TB-Profiler result

Run: ERR6359074

Summary

Run ID: ERR6359074

Sample name:

Date: 2024-03-25T23:26:20.072452

Number of reads: 281851

Percentage reads mapped: 7.27

Median coverage: 0.0

Strain: lineage4.9

Spoligotype:

Drug-resistance: HR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4 Euro-American None 1.0
lineage4.9 Euro-American (H37Rv-like) None 0.99
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin
isoniazid katG p.Ser140Asn Uncertain significance Mutation from literature
ethambutol
pyrazinamide
streptomycin
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide
clofazimine
para-aminosalicylic_acid
delamanid fbiC c.1728_1729delCT Assoc w R - Interim Confers DLM-PMD cross-resistance
c.1742delTinsCAC Assoc w R - Interim Confers DLM-PMD cross-resistance
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
fbiC 1304657 c.1728_1729delCT frameshift_variant 1.0 delamanid Assoc w R - Interim Confers DLM-PMD cross-resistance
pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
fbiC 1304672 c.1742delTinsCAC frameshift_variant&missense_variant 1.0 delamanid Assoc w R - Interim Confers DLM-PMD cross-resistance
pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
katG 2155693 p.Ser140Asn missense_variant 0.88 isoniazid Uncertain significance Mutation from literature
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 6688 c.-614C>A upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrA 6700 c.-602T>C upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrA 6703 c.-599G>C upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrA 6709 c.-593A>G upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 6715 c.1476C>T synonymous_variant 1.0 levofloxacin
moxifloxacin Not assoc w R - Interim
gyrB 6722 p.Arg495Lys missense_variant 1.0 levofloxacin
moxifloxacin
gyrA 6727 c.-575G>C upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrA 6730 c.-572A>C upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 6737 p.Thr500Ala missense_variant 1.0 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrA 6742 c.-560A>G upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 6745 c.1506T>C synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6749 p.Ala504Ser missense_variant 1.0 levofloxacin
moxifloxacin
gyrA 6760 c.-542G>C upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 6763 c.1524G>C synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6764 c.1525_1527delCTGinsTC frameshift_variant&missense_variant 1.0 levofloxacin Uncertain significance
moxifloxacin
gyrA 6775 c.-527G>T upstream_gene_variant 0.94 levofloxacin
moxifloxacin
gyrB 6798 p.Gly520Ala missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Uncertain significance
gyrB 6808 c.1569C>G synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6811 c.1572C>T synonymous_variant 1.0 levofloxacin
moxifloxacin Not assoc w R - Interim
gyrA 6844 c.-458T>C upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrA 6850 c.-452C>T upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrA 6853 c.-449A>G upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 6856 c.1617T>C synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6859 c.1620T>C synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6862 c.1623C>G synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 6869 c.-433T>C upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 6872 c.1633_1635delTTGinsCC frameshift_variant&missense_variant 1.0 levofloxacin Uncertain significance
moxifloxacin
gyrB 6881 c.1642_1644delTTGinsCC frameshift_variant&missense_variant 1.0 levofloxacin Uncertain significance
moxifloxacin
gyrA 6889 c.-413G>C upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrA 6898 c.-404G>A upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 6911 p.Asn558His missense_variant 1.0 levofloxacin
moxifloxacin
gyrA 6916 c.-386G>T upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 7012 c.1773G>C synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7015 c.-287G>A upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrA 7018 c.-284G>C upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrA 7021 c.-281G>C upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 7025 p.Lys596Ala missense_variant 1.0 levofloxacin
moxifloxacin
gyrA 7033 c.-269G>C upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 7051 p.Glu604Asp missense_variant 1.0 levofloxacin
moxifloxacin
gyrB 7057 c.1818C>T synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 7060 c.1821T>C synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7078 c.-224A>C upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrA 7081 c.-221T>C upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrA 7084 c.-218A>G upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 7088 p.Asp617Asn missense_variant 1.0 levofloxacin
moxifloxacin
gyrB 7091 c.1852_1854delGCTinsCC frameshift_variant&missense_variant 1.0 levofloxacin Uncertain significance
moxifloxacin
