
rpoC 766333 c.2964G>T synonymous_variant 1.0
rpoC 766348 c.2979A>G synonymous_variant 1.0
rpoC 766351 c.2982C>G synonymous_variant 1.0
rpoC 766353 p.Val995Ala missense_variant 1.0
rpoC 766369 c.3000C>A synonymous_variant 1.0
rpoC 766375 c.3006C>G synonymous_variant 1.0
rpoC 766381 c.3012C>T synonymous_variant 1.0
rpoC 766384 c.3015A>G synonymous_variant 1.0
rpoC 766390 c.3021C>T synonymous_variant 1.0
rpoC 766408 c.3039C>T synonymous_variant 1.0
rpoC 766435 p.Glu1022Asp missense_variant 1.0
rpoC 766568 p.Val1067Ile missense_variant 1.0
rpoC 766573 c.3204T>G synonymous_variant 1.0
rpoC 766576 c.3207C>T synonymous_variant 1.0
rpoC 766582 c.3213C>T synonymous_variant 1.0
rpoC 766585 c.3216T>C synonymous_variant 1.0
rpoC 766594 c.3225G>T synonymous_variant 1.0
rpoC 766607 p.Ile1080Leu missense_variant 1.0
rpoC 766618 c.3249G>T synonymous_variant 1.0
rpoC 766624 c.3255G>C synonymous_variant 1.0
rpoC 766630 c.3261G>C synonymous_variant 1.0
rpoC 766633 c.3264G>C synonymous_variant 1.0
rpoC 766645 c.3276A>G synonymous_variant 1.0
rpoC 766654 c.3285C>G synonymous_variant 1.0
rpoC 766657 c.3288A>G synonymous_variant 1.0
rpoC 766660 c.3291G>T synonymous_variant 1.0
rpoC 766661 p.Val1098Pro missense_variant 1.0
rpoC 766666 c.3297C>G synonymous_variant 1.0
rpoC 766667 p.Ser1100Ala missense_variant 1.0
rpoC 766690 c.3321G>C synonymous_variant 1.0
rpoC 766693 c.3324C>A synonymous_variant 1.0
rpoC 766702 c.3333G>C synonymous_variant 1.0
rpoC 766792 c.3423C>G synonymous_variant 1.0
rpoC 766799 p.Ala1144Ser missense_variant 1.0
rpoC 766804 c.3435A>G synonymous_variant 1.0
rpoC 766837 c.3468G>C synonymous_variant 1.0
rpoC 766843 c.3474T>G synonymous_variant 1.0
rpoC 766855 c.3486G>A synonymous_variant 1.0
rpoC 766858 c.3489C>T synonymous_variant 1.0
rpoC 766861 c.3492G>C synonymous_variant 1.0
rpoC 766867 c.3498C>G synonymous_variant 1.0
rpoC 766883 p.Ser1172Ala missense_variant 1.0
rpoC 766931 p.Ala1188Thr missense_variant 1.0
rpoC 766935 p.Glu1189Ala missense_variant 1.0
rpoC 766942 c.3573C>T synonymous_variant 1.0
rpoC 766945 c.3576A>C synonymous_variant 1.0
rpoC 766961 p.Gly1198Asn missense_variant 1.0
rpoC 766996 c.3627C>T synonymous_variant 1.0
rpoC 767002 c.3633G>C synonymous_variant 1.0
rpoC 767008 c.3639G>A synonymous_variant 1.0
rpoC 767044 c.3675G>C synonymous_variant 1.0
rpoC 767080 c.3711G>C synonymous_variant 1.0
rpoC 767098 c.3729T>C synonymous_variant 1.0
rpoC 767100 p.Lys1244Arg missense_variant 1.0
rpoC 767104 c.3735C>G synonymous_variant 1.0
rpoC 767107 c.3738C>T synonymous_variant 1.0
rpoC 767119 c.3750A>G synonymous_variant 1.0
rpoC 767125 c.3756G>C synonymous_variant 1.0
rpoC 767134 c.3765C>T synonymous_variant 1.0
rpoC 767138 c.3769C>T synonymous_variant 1.0
rpoC 767149 c.3780C>T synonymous_variant 1.0
rpoC 767167 c.3798C>T synonymous_variant 1.0
rpoC 767180 p.Ala1271Ser missense_variant 1.0
rpoC 767188 c.3819G>A synonymous_variant 1.0
rpoC 767191 c.3822C>G synonymous_variant 1.0
rpoC 767197 c.3828G>A synonymous_variant 1.0
rpoC 767203 c.3834C>G synonymous_variant 1.0
rpoC 767206 c.3837C>G synonymous_variant 1.0
rpoC 767209 c.3840T>C synonymous_variant 1.0
rpoC 767212 c.3843G>C synonymous_variant 1.0
rpoC 767221 c.3852C>G synonymous_variant 1.0
rpoC 767230 c.3861G>T synonymous_variant 1.0
rpoC 767233 c.3864T>C synonymous_variant 1.0
rpoC 767254 c.3885G>C synonymous_variant 1.0
rpoC 767263 c.3894T>C synonymous_variant 1.0
rpoC 767264 p.Ala1299Ser missense_variant 1.0
rpoC 767267 p.Ala1300Asn missense_variant 1.0
rpoC 767281 c.3912C>G synonymous_variant 1.0
rpoC 767284 c.3915C>G synonymous_variant 1.0
rpoC 767302 c.3933C>A synonymous_variant 1.0
mmpL5 775847 c.2634G>A synonymous_variant 1.0
mmpL5 775856 c.2625T>C synonymous_variant 1.0
mmpL5 775862 c.2619G>C synonymous_variant 1.0
mmpL5 775865 c.2616T>G synonymous_variant 1.0
mmpL5 775871 p.Ile870Met missense_variant 1.0
mmpL5 775885 p.Ile866Leu missense_variant 1.0
mmpL5 775886 c.2595A>G synonymous_variant 1.0
mmpL5 775892 p.His863Gln missense_variant 1.0
mmpL5 775895 c.2586C>A synonymous_variant 1.0
mmpL5 775898 c.2583G>A synonymous_variant 1.0
mmpL5 775904 c.2577G>A synonymous_variant 1.0
mmpL5 775910 c.2571G>C synonymous_variant 1.0
mmpL5 775916 c.2565T>A synonymous_variant 1.0
mmpL5 775921 c.2560C>T synonymous_variant 1.0
rpsL 781559 c.-1G>C upstream_gene_variant 1.0
rpsL 781572 p.Gln5Asn missense_variant 1.0
rpsL 781586 c.27C>T synonymous_variant 1.0
rpsL 781595 c.36T>C synonymous_variant 1.0
rpsL 781608 p.Ser17Ala missense_variant 1.0
rpsL 781616 c.57C>G synonymous_variant 1.0
rpsL 781628 c.69T>C synonymous_variant 1.0
rpsL 781631 c.72G>T synonymous_variant 1.0
rpsL 781649 c.90T>C synonymous_variant 1.0
rpsL 781655 c.96T>C synonymous_variant 1.0
rpsL 781658 c.99A>G synonymous_variant 1.0
rpsL 781670 c.111G>C synonymous_variant 1.0
rpsL 781682 c.123T>C synonymous_variant 1.0
rpsL 781706 c.147T>G synonymous_variant 1.0
rpsL 781715 c.156T>G synonymous_variant 1.0
rpsL 781751 c.192G>C synonymous_variant 1.0
rpsL 781754 c.195G>T synonymous_variant 1.0
rpsL 781760 c.201T>C synonymous_variant 1.0
rpsL 781763 c.204C>G synonymous_variant 1.0
rpsL 781766 c.207C>T synonymous_variant 1.0
rpsL 781802 c.243G>C synonymous_variant 1.0
rpsL 781808 c.249C>T synonymous_variant 1.0
rpsL 781811 c.252C>T synonymous_variant 1.0
rpsL 781814 c.255C>T synonymous_variant 1.0
rpsL 781817 c.258G>T synonymous_variant 1.0
rpsL 781829 c.270G>C synonymous_variant 1.0
rpsL 781832 c.273T>C synonymous_variant 1.0
rpsL 781859 c.300T>C synonymous_variant 1.0
rpsL 781868 c.309T>C synonymous_variant 1.0
rpsL 781871 c.312G>C synonymous_variant 1.0
rpsL 781877 c.318T>A synonymous_variant 1.0
rpsL 781892 c.333A>G synonymous_variant 1.0
rpsL 781898 c.339A>T synonymous_variant 1.0
rpsL 781907 c.348T>C synonymous_variant 1.0
rpsL 781916 c.357T>C synonymous_variant 1.0
rpsL 781929 p.Gly124Ser missense_variant 1.0
rplC 800612 c.-197A>G upstream_gene_variant 1.0
rplC 800615 c.-194G>A upstream_gene_variant 1.0
rplC 800618 c.-191T>C upstream_gene_variant 1.0
rplC 800639 c.-170C>T upstream_gene_variant 1.0
rplC 800645 c.-164C>G upstream_gene_variant 1.0
rplC 800648 c.-161A>G upstream_gene_variant 1.0
rplC 800654 c.-155T>C upstream_gene_variant 1.0
rplC 800666 c.-143C>T upstream_gene_variant 1.0
rplC 800672 c.-137G>C upstream_gene_variant 1.0
rplC 800693 c.-116A>C upstream_gene_variant 1.0
rplC 800703 c.-106_-104delTTGinsCTC upstream_gene_variant 1.0
rplC 800715 c.-94A>C upstream_gene_variant 1.0
rplC 800720 c.-89T>C upstream_gene_variant 1.0
rplC 800723 c.-86C>G upstream_gene_variant 1.0
rplC 800735 c.-74C>G upstream_gene_variant 1.0
rplC 800747 c.-62C>T upstream_gene_variant 1.0
rplC 800762 c.-47T>G upstream_gene_variant 1.0
rplC 800780 c.-29C>G upstream_gene_variant 1.0
fbiC 1304022 c.1092T>C synonymous_variant 1.0