gyrA 7099 c.-203G>A upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrB 7100 c.1861T>C synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7120 c.-182T>C upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrA 7129 c.-173T>C upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrA 7132 c.-170T>G upstream_gene_variant 1.0 levofloxacin
moxifloxacin
gyrA 8849 c.1548C>G synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8852 c.1551T>C synonymous_variant 1.0 levofloxacin
moxifloxacin
gyrA 8858 c.1557T>C synonymous_variant 1.0 levofloxacin
moxifloxacin
gyrA 8867 c.1566A>G synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8870 c.1569G>C synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8873 c.1572A>G synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8897 c.1596T>C synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8903 c.1602T>C synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8915 c.1614A>G synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8930 c.1629C>T synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8939 c.1638T>C synonymous_variant 1.0 levofloxacin
moxifloxacin
gyrA 8946 c.1645T>C synonymous_variant 1.0 levofloxacin
moxifloxacin
gyrA 8951 c.1650G>A synonymous_variant 1.0 levofloxacin
moxifloxacin
gyrA 8960 c.1659C>T synonymous_variant 1.0 levofloxacin
moxifloxacin
gyrA 8967 p.Ala556Arg missense_variant 1.0 levofloxacin
moxifloxacin
rpoB 760143 p.Val113Ile missense_variant 1.0 rifampicin Uncertain significance
rpoB 760172 c.366G>C synonymous_variant 1.0 rifampicin
rpoB 760181 c.375T>G synonymous_variant 1.0 rifampicin
rpoB 760184 c.378A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760185 c.379C>T synonymous_variant 1.0 rifampicin
rpoB 760199 c.393C>G synonymous_variant 1.0 rifampicin
rpoB 760223 c.417T>C synonymous_variant 1.0 rifampicin
rpoB 760235 c.429T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760244 c.438G>C synonymous_variant 0.97 rifampicin Not assoc w R - Interim
rpoB 760256 c.450C>T synonymous_variant 0.95 rifampicin Not assoc w R - Interim
rpoB 760274 p.Glu156Asp missense_variant 0.94 rifampicin Uncertain significance
rpoB 760283 c.477G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760298 c.492G>C synonymous_variant 0.94 rifampicin Not assoc w R - Interim
rpoB 760310 c.504G>C synonymous_variant 0.95 rifampicin
rpoB 760316 c.510C>T synonymous_variant 0.83 rifampicin
rpoB 760317 c.511_512delAGinsTC synonymous_variant 0.83 rifampicin
rpoB 760331 c.525G>T synonymous_variant 0.83 rifampicin
rpoB 760493 c.687C>G synonymous_variant 1.0 rifampicin
rpoB 760508 c.702G>C synonymous_variant 1.0 rifampicin
rpoB 760511 c.705G>C synonymous_variant 1.0 rifampicin
rpoB 760522 p.Ser239Thr missense_variant 1.0 rifampicin
rpoB 760527 p.Gln241Glu missense_variant 0.95 rifampicin
rpoB 760532 c.726T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760533 p.Val243Thr missense_variant 1.0 rifampicin
rpoB 760541 c.735G>T synonymous_variant 1.0 rifampicin
rpoB 760563 p.Arg253Met missense_variant 1.0 rifampicin Uncertain significance
rpoB 760568 c.762G>C synonymous_variant 1.0 rifampicin
rpoB 760571 c.765G>C synonymous_variant 1.0 rifampicin
rpoB 760589 c.783C>G synonymous_variant 1.0 rifampicin
rpoB 760591 p.Val262Ala missense_variant 1.0 rifampicin
rpoB 760596 p.Thr264Gln missense_variant 1.0 rifampicin
rpoB 760611 c.805_807delTTGinsCC frameshift_variant&missense_variant 1.0 rifampicin
rpoB 760616 c.810C>T synonymous_variant 1.0 rifampicin
rpoB 760631 c.825G>A synonymous_variant 1.0 rifampicin
rpoB 760634 c.828T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760643 c.837G>A synonymous_variant 1.0 rifampicin
rpoB 760646 c.840C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760649 c.843G>C synonymous_variant 1.0 rifampicin
rpoB 760655 c.849A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760661 c.855A>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760670 c.864G>C synonymous_variant 1.0 rifampicin
rpoB 760674 c.868T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760679 c.873A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760683 c.877T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760712 c.906G>C synonymous_variant 1.0 rifampicin
rpoB 760715 c.909C>G synonymous_variant 1.0 rifampicin
rpoB 760895 c.1089C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760910 c.1104C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760916 c.1110C>T synonymous_variant 0.79 rifampicin Not assoc w R - Interim
rpoB 760919 c.1113C>T synonymous_variant 0.81 rifampicin
rpoB 760928 c.1122G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760934 c.1128C>T synonymous_variant 1.0 rifampicin
rpoB 760940 c.1134G>C synonymous_variant 0.84 rifampicin
rpoB 760946 c.1140A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760965 p.Met387Leu missense_variant 1.0 rifampicin Uncertain significance
rpoB 760970 c.1164G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 760982 c.1176G>T synonymous_variant 0.86 rifampicin
rpoB 760991 c.1185G>C synonymous_variant 1.0 rifampicin
rpoB 761015 c.1209G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761021 c.1215G>C synonymous_variant 1.0 rifampicin
rpoB 761027 c.1221A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761036 c.1230G>C synonymous_variant 0.88 rifampicin Not assoc w R - Interim