fbiC 1304028 c.1098C>T synonymous_variant 1.0
fbiC 1304037 c.1107G>C synonymous_variant 1.0
fbiC 1304049 c.1119T>A synonymous_variant 1.0
fbiC 1304050 p.Leu374Val missense_variant 1.0
fbiC 1304058 p.Glu376Asp missense_variant 1.0
fbiC 1304064 c.1134G>C synonymous_variant 1.0
fbiC 1304066 p.Ala379Asp missense_variant 1.0
fbiC 1304070 c.1140C>G synonymous_variant 1.0
fbiC 1304079 c.1149A>G synonymous_variant 1.0
fbiC 1304085 c.1155C>A synonymous_variant 1.0
fbiC 1304088 c.1158C>T synonymous_variant 1.0
fbiC 1304092 p.Met388Leu missense_variant 1.0
fbiC 1304106 c.1176G>C synonymous_variant 1.0
fbiC 1304115 p.Gln395His missense_variant 1.0
fbiC 1304118 c.1188C>G synonymous_variant 1.0
fbiC 1304119 p.Lys397Gln missense_variant 1.0
fbiC 1304127 c.1197A>G synonymous_variant 1.0
fbiC 1304133 c.1203G>C synonymous_variant 1.0
fbiC 1304136 c.1206C>G synonymous_variant 1.0
fbiC 1304160 c.1230G>A synonymous_variant 1.0
fbiC 1304163 c.1233G>T synonymous_variant 1.0
fbiC 1304169 c.1239T>C synonymous_variant 1.0
fbiC 1304174 p.Val415Glu missense_variant 1.0
fbiC 1304178 c.1248G>C synonymous_variant 1.0
fbiC 1304574 c.1644C>G synonymous_variant 1.0
fbiC 1304578 c.1648_1650delCGTinsAGG synonymous_variant 1.0
fbiC 1304613 c.1683T>C synonymous_variant 1.0
fbiC 1304619 c.1689G>T synonymous_variant 1.0
fbiC 1304628 c.1698G>C synonymous_variant 1.0
fbiC 1304634 c.1704C>G synonymous_variant 1.0
fbiC 1304640 c.1710A>C synonymous_variant 1.0
fbiC 1304646 c.1716T>C synonymous_variant 1.0
fbiC 1304649 c.1719C>T synonymous_variant 1.0
fbiC 1304660 p.Tyr577Phe missense_variant 1.0
fbiC 1305150 c.2220C>A synonymous_variant 1.0
fbiC 1305154 c.2224T>C synonymous_variant 1.0
fbiC 1305159 c.2229G>A synonymous_variant 1.0
fbiC 1305173 p.Asn748Ser missense_variant 1.0
fbiC 1305175 p.Ser749Ala missense_variant 1.0
fbiC 1305181 c.2251T>C synonymous_variant 1.0
fbiC 1305192 c.2262C>G synonymous_variant 1.0
fbiC 1305195 c.2265T>C synonymous_variant 1.0
fbiC 1305198 c.2268G>C synonymous_variant 1.0
fbiC 1305204 c.2274C>G synonymous_variant 1.0
fbiC 1305215 p.Ser762Thr missense_variant 1.0
fbiC 1305217 p.His763Asn missense_variant 1.0
atpE 1461077 c.33C>T synonymous_variant 1.0
atpE 1461086 c.42A>G synonymous_variant 1.0
atpE 1461087 c.43C>T synonymous_variant 1.0
atpE 1461101 c.57T>C synonymous_variant 1.0
atpE 1461107 c.63C>G synonymous_variant 1.0
atpE 1461113 c.69C>T synonymous_variant 1.0
atpE 1461132 p.Val30Ile missense_variant 1.0
atpE 1461146 c.102G>C synonymous_variant 1.0
atpE 1461149 c.105T>G synonymous_variant 1.0
atpE 1461155 c.111C>G synonymous_variant 1.0
atpE 1461161 c.117C>G synonymous_variant 1.0
atpE 1461167 c.123G>T synonymous_variant 1.0
atpE 1461170 c.126A>G synonymous_variant 1.0
atpE 1461179 c.135G>T synonymous_variant 1.0
atpE 1461182 c.138A>G synonymous_variant 1.0
atpE 1461183 p.Gly47Ser missense_variant 1.0
atpE 1461197 c.153A>C synonymous_variant 1.0
atpE 1461219 c.175T>C synonymous_variant 1.0
atpE 1461230 c.186G>T synonymous_variant 1.0
atpE 1461233 c.189A>G synonymous_variant 1.0
atpE 1461251 c.207G>C synonymous_variant 1.0
atpE 1461254 c.210T>C synonymous_variant 1.0
atpE 1461275 c.231T>G synonymous_variant 1.0
atpE 1461278 c.234A>T synonymous_variant 1.0
rrs 1471922 n.78delT non_coding_transcript_exon_variant 1.0
rrs 1471925 n.80T>C non_coding_transcript_exon_variant 1.0
rrs 1471931 n.87delA non_coding_transcript_exon_variant 1.0
rrs 1471934 n.89A>G non_coding_transcript_exon_variant 1.0
rrs 1471985 n.140T>C non_coding_transcript_exon_variant 1.0
rrs 1471986 n.141C>T non_coding_transcript_exon_variant 1.0
rrs 1472030 n.185G>A non_coding_transcript_exon_variant 1.0
rrs 1472031 n.186G>C non_coding_transcript_exon_variant 1.0
rrs 1472032 n.187G>A non_coding_transcript_exon_variant 1.0
rrs 1472033 n.188A>C non_coding_transcript_exon_variant 1.0
rrs 1472035 n.190G>T non_coding_transcript_exon_variant 1.0
rrs 1472040 n.195T>G non_coding_transcript_exon_variant 1.0
rrs 1472041 n.196C>T non_coding_transcript_exon_variant 1.0
rrs 1472042 n.197T>G non_coding_transcript_exon_variant 1.0
rrs 1472043 n.198T>A non_coding_transcript_exon_variant 1.0
rrs 1472050 n.205G>C non_coding_transcript_exon_variant 1.0
rrs 1472053 n.211_212delGC non_coding_transcript_exon_variant 1.0
rrs 1472061 n.216A>T non_coding_transcript_exon_variant 1.0
rrs 1472106 n.261G>A non_coding_transcript_exon_variant 1.0
rrs 1472108 n.263C>T non_coding_transcript_exon_variant 1.0
rrs 1472113 n.268T>C non_coding_transcript_exon_variant 1.0
rrs 1472150 n.305T>A non_coding_transcript_exon_variant 1.0
rrs 1472251 n.406G>A non_coding_transcript_exon_variant 1.0
rrs 1472337 n.492C>G non_coding_transcript_exon_variant 1.0
rrs 1472380 n.535G>C non_coding_transcript_exon_variant 1.0
rrs 1472446 n.601T>A non_coding_transcript_exon_variant 1.0
rrs 1472452 n.607G>A non_coding_transcript_exon_variant 1.0
rrs 1472464 n.619A>G non_coding_transcript_exon_variant 1.0
rrs 1472612 n.767G>T non_coding_transcript_exon_variant 1.0
rrs 1472734 n.889C>T non_coding_transcript_exon_variant 1.0
rrs 1472741 n.896G>A non_coding_transcript_exon_variant 1.0
rrs 1472846 n.1001C>T non_coding_transcript_exon_variant 1.0
rrs 1472847 n.1002G>A non_coding_transcript_exon_variant 1.0
rrs 1472848 n.1003T>C non_coding_transcript_exon_variant 1.0
rrs 1472860 n.1015C>T non_coding_transcript_exon_variant 1.0
rrs 1472861 n.1016G>A non_coding_transcript_exon_variant 1.0
rrs 1472956 n.1111T>C non_coding_transcript_exon_variant 1.0
rrs 1472957 n.1112C>T non_coding_transcript_exon_variant 1.0
rrs 1472969 n.1124A>G non_coding_transcript_exon_variant 1.0
rrs 1472970 n.1125C>G non_coding_transcript_exon_variant 1.0
rrs 1472977 n.1132G>C non_coding_transcript_exon_variant 1.0
rrs 1472978 n.1133T>C non_coding_transcript_exon_variant 1.0
rrs 1472989 n.1144G>A non_coding_transcript_exon_variant 1.0
rrs 1472990 n.1145A>G non_coding_transcript_exon_variant 1.0
rrs 1473082 n.1237G>A non_coding_transcript_exon_variant 1.0
rrs 1473088 n.1243A>G non_coding_transcript_exon_variant 1.0
rrs 1473099 n.1254T>A non_coding_transcript_exon_variant 1.0
rrs 1473105 n.1260G>A non_coding_transcript_exon_variant 1.0
rrs 1473110 n.1265T>G non_coding_transcript_exon_variant 1.0
rrs 1473111 n.1266A>G non_coding_transcript_exon_variant 1.0
rrs 1473121 n.1276T>C non_coding_transcript_exon_variant 0.95
rrs 1473123 n.1278A>T non_coding_transcript_exon_variant 0.98
rrs 1473129 n.1284C>T non_coding_transcript_exon_variant 1.0
rrs 1473145 n.1300C>T non_coding_transcript_exon_variant 1.0
rrs 1473166 n.1321G>A non_coding_transcript_exon_variant 0.98
rrs 1473288 n.1443C>T non_coding_transcript_exon_variant 1.0
rrs 1473290 n.1445C>T non_coding_transcript_exon_variant 1.0
rrs 1473291 n.1446G>T non_coding_transcript_exon_variant 0.98
rrl 1473676 n.19G>A non_coding_transcript_exon_variant 1.0
rrl 1473684 n.27G>A non_coding_transcript_exon_variant 1.0
rrl 1473699 n.43delG non_coding_transcript_exon_variant 1.0
rrl 1473707 n.50T>A non_coding_transcript_exon_variant 1.0
rrl 1473717 n.60G>A non_coding_transcript_exon_variant 1.0
rrl 1473731 n.74T>A non_coding_transcript_exon_variant 1.0
rrl 1473746 n.89T>C non_coding_transcript_exon_variant 1.0
rrl 1473756 n.99G>T non_coding_transcript_exon_variant 1.0
rrl 1473758 n.101G>T non_coding_transcript_exon_variant 1.0
rrl 1473770 n.113T>G non_coding_transcript_exon_variant 0.97
rrl 1473806 n.149C>T non_coding_transcript_exon_variant 1.0
rrl 1473812 n.155G>A non_coding_transcript_exon_variant 1.0
rrl 1473814 n.157A>T non_coding_transcript_exon_variant 1.0
rrl 1473815 n.158T>G non_coding_transcript_exon_variant 1.0
rrl 1473829 n.172G>C non_coding_transcript_exon_variant 1.0
rrl 1473831 n.174G>T non_coding_transcript_exon_variant 1.0
rrl 1473832 n.175C>T non_coding_transcript_exon_variant 1.0
rrl 1473839 n.182G>A non_coding_transcript_exon_variant 1.0
rrl 1473876 n.219G>A non_coding_transcript_exon_variant 1.0
rrl 1473887 n.230T>C non_coding_transcript_exon_variant 1.0
rrl 1473888 n.231T>C non_coding_transcript_exon_variant 1.0
rrl 1473898 n.241C>T non_coding_transcript_exon_variant 1.0
rrl 1473899 n.242A>G non_coding_transcript_exon_variant 1.0
rrl 1473916 n.259C>A non_coding_transcript_exon_variant 1.0
rrl 1473923 n.266C>G non_coding_transcript_exon_variant 1.0
rrl 1473924 n.267_268insT non_coding_transcript_exon_variant 1.0
rrl 1473935 n.278C>T non_coding_transcript_exon_variant 1.0
rrl 1473937 n.280C>T non_coding_transcript_exon_variant 1.0
rrl 1473943 n.286G>T non_coding_transcript_exon_variant 1.0
rrl 1473945 n.288T>A non_coding_transcript_exon_variant 1.0
rrl 1473946 n.289A>T non_coding_transcript_exon_variant 1.0
rrl 1473950 n.293G>T non_coding_transcript_exon_variant 1.0
rrl 1473982 n.325G>T non_coding_transcript_exon_variant 1.0
rrl 1474074 n.417C>T non_coding_transcript_exon_variant 1.0
rrl 1474089 n.432C>T non_coding_transcript_exon_variant 1.0
rrl 1474093 n.436G>A non_coding_transcript_exon_variant 1.0
rrl 1474100 n.443C>T non_coding_transcript_exon_variant 1.0
rrl 1474103 n.446A>C non_coding_transcript_exon_variant 1.0
rrl 1474106 n.449_450insCT non_coding_transcript_exon_variant 1.0
rrl 1474109 n.453_454delAT non_coding_transcript_exon_variant 1.0
rrl 1474130 n.473C>T non_coding_transcript_exon_variant 1.0
rrl 1474140 n.483C>T non_coding_transcript_exon_variant 1.0
rrl 1474151 n.494C>T non_coding_transcript_exon_variant 1.0
rrl 1474181 n.524_525insT non_coding_transcript_exon_variant 1.0
rrl 1474184 n.527C>A non_coding_transcript_exon_variant 1.0
rrl 1474185 n.529delA non_coding_transcript_exon_variant 1.0
rrl 1474249 n.592G>T non_coding_transcript_exon_variant 1.0
rrl 1474263 n.606G>A non_coding_transcript_exon_variant 1.0
rrl 1474282 n.625G>A non_coding_transcript_exon_variant 1.0
rrl 1474291 n.635_649delTTCCTCTCCGGAGGA non_coding_transcript_exon_variant 1.0
rrl 1474308 n.651G>T non_coding_transcript_exon_variant 1.0
rrl 1474310 n.653T>G non_coding_transcript_exon_variant 1.0
rrl 1474356 n.699T>C non_coding_transcript_exon_variant 1.0
rrl 1474362 n.705A>G non_coding_transcript_exon_variant 1.0
rrl 1474376 n.719T>A non_coding_transcript_exon_variant 1.0
rrl 1474387 n.730C>T non_coding_transcript_exon_variant 1.0
rrl 1474413 n.756A>C non_coding_transcript_exon_variant 1.0
rrl 1474415 n.759_781delCACACGCGCATACGCGCGTGTGA non_coding_transcript_exon_variant 1.0
rrl 1474496 n.839C>G non_coding_transcript_exon_variant 0.97
rrl 1474497 n.840G>C non_coding_transcript_exon_variant 0.97
rrl 1474506 n.849C>G non_coding_transcript_exon_variant 1.0
rrl 1474507 n.850G>C non_coding_transcript_exon_variant 1.0
rrl 1474626 n.969T>C non_coding_transcript_exon_variant 1.0
rrl 1474632 n.975G>T non_coding_transcript_exon_variant 1.0
rrl 1474636 n.979A>T non_coding_transcript_exon_variant 1.0
rrl 1474637 n.980C>T non_coding_transcript_exon_variant 1.0
rrl 1474638 n.981C>G non_coding_transcript_exon_variant 1.0
rrl 1474639 n.982G>T non_coding_transcript_exon_variant 1.0
rrl 1474640 n.983C>T non_coding_transcript_exon_variant 1.0
rrl 1474717 n.1060A>G non_coding_transcript_exon_variant 1.0
rrl 1474722 n.1065T>C non_coding_transcript_exon_variant 1.0
rrl 1474743 n.1086T>G non_coding_transcript_exon_variant 1.0
rrl 1474760 n.1103A>G non_coding_transcript_exon_variant 1.0
rrl 1474794 n.1137C>T non_coding_transcript_exon_variant 1.0
rrl 1474803 n.1146G>A non_coding_transcript_exon_variant 1.0
rrl 1474812 n.1155G>A non_coding_transcript_exon_variant 1.0
rrl 1474913 n.1256T>C non_coding_transcript_exon_variant 1.0
rrl 1474932 n.1275C>T non_coding_transcript_exon_variant 1.0
rrl 1475020 n.1363G>A non_coding_transcript_exon_variant 1.0
rrl 1475031 n.1374G>C non_coding_transcript_exon_variant 1.0
rrl 1475061 n.1406delA non_coding_transcript_exon_variant 1.0
rrl 1475076 n.1419C>A non_coding_transcript_exon_variant 1.0
rrl 1475090 n.1433A>T non_coding_transcript_exon_variant 1.0
rrl 1475114 n.1457C>T non_coding_transcript_exon_variant 1.0
rrl 1475120 n.1463G>T non_coding_transcript_exon_variant 1.0
rrl 1475129 n.1472G>A non_coding_transcript_exon_variant 1.0
rrl 1475202 n.1545G>C non_coding_transcript_exon_variant 1.0
rrl 1475209 n.1552G>A non_coding_transcript_exon_variant 1.0
rrl 1475213 n.1556C>T non_coding_transcript_exon_variant 1.0
rrl 1475220 n.1563G>T non_coding_transcript_exon_variant 1.0
rrl 1475291 n.1634A>C non_coding_transcript_exon_variant 1.0
rrl 1475297 n.1640C>G non_coding_transcript_exon_variant 1.0
rrl 1475315 n.1658A>T non_coding_transcript_exon_variant 1.0
rrl 1475337 n.1680C>T non_coding_transcript_exon_variant 1.0
rrl 1475343 n.1686A>G non_coding_transcript_exon_variant 1.0
rrl 1475346 n.1689C>T non_coding_transcript_exon_variant 1.0
rrl 1475353 n.1696A>T non_coding_transcript_exon_variant 1.0
rrl 1475355 n.1698C>T non_coding_transcript_exon_variant 1.0
rrl 1475358 n.1701T>C non_coding_transcript_exon_variant 1.0
rrl 1475361 n.1704G>A non_coding_transcript_exon_variant 1.0
rrl 1475369 n.1712G>C non_coding_transcript_exon_variant 1.0
rrl 1475406 n.1749T>G non_coding_transcript_exon_variant 1.0
rrl 1475429 n.1772G>A non_coding_transcript_exon_variant 1.0
rrl 1475443 n.1786G>A non_coding_transcript_exon_variant 1.0
rrl 1475452 n.1795C>A non_coding_transcript_exon_variant 1.0
rrl 1475475 n.1818C>T non_coding_transcript_exon_variant 1.0
rrl 1475479 n.1822C>T non_coding_transcript_exon_variant 1.0
rrl 1475480 n.1823A>T non_coding_transcript_exon_variant 1.0
rrl 1475505 n.1848G>A non_coding_transcript_exon_variant 1.0
rrl 1475526 n.1869C>A non_coding_transcript_exon_variant 1.0
rrl 1475531 n.1874C>T non_coding_transcript_exon_variant 0.98
rrl 1475573 n.1916G>A non_coding_transcript_exon_variant 1.0