rpoB 761037 c.1231T>C synonymous_variant 0.88 rifampicin Not assoc w R - Interim
rpoB 761051 c.1245G>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761054 c.1248G>C synonymous_variant 0.98 rifampicin Not assoc w R - Interim
rpoB 761057 c.1251G>C synonymous_variant 0.98 rifampicin Not assoc w R - Interim
rpoB 761060 c.1254C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761084 c.1278C>A synonymous_variant 0.97 rifampicin Not assoc w R - Interim
rpoB 761088 c.1282_1283delAGinsTC synonymous_variant 1.0 rifampicin
rpoB 761096 c.1290G>C synonymous_variant 1.0 rifampicin
rpoB 761097 c.1291_1293delAGCinsTCG synonymous_variant 1.0 rifampicin
rpoB 761102 c.1296A>G synonymous_variant 1.0 rifampicin
rpoB 761126 c.1320G>C synonymous_variant 1.0 rifampicin
rpoB 761132 c.1326G>T synonymous_variant 0.97 rifampicin Not assoc w R - Interim
rpoB 761133 c.1327T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761150 c.1344A>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761153 c.1347G>C synonymous_variant 1.0 rifampicin
rpoB 761165 c.1359G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761180 c.1374A>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761189 c.1383T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761192 c.1386C>G synonymous_variant 1.0 rifampicin
rpoB 761195 c.1389G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761198 c.1392G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761219 c.1413G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761234 c.1428G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761249 c.1443A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761255 c.1449T>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761258 c.1452G>A synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761261 c.1455G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761264 c.1458C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761273 c.1467T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761282 c.1476C>T synonymous_variant 1.0 rifampicin
rpoB 761294 c.1488G>C synonymous_variant 1.0 rifampicin
rpoB 761306 c.1500C>G synonymous_variant 1.0 rifampicin
rpoB 761309 c.1503C>T synonymous_variant 1.0 rifampicin
rpoB 761909 c.2103T>C synonymous_variant 1.0 rifampicin
rpoB 761912 c.2106T>C synonymous_variant 1.0 rifampicin
rpoB 761915 p.Asp703Glu missense_variant 1.0 rifampicin
rpoB 761916 p.Asp704Asn missense_variant 1.0 rifampicin
rpoB 761921 c.2115C>T synonymous_variant 1.0 rifampicin
rpoB 761924 c.2118G>A synonymous_variant 0.6 rifampicin
rpoB 761930 c.2124G>C synonymous_variant 1.0 rifampicin
rpoB 761936 c.2130C>T synonymous_variant 1.0 rifampicin
rpoB 761948 c.2142G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761954 c.2148C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761969 c.2163G>A synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 761975 c.2169C>T synonymous_variant 0.38 rifampicin Not assoc w R - Interim
rpoB 762002 c.2196C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762003 c.2197_2199delAACinsCG frameshift_variant&missense_variant 1.0 rifampicin
rpoB 762008 c.2202C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762017 c.2211A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762020 p.Glu738Asp missense_variant 1.0 rifampicin
rpoB 762026 c.2220G>T synonymous_variant 1.0 rifampicin
rpoB 762041 c.2235C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762053 c.2247T>C synonymous_variant 0.41 rifampicin Not assoc w R - Interim
rpoB 762062 c.2256T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762065 c.2259T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762071 c.2265C>T synonymous_variant 0.43 rifampicin
rpoB 762074 c.2268C>G synonymous_variant 0.4 rifampicin
rpoB 762086 c.2280G>C synonymous_variant 0.57 rifampicin Not assoc w R - Interim
rpoB 762104 c.2298C>T synonymous_variant 0.99 rifampicin
rpoB 762110 c.2304G>C synonymous_variant 0.99 rifampicin
rpoB 762114 c.2308_2310delATCinsGT frameshift_variant&missense_variant 1.0 rifampicin
rpoB 762122 c.2316C>T synonymous_variant 0.48 rifampicin
rpoB 762128 c.2322G>C synonymous_variant 0.99 rifampicin
rpoB 762131 c.2325C>G synonymous_variant 0.47 rifampicin
rpoB 762134 c.2328C>T synonymous_variant 0.49 rifampicin
rpoB 762137 c.2331C>T synonymous_variant 0.48 rifampicin Not assoc w R - Interim
rpoB 762140 c.2334G>C synonymous_variant 1.0 rifampicin
rpoB 762143 c.2337T>C synonymous_variant 0.48 rifampicin
rpoB 762155 c.2349C>T synonymous_variant 0.52 rifampicin
rpoB 762161 c.2355C>T synonymous_variant 0.99 rifampicin Not assoc w R - Interim
rpoB 762176 c.2370T>G synonymous_variant 1.0 rifampicin
rpoB 762179 c.2373C>T synonymous_variant 0.99 rifampicin
rpoB 762185 c.2379G>T synonymous_variant 1.0 rifampicin
rpoB 762221 c.2415G>A synonymous_variant 1.0 rifampicin
rpoB 762227 c.2421G>A synonymous_variant 1.0 rifampicin
rpoB 762233 c.2427G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762239 c.2433G>A synonymous_variant 1.0 rifampicin
rpoB 762246 c.2440C>T synonymous_variant 0.99 rifampicin