rrl 1475649 n.1992A>G non_coding_transcript_exon_variant 1.0
rrl 1475659 n.2002G>A non_coding_transcript_exon_variant 1.0
rrl 1475760 n.2105_2106delGC non_coding_transcript_exon_variant 1.0
rrl 1475764 n.2107A>T non_coding_transcript_exon_variant 1.0
rrl 1475765 n.2108A>T non_coding_transcript_exon_variant 1.0
rrl 1475975 n.2318C>T non_coding_transcript_exon_variant 1.0
rrl 1475977 n.2320A>G non_coding_transcript_exon_variant 1.0
rrl 1475988 n.2331A>G non_coding_transcript_exon_variant 1.0
rrl 1475989 n.2332T>C non_coding_transcript_exon_variant 1.0
rrl 1475993 n.2336C>T non_coding_transcript_exon_variant 1.0
rrl 1475997 n.2340A>T non_coding_transcript_exon_variant 1.0
rrl 1476030 n.2373A>G non_coding_transcript_exon_variant 1.0
rrl 1476056 n.2399G>A non_coding_transcript_exon_variant 1.0
rrl 1476058 n.2401T>C non_coding_transcript_exon_variant 1.0
rrl 1476085 n.2428G>A non_coding_transcript_exon_variant 1.0
rrl 1476086 n.2429G>A non_coding_transcript_exon_variant 1.0
rrl 1476088 n.2431A>C non_coding_transcript_exon_variant 1.0
rrl 1476099 n.2442A>G non_coding_transcript_exon_variant 1.0
rrl 1476103 n.2446C>G non_coding_transcript_exon_variant 1.0
rrl 1476105 n.2448G>A non_coding_transcript_exon_variant 1.0
rrl 1476106 n.2449A>T non_coding_transcript_exon_variant 1.0
rrl 1476110 n.2453G>C non_coding_transcript_exon_variant 1.0
rrl 1476114 n.2457T>C non_coding_transcript_exon_variant 1.0
rrl 1476115 n.2458T>C non_coding_transcript_exon_variant 1.0
rrl 1476131 n.2474C>T non_coding_transcript_exon_variant 1.0
rrl 1476160 n.2503T>C non_coding_transcript_exon_variant 1.0
rrl 1476214 n.2557G>T non_coding_transcript_exon_variant 1.0
rrl 1476215 n.2558C>T non_coding_transcript_exon_variant 1.0
rrl 1476221 n.2564T>C non_coding_transcript_exon_variant 1.0
rrl 1476224 n.2567A>G non_coding_transcript_exon_variant 1.0
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 1.0
rrl 1476281 n.2624T>C non_coding_transcript_exon_variant 0.99
rrl 1476295 n.2638C>T non_coding_transcript_exon_variant 1.0
rrl 1476297 n.2640C>T non_coding_transcript_exon_variant 1.0
rrl 1476299 n.2642C>T non_coding_transcript_exon_variant 0.98
rrl 1476311 n.2654G>A non_coding_transcript_exon_variant 1.0
rrl 1476584 n.2927C>T non_coding_transcript_exon_variant 1.0
rrl 1476594 n.2937C>T non_coding_transcript_exon_variant 1.0
rrl 1476597 n.2940G>A non_coding_transcript_exon_variant 1.0
rrl 1476603 n.2946G>A non_coding_transcript_exon_variant 1.0
rrl 1476608 n.2951C>G non_coding_transcript_exon_variant 1.0
rrl 1476619 n.2962C>T non_coding_transcript_exon_variant 1.0
rrl 1476628 n.2971T>A non_coding_transcript_exon_variant 1.0
rrl 1476665 n.3008T>A non_coding_transcript_exon_variant 1.0
rrl 1476666 n.3009C>T non_coding_transcript_exon_variant 1.0
rrl 1476674 n.3017T>C non_coding_transcript_exon_variant 1.0
rrl 1476684 n.3027C>T non_coding_transcript_exon_variant 1.0
rrl 1476689 n.3032A>T non_coding_transcript_exon_variant 1.0
rrl 1476690 n.3033C>T non_coding_transcript_exon_variant 1.0
rrl 1476693 n.3036G>A non_coding_transcript_exon_variant 1.0
rrl 1476695 n.3038T>A non_coding_transcript_exon_variant 1.0
rrl 1476705 n.3048C>T non_coding_transcript_exon_variant 1.0
rrl 1476707 n.3050C>A non_coding_transcript_exon_variant 1.0
rrl 1476711 n.3054G>A non_coding_transcript_exon_variant 1.0
rrl 1476716 n.3059A>C non_coding_transcript_exon_variant 1.0
rrl 1476717 n.3060C>T non_coding_transcript_exon_variant 1.0
rrl 1476719 n.3062C>T non_coding_transcript_exon_variant 1.0
rrl 1476732 n.3075T>C non_coding_transcript_exon_variant 1.0
inhA 1673679 c.-523T>A upstream_gene_variant 1.0
inhA 1673682 c.-520G>T upstream_gene_variant 1.0
inhA 1673697 c.-505G>A upstream_gene_variant 1.0
inhA 1673706 c.-496C>G upstream_gene_variant 1.0
fabG1 1673710 p.Leu91Ile missense_variant 1.0
fabG1 1673711 c.273delA frameshift_variant 1.0
fabG1 1673714 p.Ser92Cys missense_variant 1.0
fabG1 1673717 c.278_279insA frameshift_variant 1.0
inhA 1673728 c.-474_-472delCTCinsTTG upstream_gene_variant 1.0
inhA 1673736 c.-466G>C upstream_gene_variant 1.0
inhA 1673748 c.-454A>G upstream_gene_variant 1.0
inhA 1673772 c.-430C>G upstream_gene_variant 1.0
inhA 1673778 c.-424C>G upstream_gene_variant 1.0
inhA 1673784 c.-418G>A upstream_gene_variant 1.0
inhA 1673787 c.-415G>A upstream_gene_variant 1.0
inhA 1673799 c.-403T>C upstream_gene_variant 1.0
inhA 1673802 c.-400A>G upstream_gene_variant 1.0
inhA 1673808 c.-394A>G upstream_gene_variant 1.0
fabG1 1673816 p.Ser126Thr missense_variant 1.0
fabG1 1674049 p.Gln204Glu missense_variant 1.0
inhA 1674054 c.-148T>C upstream_gene_variant 1.0
inhA 1674060 c.-142A>G upstream_gene_variant 1.0
inhA 1674069 c.-133G>A upstream_gene_variant 1.0
inhA 1674072 c.-130C>G upstream_gene_variant 1.0
inhA 1674078 c.-124C>T upstream_gene_variant 1.0
fabG1 1674079 p.Pro214Ala missense_variant 1.0
inhA 1674084 c.-118C>T upstream_gene_variant 1.0
inhA 1674114 c.-88T>G upstream_gene_variant 1.0
inhA 1674126 c.-76G>C upstream_gene_variant 1.0
inhA 1674129 c.-73C>T upstream_gene_variant 1.0
inhA 1674132 c.-70T>C upstream_gene_variant 1.0
inhA 1674144 c.-58G>A upstream_gene_variant 1.0
inhA 1674156 c.-46C>T upstream_gene_variant 1.0
inhA 1674159 c.-43C>T upstream_gene_variant 1.0
inhA 1674171 c.-31T>C upstream_gene_variant 1.0
inhA 1674589 p.Met130Leu missense_variant 1.0
inhA 1674600 c.399G>T synonymous_variant 1.0
inhA 1674601 p.Leu134Val missense_variant 1.0
inhA 1674609 c.408G>C synonymous_variant 1.0
inhA 1674621 c.420C>G synonymous_variant 1.0
inhA 1674624 c.423A>C synonymous_variant 1.0
inhA 1674627 c.426T>C synonymous_variant 1.0
inhA 1674628 c.427_428delTCinsAG synonymous_variant 1.0
inhA 1674636 c.435C>A synonymous_variant 1.0
inhA 1674656 p.Ser152Thr missense_variant 1.0
inhA 1674660 c.459G>C synonymous_variant 1.0
inhA 1674670 p.Ala157Phe missense_variant 1.0
inhA 1674687 c.486G>C synonymous_variant 1.0
inhA 1674690 c.489C>G synonymous_variant 1.0
inhA 1674702 c.501G>A synonymous_variant 1.0
inhA 1674703 c.502T>C synonymous_variant 1.0
inhA 1674708 c.507G>A synonymous_variant 1.0
inhA 1674714 c.513C>A synonymous_variant 1.0
inhA 1674718 c.517A>C synonymous_variant 1.0
inhA 1674726 c.525G>C synonymous_variant 1.0
rpsA 1833511 c.-31G>T upstream_gene_variant 1.0
rpsA 1833514 c.-28C>A upstream_gene_variant 1.0
rpsA 1833517 c.-24delC upstream_gene_variant 1.0
rpsA 1833517 c.-24C>A upstream_gene_variant 1.0
rpsA 1833547 c.6G>A synonymous_variant 1.0
rpsA 1833559 c.18C>G synonymous_variant 1.0
rpsA 1833583 c.42C>T synonymous_variant 1.0
rpsA 1833589 c.48A>C synonymous_variant 1.0
rpsA 1833595 c.54T>G synonymous_variant 1.0
rpsA 1833596 p.Ser19Ala missense_variant 1.0
rpsA 1833604 c.63C>T synonymous_variant 1.0
rpsA 1833616 c.75A>T synonymous_variant 1.0