rpoB 762254 c.2448T>G synonymous_variant 1.0 rifampicin
rpoB 762257 c.2451C>A synonymous_variant 1.0 rifampicin
rpoB 762275 c.2469C>G synonymous_variant 1.0 rifampicin
rpoB 762278 c.2472C>T synonymous_variant 1.0 rifampicin
rpoB 762287 c.2481C>T synonymous_variant 1.0 rifampicin
rpoB 762293 c.2487T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762297 c.2491C>T synonymous_variant 0.71 rifampicin
rpoB 762308 c.2502G>C synonymous_variant 1.0 rifampicin
rpoB 762314 c.2508C>T synonymous_variant 0.97 rifampicin
rpoB 762335 c.2529C>T synonymous_variant 1.0 rifampicin
rpoB 762338 c.2532T>C synonymous_variant 1.0 rifampicin
rpoB 762857 c.3051C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762858 p.Thr1018Ala missense_variant 1.0 rifampicin
rpoB 762863 c.3057T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762879 p.Met1025Leu missense_variant 1.0 rifampicin Uncertain significance
rpoC 762890 c.-480C>T upstream_gene_variant 1.0 rifampicin
rpoB 762899 c.3093G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 762902 c.-468C>T upstream_gene_variant 1.0 rifampicin
rpoB 762923 c.3117C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762929 c.3123G>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762959 c.3153G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 762962 c.3156C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 762971 c.-399G>C upstream_gene_variant 0.47 rifampicin
rpoC 762983 c.-387C>T upstream_gene_variant 1.0 rifampicin
rpoB 762995 c.3189G>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 763028 c.3222T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 763031 c.3225T>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 763040 c.3234C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763049 c.-321G>A upstream_gene_variant 1.0 rifampicin
rpoB 763053 c.3247T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 763070 c.3264T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763073 c.-297C>T upstream_gene_variant 1.0 rifampicin
rpoB 763074 p.Thr1090Val missense_variant 1.0 rifampicin
rpoC 763079 c.-291C>G upstream_gene_variant 1.0 rifampicin
rpoB 763085 c.3279C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 763088 c.3282C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 763094 c.3288G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 763115 c.3309T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763124 c.-246C>T upstream_gene_variant 1.0 rifampicin
rpoC 763142 c.-228C>G upstream_gene_variant 1.0 rifampicin
rpoB 763145 c.3339G>A synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoB 763157 c.3351G>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763375 c.6C>A synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763402 c.33C>G synonymous_variant 1.0 rifampicin
rpoC 763408 c.39T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763411 c.42T>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763414 c.45T>C synonymous_variant 1.0 rifampicin
rpoC 763420 c.51G>C synonymous_variant 1.0 rifampicin
rpoC 763423 p.Glu18Asp missense_variant 1.0 rifampicin Uncertain significance
rpoC 763430 c.61_63delAGGinsCC frameshift_variant&missense_variant 1.0 rifampicin
rpoC 763435 c.66A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763444 c.75T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763453 c.84C>G synonymous_variant 1.0 rifampicin
rpoC 763456 c.87A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763459 c.90G>A synonymous_variant 1.0 rifampicin
rpoC 763468 c.99G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763486 c.117T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763505 c.136C>T synonymous_variant 1.0 rifampicin
rpoC 763528 c.159G>T synonymous_variant 1.0 rifampicin
rpoC 763531 c.162G>C synonymous_variant 1.0 rifampicin Not assoc w R
rpoC 763534 c.165T>C synonymous_variant 1.0 rifampicin
rpoC 763537 c.168C>G synonymous_variant 1.0 rifampicin
rpoC 763546 c.177A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763558 c.189C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763570 c.201G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763573 c.204G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763594 c.225C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763597 c.228G>A synonymous_variant 1.0 rifampicin
rpoC 763621 c.252C>G synonymous_variant 1.0 rifampicin
rpoC 763624 c.255C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763633 c.264T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763651 c.282C>T synonymous_variant 1.0 rifampicin
rpoC 763660 c.291T>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763666 c.297G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763669 c.300C>G synonymous_variant 0.97 rifampicin Not assoc w R - Interim
rpoC 763702 c.333C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763703 c.334_336delTCGinsAGC synonymous_variant 1.0 rifampicin
rpoC 763708 c.339G>C synonymous_variant 1.0 rifampicin
rpoC 763711 c.342G>C synonymous_variant 1.0 rifampicin
rpoC 763714 c.345G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763717 c.348T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 763723 c.354G>C synonymous_variant 1.0 rifampicin
rpoC 763732 c.363C>G synonymous_variant 1.0 rifampicin
rpoC 763741 c.372C>T synonymous_variant 1.0 rifampicin
rpoC 763747 c.378G>A synonymous_variant 1.0 rifampicin
rpoC 763765 c.396T>C synonymous_variant 1.0 rifampicin
rpoC 763774 c.405G>C synonymous_variant 1.0 rifampicin
rpoC 763781 p.Ser138Ala missense_variant 1.0 rifampicin
rpoC 764227 c.858G>C synonymous_variant 1.0 rifampicin
rpoC 764239 c.870T>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764245 c.876C>G synonymous_variant 1.0 rifampicin
rpoC 764257 c.888G>C synonymous_variant 1.0 rifampicin
rpoC 764263 c.894G>C synonymous_variant 1.0 rifampicin
rpoC 764266 c.897T>C synonymous_variant 1.0 rifampicin
rpoC 764274 c.908_909insGACCA frameshift_variant 1.0 rifampicin
rpoC 764279 c.911_915delAGTCG frameshift_variant 1.0 rifampicin
rpoC 764344 c.975C>G synonymous_variant 1.0 rifampicin
rpoC 764353 c.984G>C synonymous_variant 1.0 rifampicin
rpoC 764365 c.996C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764371 c.1002G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764380 c.1011G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764383 c.1014C>G synonymous_variant 1.0 rifampicin
rpoC 764387 c.1018T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764398 c.1029G>C synonymous_variant 1.0 rifampicin
rpoC 764404 c.1035C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764405 c.1036_1038delAGGinsCT frameshift_variant&missense_variant 1.0 rifampicin
rpoC 764410 c.1041G>C synonymous_variant 1.0 rifampicin
rpoC 764428 c.1059G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764431 c.1062G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764434 c.1065A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764435 c.1066_1068delAGGinsCA frameshift_variant&missense_variant 1.0 rifampicin
rpoC 764446 c.1077T>C synonymous_variant 1.0 rifampicin
rpoC 764449 c.1080G>C synonymous_variant 1.0 rifampicin
rpoC 764455 c.1086G>T synonymous_variant 1.0 rifampicin
rpoC 764458 c.1089G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764461 c.1092A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764497 c.1128A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764500 c.1131C>G synonymous_variant 1.0 rifampicin
rpoC 764503 c.1134G>C synonymous_variant 1.0 rifampicin
rpoC 764521 c.1152T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764524 c.1155C>T synonymous_variant 1.0 rifampicin
rpoC 764527 c.1158C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764530 c.1161C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764539 c.1170C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764548 c.1179G>C synonymous_variant 1.0 rifampicin
rpoC 764554 c.1185C>T synonymous_variant 1.0 rifampicin
rpoC 764560 c.1191T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764566 c.1197C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764572 c.1203G>C synonymous_variant 1.0 rifampicin
rpoC 764575 c.1206T>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764576 c.1207_1208delTCinsAG synonymous_variant 1.0 rifampicin
rpoC 764593 c.1224C>T synonymous_variant 1.0 rifampicin
rpoC 764602 c.1233C>T synonymous_variant 1.0 rifampicin
rpoC 764605 c.1236G>T synonymous_variant 1.0 rifampicin
rpoC 764626 c.1257C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764644 c.1275G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764650 c.1281G>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764662 c.1293G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764677 c.1308C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764752 c.1383G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764758 c.1389C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764764 c.1395T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764779 c.1410G>A synonymous_variant 1.0 rifampicin
rpoC 764780 c.1411_1412delAGinsTC synonymous_variant 1.0 rifampicin
rpoC 764791 c.1422C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764797 c.1428G>C synonymous_variant 1.0 rifampicin
rpoC 764803 c.1434C>G synonymous_variant 1.0 rifampicin
rpoC 764809 c.1440C>G synonymous_variant 1.0 rifampicin
rpoC 764812 c.1443C>G synonymous_variant 1.0 rifampicin
rpoC 764815 c.1446A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764824 c.1455T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764827 c.1458G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764854 c.1485G>C synonymous_variant 1.0 rifampicin
rpoC 764858 c.1489T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764869 c.1500C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764872 c.1503A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764887 c.1518G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764888 c.1519_1521delTTGinsCC frameshift_variant&missense_variant 1.0 rifampicin
rpoC 764911 c.1542A>G synonymous_variant 1.0 rifampicin
rpoC 764912 p.Met515Gln missense_variant 1.0 rifampicin Uncertain significance
rpoC 764920 c.1551G>C synonymous_variant 1.0 rifampicin
rpoC 764923 c.1554A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764926 c.1557C>T synonymous_variant 1.0 rifampicin