rpsA 1833619 c.78A>C synonymous_variant 1.0
rpsA 1833625 c.84A>G synonymous_variant 1.0
rpsA 1833661 c.120A>G synonymous_variant 1.0
rpsA 1833664 c.123C>G synonymous_variant 1.0
rpsA 1833676 c.135A>G synonymous_variant 1.0
rpsA 1833679 c.138G>T synonymous_variant 1.0
rpsA 1833685 c.144G>C synonymous_variant 1.0
rpsA 1833691 c.150G>A synonymous_variant 1.0
rpsA 1833694 c.153G>T synonymous_variant 1.0
rpsA 1833697 c.156C>T synonymous_variant 1.0
rpsA 1833700 c.159C>T synonymous_variant 1.0
rpsA 1833709 c.168C>T synonymous_variant 1.0
rpsA 1833724 c.183C>T synonymous_variant 1.0
rpsA 1833727 c.186G>C synonymous_variant 1.0
rpsA 1833733 c.192C>G synonymous_variant 1.0
rpsA 1833734 p.Ala65Ser missense_variant 1.0
rpsA 1833748 c.207C>G synonymous_variant 1.0
rpsA 1833751 c.210C>T synonymous_variant 1.0
rpsA 1833760 c.219C>T synonymous_variant 0.96
rpsA 1833787 c.246C>G synonymous_variant 1.0
rpsA 1833790 c.249T>C synonymous_variant 1.0
rpsA 1833802 c.261A>G synonymous_variant 1.0
rpsA 1833811 c.270G>C synonymous_variant 1.0
rpsA 1833829 c.288A>G synonymous_variant 1.0
rpsA 1833832 c.291G>A synonymous_variant 1.0
rpsA 1833838 c.297G>T synonymous_variant 1.0
rpsA 1833841 c.300C>G synonymous_variant 1.0
rpsA 1833847 c.306C>G synonymous_variant 1.0
rpsA 1833856 c.315A>G synonymous_variant 1.0
rpsA 1833862 c.321G>T synonymous_variant 1.0
rpsA 1833874 c.333T>G synonymous_variant 1.0
rpsA 1833886 c.345C>G synonymous_variant 1.0
rpsA 1833892 c.351G>A synonymous_variant 1.0
rpsA 1833894 p.Ala118Glu missense_variant 1.0
rpsA 1833928 c.387G>C synonymous_variant 1.0
rpsA 1833949 c.408T>C synonymous_variant 1.0
rpsA 1833970 c.429G>C synonymous_variant 1.0
rpsA 1833979 c.438T>C synonymous_variant 1.0
rpsA 1833991 c.450C>G synonymous_variant 1.0
rpsA 1834000 c.459G>C synonymous_variant 1.0
rpsA 1834009 c.468C>T synonymous_variant 1.0
rpsA 1834012 c.471G>T synonymous_variant 1.0
rpsA 1834015 c.474G>C synonymous_variant 1.0
rpsA 1834021 c.480C>T synonymous_variant 1.0
rpsA 1834030 c.489C>G synonymous_variant 1.0
rpsA 1834033 c.492C>T synonymous_variant 1.0
rpsA 1834069 c.528G>C synonymous_variant 1.0
rpsA 1834073 p.Lys178Arg missense_variant 1.0
rpsA 1834097 c.556_557delTCinsAG synonymous_variant 1.0
rpsA 1834150 c.609G>C synonymous_variant 1.0
rpsA 1834165 c.624A>G synonymous_variant 1.0
rpsA 1834168 c.627C>T synonymous_variant 1.0
rpsA 1834169 p.Thr210Ala missense_variant 1.0
rpsA 1834177 c.636A>C synonymous_variant 1.0
rpsA 1834228 c.687C>A synonymous_variant 1.0
rpsA 1834231 c.690T>G synonymous_variant 1.0
rpsA 1834234 c.693G>T synonymous_variant 1.0
rpsA 1834240 c.699T>C synonymous_variant 1.0
rpsA 1834246 c.705G>T synonymous_variant 1.0
rpsA 1834249 c.708T>C synonymous_variant 1.0
rpsA 1834252 c.711C>G synonymous_variant 1.0
rpsA 1834261 c.720A>G synonymous_variant 1.0
rpsA 1834264 c.723G>C synonymous_variant 1.0
rpsA 1834297 c.756C>T synonymous_variant 1.0
rpsA 1834303 c.762T>G synonymous_variant 1.0
rpsA 1834306 c.765T>C synonymous_variant 1.0
rpsA 1834339 c.798C>T synonymous_variant 1.0
rpsA 1834348 c.807T>C synonymous_variant 1.0
rpsA 1834366 c.825A>G synonymous_variant 1.0
rpsA 1834375 c.834G>A synonymous_variant 1.0
rpsA 1834378 c.837T>C synonymous_variant 1.0
rpsA 1834396 c.855G>T synonymous_variant 1.0
rpsA 1834405 c.864C>T synonymous_variant 1.0
rpsA 1834408 c.867C>T synonymous_variant 1.0
rpsA 1834411 c.870T>C synonymous_variant 1.0
rpsA 1834417 c.876G>C synonymous_variant 1.0
rpsA 1834423 c.882G>C synonymous_variant 1.0
rpsA 1834435 c.894G>C synonymous_variant 1.0
rpsA 1834451 c.910T>C synonymous_variant 1.0
rpsA 1834456 c.915T>G synonymous_variant 1.0
rpsA 1834468 c.927A>G synonymous_variant 1.0
rpsA 1834480 c.939C>G synonymous_variant 1.0
rpsA 1834483 c.942G>A synonymous_variant 1.0
rpsA 1834489 c.948T>C synonymous_variant 1.0
rpsA 1834498 c.957C>T synonymous_variant 1.0
rpsA 1834520 p.Ala327Ser missense_variant 1.0
rpsA 1834528 c.987T>C synonymous_variant 1.0
rpsA 1834543 c.1002C>G synonymous_variant 1.0
rpsA 1834552 c.1011G>T synonymous_variant 1.0
rpsA 1834555 c.1014T>G synonymous_variant 1.0
rpsA 1834557 p.Ala339Gly missense_variant 1.0
rpsA 1834606 c.1065C>T synonymous_variant 1.0
rpsA 1834609 c.1068T>C synonymous_variant 1.0
rpsA 1834612 c.1071G>C synonymous_variant 1.0
rpsA 1834619 c.1078T>C synonymous_variant 1.0
rpsA 1834622 c.1081_1083delTCGinsAGC synonymous_variant 1.0
rpsA 1834633 c.1092A>G synonymous_variant 1.0
rpsA 1834639 c.1098T>C synonymous_variant 1.0
rpsA 1834666 c.1125G>T synonymous_variant 1.0
rpsA 1834667 p.Ala376Ser missense_variant 1.0
rpsA 1834684 c.1143C>G synonymous_variant 1.0
rpsA 1834690 c.1149T>C synonymous_variant 1.0
rpsA 1834700 p.Gln387Ala missense_variant 1.0
rpsA 1834720 c.1179C>G synonymous_variant 1.0
rpsA 1834726 c.1185C>T synonymous_variant 1.0
rpsA 1834732 c.1191T>C synonymous_variant 1.0
ndh 2102620 c.423C>T synonymous_variant 1.0
ndh 2102635 c.408C>G synonymous_variant 1.0
ndh 2102638 c.405A>G synonymous_variant 1.0
ndh 2102641 p.Phe134Trp missense_variant 1.0
ndh 2102644 c.399A>G synonymous_variant 1.0
ndh 2102653 c.390T>C synonymous_variant 1.0
ndh 2102662 c.381C>A synonymous_variant 1.0
ndh 2102668 c.375T>C synonymous_variant 1.0
ndh 2102677 c.366C>T synonymous_variant 1.0
ndh 2102680 c.363T>G synonymous_variant 1.0
ndh 2102686 c.357G>C synonymous_variant 1.0
ndh 2102827 c.216C>G synonymous_variant 1.0
ndh 2102833 c.210G>C synonymous_variant 1.0
ndh 2102842 c.201A>G synonymous_variant 1.0
ndh 2102848 c.195G>A synonymous_variant 1.0
ndh 2102857 c.186T>C synonymous_variant 1.0
ndh 2102863 c.180C>T synonymous_variant 1.0
ndh 2102895 c.148C>T synonymous_variant 1.0
ndh 2102902 c.141C>T synonymous_variant 1.0
ndh 2102908 c.135C>T synonymous_variant 1.0
ndh 2102921 p.Lys41Thr missense_variant 1.0
ndh 2102926 c.117C>T synonymous_variant 1.0
ndh 2102929 c.114T>C synonymous_variant 1.0
katG 2155716 c.396T>G synonymous_variant 1.0
katG 2155722 c.390G>C synonymous_variant 1.0
katG 2155741 p.Gly124Ala missense_variant 1.0
katG 2155743 c.369G>T synonymous_variant 1.0
katG 2155755 c.357C>T synonymous_variant 1.0
katG 2155765 p.His116Gly missense_variant 1.0
katG 2155767 p.Ile115Val missense_variant 1.0
katG 2155782 c.330C>G synonymous_variant 1.0
katG 2155785 c.327T>C synonymous_variant 1.0
katG 2155794 c.318G>A synonymous_variant 1.0
katG 2155800 c.312G>C synonymous_variant 1.0
kasA 2517917 c.-198G>C upstream_gene_variant 1.0
kasA 2517941 c.-174C>G upstream_gene_variant 1.0
kasA 2517953 c.-162C>T upstream_gene_variant 1.0
kasA 2517959 c.-156C>T upstream_gene_variant 1.0
kasA 2517962 c.-153C>G upstream_gene_variant 1.0
kasA 2517974 c.-141T>G upstream_gene_variant 1.0
kasA 2517980 c.-135C>T upstream_gene_variant 1.0
kasA 2517983 c.-132T>C upstream_gene_variant 1.0
kasA 2517986 c.-129C>T upstream_gene_variant 1.0
kasA 2517989 c.-126T>C upstream_gene_variant 1.0
kasA 2517993 c.-122_-121delGCinsAA upstream_gene_variant 1.0
kasA 2518002 c.-113C>G upstream_gene_variant 1.0
kasA 2518014 c.-101_-99delGAAinsCAG upstream_gene_variant 1.0
kasA 2518723 c.609G>A synonymous_variant 1.0
kasA 2518726 c.612G>C synonymous_variant 1.0
kasA 2518732 c.618C>G synonymous_variant 1.0
kasA 2518738 c.624G>C synonymous_variant 1.0
kasA 2518756 c.642G>C synonymous_variant 1.0
kasA 2518771 c.657C>A synonymous_variant 1.0
kasA 2518774 c.660C>T synonymous_variant 1.0
kasA 2518777 c.663C>T synonymous_variant 1.0
kasA 2518783 c.669T>G synonymous_variant 1.0
kasA 2518787 p.Arg225Lys missense_variant 1.0
kasA 2518792 c.678C>T synonymous_variant 1.0
kasA 2518795 c.681C>T synonymous_variant 1.0
kasA 2518798 c.684G>C synonymous_variant 1.0
kasA 2518822 c.708C>A synonymous_variant 1.0
kasA 2518825 c.711T>C synonymous_variant 1.0
ahpC 2726636 c.444G>C synonymous_variant 1.0
ahpC 2726638 p.Ala149Val missense_variant 1.0
ahpC 2726645 c.453C>G synonymous_variant 1.0
ahpC 2726657 c.465A>C synonymous_variant 1.0
ahpC 2726669 c.477T>C synonymous_variant 1.0
ahpC 2726675 c.483A>G synonymous_variant 1.0
ahpC 2726678 c.486G>C synonymous_variant 1.0
ahpC 2726681 c.489A>C synonymous_variant 1.0
ahpC 2726693 c.501C>G synonymous_variant 1.0
ahpC 2726696 c.504C>G synonymous_variant 1.0
ahpC 2726717 c.525A>C synonymous_variant 1.0
ahpC 2726735 c.543C>T synonymous_variant 1.0
thyA 3073925 c.547T>C synonymous_variant 1.0
thyA 3073926 c.546G>A synonymous_variant 1.0
thyA 3073950 c.522G>T synonymous_variant 1.0
thyA 3073953 c.519T>C synonymous_variant 1.0
thyA 3073956 c.516G>C synonymous_variant 1.0
thyA 3073971 c.501C>T synonymous_variant 1.0
thyA 3073977 c.495A>G synonymous_variant 1.0
thyA 3073980 c.492C>T synonymous_variant 1.0
thyA 3073983 c.489C>G synonymous_variant 1.0
thyA 3073999 p.Arg158Lys missense_variant 1.0
thyA 3074004 c.468T>C synonymous_variant 1.0
thyA 3074010 c.462C>T synonymous_variant 1.0
thyA 3074013 c.459C>T synonymous_variant 1.0
thyA 3074022 c.450C>T synonymous_variant 1.0
thyA 3074031 c.441T>C synonymous_variant 1.0
thyA 3074037 c.435C>G synonymous_variant 1.0
thyA 3074045 c.427C>T synonymous_variant 1.0
thyA 3074053 p.Arg140Gln missense_variant 1.0
thyA 3074056 p.Glu139Pro missense_variant 1.0
thyA 3074061 c.411A>G synonymous_variant 1.0
thyA 3074067 c.405C>G synonymous_variant 1.0
thyA 3074082 c.390G>C synonymous_variant 1.0
thyA 3074089 p.Ile128Asn missense_variant 1.0
thyA 3074094 c.378G>C synonymous_variant 1.0
thyA 3074097 c.375C>G synonymous_variant 1.0
thyA 3074106 c.366T>C synonymous_variant 1.0
thyA 3074109 c.363C>G synonymous_variant 1.0
thyA 3074120 c.352T>C synonymous_variant 1.0
thyA 3074121 c.351T>C synonymous_variant 1.0
thyA 3074124 c.348G>C synonymous_variant 1.0
thyA 3074130 c.342G>C synonymous_variant 1.0
thyA 3074133 c.339C>T synonymous_variant 1.0
thyA 3074157 c.315C>G synonymous_variant 1.0
thyA 3074160 c.312A>C synonymous_variant 1.0
thyA 3074163 p.Ala103Thr missense_variant 1.0
thyA 3074166 c.306G>C synonymous_variant 1.0
rpoA 3877521 c.987C>A synonymous_variant 1.0
rpoA 3877533 c.975C>T synonymous_variant 1.0
rpoA 3877542 c.966C>A synonymous_variant 1.0
rpoA 3877545 c.963G>C synonymous_variant 1.0
rpoA 3877554 c.954G>C synonymous_variant 1.0
rpoA 3877557 c.951C>G synonymous_variant 1.0
rpoA 3877560 c.948C>T synonymous_variant 1.0
rpoA 3877569 p.Pro313Thr missense_variant 1.0
rpoA 3877587 c.921A>G synonymous_variant 1.0
rpoA 3877596 c.912G>C synonymous_variant 1.0
rpoA 3877602 c.906C>T synonymous_variant 1.0
rpoA 3877656 c.852T>G synonymous_variant 1.0
rpoA 3877662 c.846C>T synonymous_variant 1.0
rpoA 3877665 c.843C>G synonymous_variant 1.0
rpoA 3877668 c.840A>G synonymous_variant 1.0
rpoA 3877677 c.831G>C synonymous_variant 1.0
rpoA 3877680 c.828G>T synonymous_variant 1.0
rpoA 3877686 c.822A>G synonymous_variant 1.0
rpoA 3877692 c.816G>C synonymous_variant 1.0
rpoA 3877704 c.804G>T synonymous_variant 1.0
rpoA 3877728 c.780C>G synonymous_variant 1.0
rpoA 3877734 c.774G>C synonymous_variant 1.0
rpoA 3877737 c.771G>C synonymous_variant 1.0
rpoA 3877743 c.765T>C synonymous_variant 1.0
rpoA 3877752 p.Asp252Glu missense_variant 1.0
rpoA 3877758 c.750G>C synonymous_variant 1.0
rpoA 3877764 c.744C>G synonymous_variant 1.0
rpoA 3877770 c.738A>G synonymous_variant 1.0
rpoA 3877773 c.735G>C synonymous_variant 1.0
rpoA 3877776 c.732T>C synonymous_variant 1.0
rpoA 3877782 c.726T>C synonymous_variant 1.0
rpoA 3877785 c.723C>A synonymous_variant 1.0
rpoA 3877818 c.690A>G synonymous_variant 1.0
rpoA 3877839 c.669G>T synonymous_variant 1.0
rpoA 3877848 c.660C>T synonymous_variant 1.0
rpoA 3877856 c.652T>C synonymous_variant 1.0
rpoA 3877860 c.648C>T synonymous_variant 1.0
rpoA 3877875 c.633T>C synonymous_variant 1.0
rpoA 3877881 c.627G>C synonymous_variant 1.0
rpoA 3877887 c.621G>C synonymous_variant 1.0
rpoA 3877893 c.615C>T synonymous_variant 1.0
rpoA 3877900 p.Ser203Thr missense_variant 1.0
rpoA 3877905 c.603A>G synonymous_variant 1.0
rpoA 3877908 c.600T>C synonymous_variant 1.0
rpoA 3877920 c.588G>C synonymous_variant 1.0
rpoA 3877923 c.585C>T synonymous_variant 1.0
rpoA 3877929 p.Ile193Val missense_variant 1.0
rpoA 3877962 c.546G>C synonymous_variant 1.0
rpoA 3877974 c.534G>C synonymous_variant 1.0
rpoA 3877977 p.Lys177Asn missense_variant 1.0
rpoA 3877983 c.525C>G synonymous_variant 1.0
rpoA 3877986 c.522G>C synonymous_variant 1.0
rpoA 3877989 c.519A>G synonymous_variant 1.0
rpoA 3878001 c.507A>G synonymous_variant 1.0
rpoA 3878019 c.489A>C synonymous_variant 1.0
rpoA 3878022 c.486T>C synonymous_variant 1.0
rpoA 3878025 c.483C>T synonymous_variant 1.0
rpoA 3878028 c.480G>T synonymous_variant 1.0
rpoA 3878031 c.477T>C synonymous_variant 1.0
rpoA 3878034 c.474A>G synonymous_variant 1.0
rpoA 3878046 c.462T>C synonymous_variant 1.0
rpoA 3878050 p.Arg153Lys missense_variant 1.0
rpoA 3878055 c.453A>G synonymous_variant 1.0
rpoA 3878061 c.447G>C synonymous_variant 1.0
rpoA 3878070 c.438T>C synonymous_variant 1.0
rpoA 3878079 c.429C>T synonymous_variant 1.0
rpoA 3878082 c.426T>C synonymous_variant 1.0
rpoA 3878102 p.Val136Ile missense_variant 1.0
rpoA 3878103 c.405A>G synonymous_variant 1.0
rpoA 3878118 c.390T>C synonymous_variant 1.0
rpoA 3878127 c.381G>C synonymous_variant 1.0
rpoA 3878130 c.378C>G synonymous_variant 1.0
rpoA 3878143 p.Gly122Asp missense_variant 1.0
rpoA 3878160 c.348C>G synonymous_variant 1.0
rpoA 3878169 c.339G>C synonymous_variant 1.0
rpoA 3878175 c.333G>T synonymous_variant 1.0
rpoA 3878184 c.324C>T synonymous_variant 1.0
rpoA 3878193 c.315T>C synonymous_variant 1.0
rpoA 3878196 p.Glu104Ala missense_variant 1.0
rpoA 3878205 c.303T>A synonymous_variant 1.0
rpoA 3878217 c.291A>G synonymous_variant 1.0
rpoA 3878259 c.249G>C synonymous_variant 1.0