rpoC 764935 c.1566T>C synonymous_variant 1.0 rifampicin
rpoC 764948 c.1579T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 764953 c.1584G>C synonymous_variant 1.0 rifampicin
rpoC 764968 c.1599T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765007 c.1638T>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765008 c.1639T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765011 c.1642_1643delAGinsTC synonymous_variant 1.0 rifampicin
rpoC 765016 c.1647C>G synonymous_variant 1.0 rifampicin
rpoC 765019 c.1650A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765034 c.1665T>C synonymous_variant 1.0 rifampicin
rpoC 765040 c.1671T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765041 c.1672T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765047 c.1678T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765052 c.1683C>T synonymous_variant 1.0 rifampicin
rpoC 765055 c.1686C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765070 c.1701G>C synonymous_variant 1.0 rifampicin
rpoC 765076 c.1707A>G synonymous_variant 1.0 rifampicin
rpoC 765079 c.1710T>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765082 c.1713G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765085 c.1716T>C synonymous_variant 1.0 rifampicin
rpoC 765089 c.1720T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765103 c.1734G>T synonymous_variant 1.0 rifampicin
rpoC 765118 c.1749C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765121 c.1752G>T synonymous_variant 1.0 rifampicin
rpoC 765729 p.Gln787Arg missense_variant 1.0 rifampicin
rpoC 765734 c.2365T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765739 c.2370G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765741 p.Glu791Ala missense_variant 1.0 rifampicin Uncertain significance
rpoC 765751 c.2382C>G synonymous_variant 1.0 rifampicin
rpoC 765753 p.Asp795Ala missense_variant 1.0 rifampicin Uncertain significance
rpoC 765772 c.2403C>G synonymous_variant 1.0 rifampicin
rpoC 765781 c.2412C>T synonymous_variant 1.0 rifampicin
rpoC 765784 c.2415C>G synonymous_variant 1.0 rifampicin
rpoC 765793 c.2424C>G synonymous_variant 1.0 rifampicin
rpoC 765796 c.2427C>T synonymous_variant 1.0 rifampicin
rpoC 765811 c.2442T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765814 c.2445A>T synonymous_variant 1.0 rifampicin
rpoC 765817 c.2448G>C synonymous_variant 1.0 rifampicin
rpoC 765820 c.2451G>C synonymous_variant 1.0 rifampicin
rpoC 765823 c.2454C>G synonymous_variant 1.0 rifampicin
rpoC 765844 c.2475C>G synonymous_variant 1.0 rifampicin
rpoC 765871 c.2502T>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765875 p.Val836Ile missense_variant 1.0 rifampicin Uncertain significance
rpoC 765904 c.2535C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765940 c.2571A>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765946 c.2577C>T synonymous_variant 1.0 rifampicin
rpoC 765947 c.2578T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765952 c.2583G>C synonymous_variant 1.0 rifampicin
rpoC 765962 c.2593T>C synonymous_variant 1.0 rifampicin
rpoC 765967 c.2598C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765979 c.2610C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765982 c.2613C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 765994 c.2625A>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 766009 c.2640G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 766012 c.2643C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 766708 c.3339A>G synonymous_variant 1.0 rifampicin
rpoC 766712 p.Ser1115Ala missense_variant 1.0 rifampicin
rpoC 766717 c.3348C>G synonymous_variant 1.0 rifampicin
rpoC 766720 c.3351C>T synonymous_variant 1.0 rifampicin
rpoC 766726 c.3357T>C synonymous_variant 1.0 rifampicin
rpoC 766738 c.3369G>C synonymous_variant 1.0 rifampicin
rpoC 766742 p.Gln1125Met missense_variant 1.0 rifampicin
rpoC 766753 c.3384C>G synonymous_variant 1.0 rifampicin
rpoC 766754 p.Glu1129Gln missense_variant 1.0 rifampicin
rpoC 766759 c.3390G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 766765 c.3396A>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 766774 c.3405T>C synonymous_variant 1.0 rifampicin
rpoC 766776 p.Arg1136His missense_variant 1.0 rifampicin
rpoC 766798 c.3429C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 766799 p.Ala1144Ser missense_variant 1.0 rifampicin Uncertain significance
rpoC 766804 c.3435A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 766813 c.3444G>C synonymous_variant 1.0 rifampicin
rpoC 766837 c.3468G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 766843 c.3474T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 767002 c.3633G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 767023 c.3654C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 767044 c.3675G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 767059 c.3690T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 767062 c.3693C>A synonymous_variant 1.0 rifampicin
rpoC 767065 c.3696G>C synonymous_variant 1.0 rifampicin
rpoC 767071 c.3702C>G synonymous_variant 1.0 rifampicin