rpoA 3878271 c.237T>C synonymous_variant 1.0
rpoA 3878274 c.234G>C synonymous_variant 1.0
rpoA 3878283 p.Glu75Asp missense_variant 1.0
rpoA 3878292 c.216T>C synonymous_variant 1.0
rpoA 3878298 c.210A>G synonymous_variant 1.0
rpoA 3878301 c.207C>G synonymous_variant 1.0
rpoA 3878307 c.201C>T synonymous_variant 1.0
rpoA 3878310 c.198G>T synonymous_variant 1.0
rpoA 3878313 c.195G>C synonymous_variant 1.0
rpoA 3878322 c.186A>G synonymous_variant 1.0
rpoA 3878331 c.177A>G synonymous_variant 1.0
rpoA 3878334 c.174T>C synonymous_variant 1.0
rpoA 3878337 c.171T>C synonymous_variant 1.0
rpoA 3878346 c.162T>C synonymous_variant 1.0
rpoA 3878364 c.144A>C synonymous_variant 1.0
rpoA 3878367 c.141C>G synonymous_variant 1.0
rpoA 3878370 c.138T>C synonymous_variant 1.0
rpoA 3878373 c.135G>C synonymous_variant 1.0
rpoA 3878391 c.117T>G synonymous_variant 1.0
rpoA 3878400 c.108T>C synonymous_variant 1.0
rpoA 3878424 c.84G>C synonymous_variant 1.0
rpoA 3878433 c.75G>C synonymous_variant 1.0
rpoA 3878436 c.72A>G synonymous_variant 1.0
rpoA 3878442 c.66G>C synonymous_variant 1.0
rpoA 3878672 c.-165A>T upstream_gene_variant 1.0
rpoA 3878698 c.-191A>G upstream_gene_variant 1.0
rpoA 3878701 c.-194C>G upstream_gene_variant 1.0
ddn 3986648 c.-196C>G upstream_gene_variant 1.0
ddn 3986651 c.-193G>A upstream_gene_variant 1.0
ddn 3986654 c.-190C>T upstream_gene_variant 1.0
clpC1 4038497 p.Ser736Gly missense_variant 1.0
clpC1 4038519 p.Arg729Glu missense_variant 1.0
clpC1 4038529 p.Glu726Gln missense_variant 1.0
clpC1 4038530 c.2175G>A synonymous_variant 1.0
clpC1 4038533 p.Arg724Gln missense_variant 1.0
clpC1 4038536 c.2169C>G synonymous_variant 1.0
clpC1 4038545 p.His720Glu missense_variant 1.0
clpC1 4038584 c.2121G>T synonymous_variant 1.0
clpC1 4038587 c.2118C>G synonymous_variant 1.0
clpC1 4038596 c.2109A>G synonymous_variant 1.0
clpC1 4038613 p.Asn698His missense_variant 1.0
clpC1 4038614 c.2091C>T synonymous_variant 1.0
clpC1 4038623 c.2082A>G synonymous_variant 1.0
clpC1 4038725 c.1980C>T synonymous_variant 1.0
clpC1 4038737 c.1968C>T synonymous_variant 1.0
clpC1 4038740 c.1965G>C synonymous_variant 1.0
clpC1 4038743 c.1962G>A synonymous_variant 1.0
clpC1 4038749 c.1956C>T synonymous_variant 1.0
clpC1 4038755 c.1950G>C synonymous_variant 1.0
clpC1 4038767 c.1938G>T synonymous_variant 1.0
clpC1 4038770 c.1935C>A synonymous_variant 1.0
clpC1 4038773 c.1932T>C synonymous_variant 1.0
clpC1 4038779 c.1926C>A synonymous_variant 1.0
clpC1 4038782 c.1923G>T synonymous_variant 1.0
clpC1 4038790 c.1915C>T synonymous_variant 1.0
clpC1 4038795 p.Ser637Thr missense_variant 1.0
clpC1 4038812 c.1893T>C synonymous_variant 1.0
clpC1 4038842 c.1863G>T synonymous_variant 1.0
clpC1 4038845 c.1858_1860delTCGinsAGC synonymous_variant 1.0
clpC1 4038860 c.1845G>T synonymous_variant 1.0
clpC1 4038878 c.1827A>G synonymous_variant 1.0
clpC1 4038881 c.1824C>A synonymous_variant 1.0
clpC1 4038884 c.1821C>T synonymous_variant 1.0
clpC1 4038890 c.1815G>A synonymous_variant 1.0
clpC1 4038896 c.1809C>A synonymous_variant 1.0
clpC1 4038908 c.1797C>G synonymous_variant 1.0
clpC1 4038932 c.1773G>T synonymous_variant 1.0
clpC1 4038941 c.1764G>C synonymous_variant 1.0
clpC1 4038953 c.1752A>G synonymous_variant 1.0
clpC1 4038956 c.1749T>C synonymous_variant 1.0
clpC1 4038965 c.1740T>C synonymous_variant 1.0
clpC1 4038971 c.1734T>C synonymous_variant 1.0
clpC1 4038974 c.1731T>C synonymous_variant 1.0
clpC1 4038989 c.1716T>C synonymous_variant 1.0
clpC1 4038997 c.1708T>C synonymous_variant 1.0
clpC1 4039031 c.1674T>C synonymous_variant 1.0
clpC1 4039064 c.1641C>T synonymous_variant 1.0
clpC1 4039070 c.1635G>C synonymous_variant 1.0
clpC1 4039085 c.1620A>G synonymous_variant 1.0
clpC1 4039091 c.1614G>T synonymous_variant 1.0
clpC1 4039097 c.1608G>T synonymous_variant 1.0
clpC1 4039100 c.1605C>G synonymous_variant 1.0
clpC1 4039106 c.1599G>C synonymous_variant 1.0
clpC1 4039112 c.1593C>G synonymous_variant 1.0
clpC1 4039118 c.1587C>G synonymous_variant 1.0
clpC1 4039121 c.1584T>C synonymous_variant 1.0
clpC1 4039136 c.1569C>T synonymous_variant 1.0
clpC1 4039139 c.1566G>A synonymous_variant 1.0
clpC1 4039142 c.1563A>G synonymous_variant 1.0
clpC1 4039145 c.1560G>C synonymous_variant 1.0
clpC1 4039166 c.1539G>A synonymous_variant 1.0
clpC1 4039169 c.1536A>G synonymous_variant 1.0
clpC1 4039172 c.1533A>G synonymous_variant 1.0
clpC1 4039178 c.1527G>C synonymous_variant 1.0
clpC1 4039183 c.1522T>C synonymous_variant 1.0
clpC1 4039190 c.1515C>T synonymous_variant 1.0
clpC1 4039196 c.1509G>A synonymous_variant 1.0
clpC1 4039199 p.Ala502Glu missense_variant 1.0
clpC1 4039208 c.1497C>G synonymous_variant 1.0
clpC1 4039220 c.1485G>C synonymous_variant 1.0
clpC1 4039238 c.1467C>T synonymous_variant 1.0
clpC1 4039265 c.1440C>T synonymous_variant 1.0
clpC1 4039274 c.1431G>C synonymous_variant 1.0
clpC1 4039277 c.1428C>G synonymous_variant 1.0
clpC1 4039280 c.1425G>T synonymous_variant 1.0
clpC1 4039283 c.1422C>T synonymous_variant 1.0
clpC1 4039286 c.1419T>G synonymous_variant 1.0
clpC1 4039292 c.1413C>T synonymous_variant 1.0
clpC1 4039316 p.Glu463Asp missense_variant 1.0
clpC1 4039319 c.1386T>A synonymous_variant 1.0
clpC1 4039322 c.1383T>G synonymous_variant 1.0
clpC1 4039328 c.1377A>G synonymous_variant 1.0
clpC1 4039336 c.1369C>T synonymous_variant 1.0
clpC1 4039338 p.Thr456Gln missense_variant 1.0
clpC1 4039346 p.Arg453Ser missense_variant 1.0
clpC1 4039360 p.Ser449Arg missense_variant 1.0
clpC1 4039361 c.1344C>T synonymous_variant 1.0
clpC1 4039391 c.1314T>C synonymous_variant 1.0
clpC1 4039397 c.1308A>G synonymous_variant 1.0
clpC1 4039409 c.1296T>C synonymous_variant 1.0
clpC1 4039412 c.1293T>G synonymous_variant 1.0
clpC1 4039415 p.Glu430Asp missense_variant 1.0
clpC1 4039430 c.1275T>C synonymous_variant 1.0
clpC1 4039442 c.1263A>G synonymous_variant 1.0
clpC1 4039451 c.1254G>A synonymous_variant 1.0
clpC1 4039454 c.1251A>T synonymous_variant 1.0
clpC1 4039457 c.1248C>T synonymous_variant 1.0
clpC1 4039463 c.1242C>G synonymous_variant 1.0
clpC1 4039466 c.1239T>C synonymous_variant 1.0
clpC1 4039469 c.1236T>C synonymous_variant 1.0
clpC1 4039472 c.1233G>C synonymous_variant 1.0
clpC1 4039478 c.1227G>C synonymous_variant 1.0
clpC1 4039481 c.1224T>C synonymous_variant 1.0
clpC1 4039484 c.1221T>A synonymous_variant 1.0
clpC1 4039487 c.1218G>C synonymous_variant 1.0
clpC1 4039517 c.1188C>G synonymous_variant 1.0
clpC1 4039522 c.1183C>T synonymous_variant 1.0
clpC1 4039541 c.1164C>G synonymous_variant 1.0
clpC1 4039544 c.1161C>T synonymous_variant 1.0
clpC1 4039553 c.1152C>T synonymous_variant 1.0
clpC1 4039556 c.1149G>C synonymous_variant 1.0
clpC1 4039559 c.1146C>G synonymous_variant 1.0
clpC1 4039562 c.1143C>G synonymous_variant 1.0
clpC1 4039565 c.1140G>C synonymous_variant 1.0