rpoC 767074 c.3705T>C synonymous_variant 1.0 rifampicin
rpoC 767093 c.3724_3725delAGinsTC synonymous_variant 1.0 rifampicin
rpoC 767098 c.3729T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 767099 p.Lys1244Arg missense_variant 1.0 rifampicin
rpoC 767106 p.Asn1246Ile missense_variant 1.0 rifampicin
rpoC 767110 c.3741T>C synonymous_variant 1.0 rifampicin
rpoC 767113 c.3744G>C synonymous_variant 1.0 rifampicin
rpoC 767119 c.3750A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoC 767134 c.3765C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpsL 781628 c.69T>C synonymous_variant 1.0 streptomycin Not assoc w R - Interim
rpsL 781631 c.72G>C synonymous_variant 1.0 streptomycin
rpsL 781637 c.78C>G synonymous_variant 1.0 streptomycin
rpsL 781655 c.96T>C synonymous_variant 0.96 streptomycin
rpsL 781658 c.99A>G synonymous_variant 1.0 streptomycin
rpsL 781682 c.123T>C synonymous_variant 1.0 streptomycin
rpsL 781700 c.141G>C synonymous_variant 1.0 streptomycin
rpsL 781706 c.147T>G synonymous_variant 1.0 streptomycin
rpsL 781715 c.156T>C synonymous_variant 1.0 streptomycin
rpsL 781718 c.159C>G synonymous_variant 1.0 streptomycin
rpsL 781721 c.162C>T synonymous_variant 1.0 streptomycin
rpsL 781728 c.169T>C synonymous_variant 1.0 streptomycin
rpsL 781733 c.174G>C synonymous_variant 1.0 streptomycin
rpsL 781736 c.177T>C synonymous_variant 1.0 streptomycin
rpsL 781737 p.Gln60Ala missense_variant 1.0 streptomycin
rpsL 781754 c.195G>T synonymous_variant 1.0 streptomycin
rpsL 781760 c.201T>C synonymous_variant 1.0 streptomycin
rpsL 781766 c.207C>T synonymous_variant 1.0 streptomycin Not assoc w R - Interim
rpsL 781769 c.210G>A synonymous_variant 1.0 streptomycin
rpsL 781802 c.243G>C synonymous_variant 1.0 streptomycin
rpsL 781814 c.255C>T synonymous_variant 1.0 streptomycin
rpsL 781817 c.258G>T synonymous_variant 1.0 streptomycin
rpsL 781829 c.270G>C synonymous_variant 1.0 streptomycin
rpsL 781832 c.273T>G synonymous_variant 1.0 streptomycin
rpsL 781841 c.282C>T synonymous_variant 1.0 streptomycin
rpsL 781859 c.300T>C synonymous_variant 1.0 streptomycin Not assoc w R - Interim
rpsL 781865 c.306G>C synonymous_variant 1.0 streptomycin
rpsL 781871 c.312G>C synonymous_variant 1.0 streptomycin
rpsL 781877 c.318T>C synonymous_variant 1.0 streptomycin
rpsL 781880 c.321C>G synonymous_variant 1.0 streptomycin
rpsL 781892 c.333A>G synonymous_variant 1.0 streptomycin
rpsL 781898 c.339A>C synonymous_variant 1.0 streptomycin
rpsL 781916 c.357T>C synonymous_variant 1.0 streptomycin
rpsL 781929 p.Gly124Ser missense_variant 1.0 streptomycin Uncertain significance
rplC 800516 c.-293G>C upstream_gene_variant 1.0 linezolid
rplC 800525 c.-284C>T upstream_gene_variant 1.0 linezolid
rplC 800531 c.-278T>C upstream_gene_variant 1.0 linezolid
rplC 800537 c.-272C>G upstream_gene_variant 1.0 linezolid
rplC 800540 c.-269T>C upstream_gene_variant 1.0 linezolid
rplC 800543 c.-266C>T upstream_gene_variant 1.0 linezolid
rplC 800546 c.-263T>G upstream_gene_variant 1.0 linezolid
rplC 800549 c.-260G>T upstream_gene_variant 1.0 linezolid
rplC 800570 c.-239C>G upstream_gene_variant 1.0 linezolid
rplC 800573 c.-236C>G upstream_gene_variant 1.0 linezolid
rplC 800574 c.-235_-234delGTinsAC upstream_gene_variant 1.0 linezolid
rplC 800585 c.-224T>G upstream_gene_variant 1.0 linezolid
rplC 800589 c.-220_-218delAGCinsCG upstream_gene_variant 1.0 linezolid
rplC 800597 c.-212A>C upstream_gene_variant 1.0 linezolid
rplC 800610 c.-199_-197delCTAinsTG upstream_gene_variant 1.0 linezolid
rplC 800618 c.-191T>C upstream_gene_variant 1.0 linezolid
rplC 800633 c.-176T>C upstream_gene_variant 1.0 linezolid
rplC 800645 c.-164C>T upstream_gene_variant 1.0 linezolid
rplC 800648 c.-161A>G upstream_gene_variant 1.0 linezolid
rplC 800654 c.-155T>C upstream_gene_variant 1.0 linezolid
rplC 800672 c.-137G>C upstream_gene_variant 1.0 linezolid
rplC 800690 c.-119C>T upstream_gene_variant 1.0 linezolid
rplC 800693 c.-116A>G upstream_gene_variant 1.0 linezolid
rplC 800703 c.-106T>C upstream_gene_variant 1.0 linezolid
rplC 800715 c.-94A>C upstream_gene_variant 1.0 linezolid
rplC 800720 c.-89T>C upstream_gene_variant 1.0 linezolid
rplC 800723 c.-86C>G upstream_gene_variant 1.0 linezolid
rplC 800735 c.-74C>G upstream_gene_variant 1.0 linezolid
rplC 800738 c.-71T>G upstream_gene_variant 1.0 linezolid
rplC 800762 c.-47T>G upstream_gene_variant 1.0 linezolid
fbiC 1304613 c.1683T>G synonymous_variant 1.0 clofazimine
pretomanid
delamanid
fbiC 1304634 c.1704C>G synonymous_variant 1.0 clofazimine
pretomanid
delamanid
fbiC 1304640 c.1710A>C synonymous_variant 1.0 clofazimine
pretomanid
delamanid
fbiC 1304646 c.1716T>G synonymous_variant 1.0 clofazimine
pretomanid
delamanid
fbiC 1304661 c.1731C>T synonymous_variant 1.0 clofazimine
pretomanid
delamanid
fbiC 1304664 c.1734G>A synonymous_variant 1.0 clofazimine Not assoc w R - Interim
pretomanid
delamanid
fbiC 1304666 p.Leu579Pro missense_variant 1.0 clofazimine
pretomanid
delamanid
fbiC 1304670 c.1740G>A synonymous_variant 1.0 clofazimine
pretomanid
delamanid
fbiC 1304676 c.1746A>T synonymous_variant 1.0 clofazimine