clpC1 4039570 p.Met379Leu missense_variant 1.0
clpC1 4039574 p.Ala377Gly missense_variant 0.93
clpC1 4039577 c.1128T>C synonymous_variant 1.0
clpC1 4039586 c.1119G>C synonymous_variant 1.0
clpC1 4039589 c.1116G>C synonymous_variant 1.0
clpC1 4039610 c.1095G>T synonymous_variant 1.0
clpC1 4039616 c.1089G>C synonymous_variant 1.0
clpC1 4039649 c.1056G>T synonymous_variant 0.92
clpC1 4039652 c.1053G>T synonymous_variant 0.92
clpC1 4039661 c.1044T>C synonymous_variant 1.0
clpC1 4039682 c.1023C>G synonymous_variant 1.0
clpC1 4039694 c.1011G>C synonymous_variant 1.0
clpC1 4039724 c.981A>G synonymous_variant 1.0
clpC1 4039733 c.972G>C synonymous_variant 1.0
clpC1 4039739 c.966C>G synonymous_variant 0.94
clpC1 4039751 c.954A>G synonymous_variant 1.0
clpC1 4039757 c.948A>G synonymous_variant 1.0
clpC1 4039769 c.936C>T synonymous_variant 1.0
clpC1 4039775 c.930G>C synonymous_variant 1.0
clpC1 4039778 c.927A>G synonymous_variant 1.0
clpC1 4039793 c.912C>G synonymous_variant 1.0
clpC1 4039805 c.900C>T synonymous_variant 1.0
clpC1 4039814 c.891C>G synonymous_variant 1.0
clpC1 4039817 c.888A>C synonymous_variant 1.0
clpC1 4039820 c.885T>G synonymous_variant 1.0
clpC1 4039831 c.874T>C synonymous_variant 1.0
clpC1 4039850 c.855T>C synonymous_variant 1.0
clpC1 4039865 c.840T>C synonymous_variant 1.0
clpC1 4039904 c.801A>G synonymous_variant 1.0
clpC1 4039907 c.798G>A synonymous_variant 1.0
clpC1 4039931 c.774T>C synonymous_variant 1.0
clpC1 4039934 c.771G>C synonymous_variant 1.0
clpC1 4039943 c.762G>C synonymous_variant 1.0
clpC1 4039946 c.759A>G synonymous_variant 1.0
clpC1 4039949 c.756G>C synonymous_variant 1.0
clpC1 4039952 c.753T>C synonymous_variant 1.0
clpC1 4039958 c.747G>C synonymous_variant 1.0
clpC1 4039964 c.741C>G synonymous_variant 1.0
clpC1 4039975 p.Asp244Asn missense_variant 1.0
clpC1 4039979 c.726C>G synonymous_variant 1.0
clpC1 4039982 c.723G>A synonymous_variant 1.0
clpC1 4040000 c.705C>T synonymous_variant 1.0
clpC1 4040021 c.684A>C synonymous_variant 1.0
clpC1 4040024 c.681A>G synonymous_variant 1.0
clpC1 4040033 c.672G>C synonymous_variant 1.0
clpC1 4040042 c.663C>T synonymous_variant 1.0
clpC1 4040057 c.648C>T synonymous_variant 1.0
clpC1 4040087 c.618G>T synonymous_variant 1.0
clpC1 4040090 c.613_615delTCTinsAGC synonymous_variant 1.0
clpC1 4040093 c.612C>G synonymous_variant 1.0
clpC1 4040126 c.579C>T synonymous_variant 1.0
clpC1 4040132 c.573C>T synonymous_variant 1.0
clpC1 4040141 c.564C>T synonymous_variant 1.0
clpC1 4040144 c.561G>C synonymous_variant 1.0
clpC1 4040147 c.558A>G synonymous_variant 1.0
clpC1 4040153 c.552A>G synonymous_variant 1.0
clpC1 4040159 c.546G>C synonymous_variant 1.0
clpC1 4040162 c.543G>C synonymous_variant 1.0
clpC1 4040165 c.540G>C synonymous_variant 1.0
clpC1 4040168 c.537G>T synonymous_variant 1.0
clpC1 4040171 c.534C>G synonymous_variant 1.0
clpC1 4040192 c.513C>T synonymous_variant 1.0
clpC1 4040237 c.468C>T synonymous_variant 1.0
clpC1 4040243 c.462C>T synonymous_variant 1.0
clpC1 4040248 p.Ala153Ser missense_variant 1.0
clpC1 4040254 p.Ala151Thr missense_variant 1.0
clpC1 4040257 p.Ala150Thr missense_variant 1.0
clpC1 4040267 c.438A>G synonymous_variant 1.0
clpC1 4040277 c.427_428delTCinsAG synonymous_variant 1.0
clpC1 4040279 c.426C>G synonymous_variant 1.0
clpC1 4040284 c.421C>T synonymous_variant 1.0
clpC1 4040291 c.414G>C synonymous_variant 1.0
clpC1 4040300 c.405C>T synonymous_variant 1.0
clpC1 4040303 c.402G>C synonymous_variant 1.0
clpC1 4040321 c.384C>T synonymous_variant 1.0
clpC1 4040333 c.372G>C synonymous_variant 1.0
clpC1 4040342 c.363C>T synonymous_variant 1.0
clpC1 4040345 c.360C>G synonymous_variant 1.0
clpC1 4040348 c.357G>C synonymous_variant 1.0
clpC1 4040360 c.345G>A synonymous_variant 1.0
clpC1 4040363 c.342A>T synonymous_variant 1.0
clpC1 4040423 c.282A>G synonymous_variant 1.0
clpC1 4040426 c.279T>C synonymous_variant 1.0
clpC1 4040431 c.274T>C synonymous_variant 1.0
clpC1 4040438 c.267G>A synonymous_variant 1.0
clpC1 4040441 c.264C>G synonymous_variant 1.0
clpC1 4040444 c.261C>G synonymous_variant 1.0
clpC1 4040450 c.255A>G synonymous_variant 1.0
clpC1 4040459 c.246C>G synonymous_variant 1.0
clpC1 4040462 c.243C>G synonymous_variant 1.0
clpC1 4040465 c.240T>C synonymous_variant 1.0
clpC1 4040468 c.237G>C synonymous_variant 1.0
clpC1 4040480 c.225T>C synonymous_variant 1.0
clpC1 4040486 c.219G>A synonymous_variant 1.0
clpC1 4040495 c.210C>G synonymous_variant 1.0
embC 4240717 c.855T>C synonymous_variant 1.0
embC 4240720 c.858C>T synonymous_variant 1.0
embC 4240723 c.861C>G synonymous_variant 1.0
embC 4240726 c.864G>C synonymous_variant 1.0
embC 4240741 c.879C>T synonymous_variant 1.0
embC 4240756 c.894G>C synonymous_variant 1.0
embC 4240768 c.906G>C synonymous_variant 1.0
embC 4240771 c.909G>C synonymous_variant 1.0
embC 4240772 p.Ser304Ala missense_variant 1.0
embC 4240780 c.918T>C synonymous_variant 1.0
embC 4240781 p.Ala307Ser missense_variant 1.0
embC 4240789 c.927T>C synonymous_variant 1.0
embC 4240819 c.957A>C synonymous_variant 1.0
embC 4240826 p.Ala322Ser missense_variant 1.0
embC 4240831 c.969T>G synonymous_variant 1.0
embA 4242892 c.-341G>C upstream_gene_variant 1.0
embA 4242898 c.-335G>C upstream_gene_variant 1.0
embA 4242901 c.-332G>C upstream_gene_variant 1.0
embA 4242907 c.-326G>C upstream_gene_variant 1.0
embA 4242916 c.-317C>G upstream_gene_variant 1.0
embA 4242940 c.-293T>C upstream_gene_variant 1.0
embC 4242941 p.His1027Tyr missense_variant 1.0
embC 4242944 p.Asn1028Leu missense_variant 1.0
embA 4242949 c.-284C>T upstream_gene_variant 1.0
embA 4242952 c.-281T>C upstream_gene_variant 1.0
embA 4242958 c.-275G>A upstream_gene_variant 1.0
embA 4245029 p.Ser599Arg missense_variant 1.0
embA 4245041 c.1809C>G synonymous_variant 1.0
embA 4245042 p.Thr604Ala missense_variant 1.0
embA 4245053 c.1821G>C synonymous_variant 1.0
embA 4245056 c.1824C>G synonymous_variant 1.0
embA 4245059 c.1827G>C synonymous_variant 1.0
embA 4245060 c.1828T>C synonymous_variant 1.0
embA 4245069 p.Val613Ile missense_variant 1.0
embA 4245081 p.Ala617Ser missense_variant 1.0
embA 4245089 c.1857G>C synonymous_variant 1.0
embA 4245101 c.1869G>C synonymous_variant 1.0
embA 4245125 c.1893G>C synonymous_variant 1.0
embB 4248211 c.1698G>C synonymous_variant 1.0
embB 4248217 c.1704C>G synonymous_variant 1.0
embB 4248226 c.1713G>C synonymous_variant 1.0
embB 4248232 c.1719G>C synonymous_variant 1.0
embB 4248233 p.Leu574Val missense_variant 1.0
embB 4248236 p.Met575Leu missense_variant 1.0
embB 4248245 p.Ile578Val missense_variant 1.0
embB 4248259 p.Met582Ile missense_variant 1.0
embB 4248275 p.Thr588Ala missense_variant 1.0
embB 4248280 c.1767C>G synonymous_variant 1.0
embB 4248283 c.1770C>G synonymous_variant 1.0
embB 4248307 c.1794G>C synonymous_variant 1.0
embB 4248317 p.Val602Leu missense_variant 1.0