pretomanid
delamanid
fbiC 1304694 c.1764A>C synonymous_variant 1.0 clofazimine
pretomanid
delamanid
fbiC 1304704 p.His592Tyr missense_variant 1.0 clofazimine
pretomanid
delamanid
fbiC 1304711 p.Ala594Asp missense_variant 1.0 clofazimine
pretomanid
delamanid
fbiC 1304715 c.1785G>T synonymous_variant 1.0 clofazimine
pretomanid
delamanid
fbiC 1304718 c.1788C>G synonymous_variant 1.0 clofazimine
pretomanid
delamanid
fbiC 1304724 c.1794A>G synonymous_variant 1.0 clofazimine Not assoc w R - Interim
pretomanid
delamanid Not assoc w R - Interim
fbiC 1304727 c.1797A>G synonymous_variant 1.0 clofazimine
pretomanid
delamanid
fbiC 1304748 c.1818T>C synonymous_variant 1.0 clofazimine
pretomanid
delamanid
rrs 1471914 n.69A>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1471918 n.73A>T non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1471922 n.78delT non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1471925 n.80T>C non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1471931 n.87delA non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1471934 n.89A>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1471938 n.93T>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1471943 n.98T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1471978 n.133C>T non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1471985 n.140T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1471986 n.141C>T non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472106 n.261G>A non_coding_transcript_exon_variant 0.97 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472108 n.263C>T non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472148 n.303T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472150 n.305T>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472172 n.327T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472225 n.380C>G non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472251 n.406G>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472285 n.440A>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472286 n.441C>A non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472288 n.443A>T non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472289 n.444T>C non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472297 n.453_465delGTCCGGGTTCTCT non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472312 n.467_468insA non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472315 n.470T>G non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472326 n.481T>A non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472328 n.483G>T non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472330 n.485G>T non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472416 n.571C>T non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472422 n.577T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Uncertain significance
rrs 1472425 n.580T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472435 n.590T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472437 n.592T>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472446 n.601T>A non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472450 n.605A>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472451 n.606C>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472456 n.611T>C non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472460 n.615T>C non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472461 n.616G>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472462 n.617T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472467 n.622G>T non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472473 n.628G>T non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472486 n.641A>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472489 n.644A>T non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472497 n.652G>T non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472530 n.685G>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472580 n.735C>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472597 n.752G>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472612 n.767G>T non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472682 n.837T>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472683 n.838T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472836 n.991G>A non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472840 n.995A>C non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472844 n.999C>A non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472845 n.1000G>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472847 n.1002G>C non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472849 n.1004C>G non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472850 n.1005T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472855 n.1011_1012insGT non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472861 n.1016_1018delGTTinsC non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472873 n.1028C>T non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472875 n.1030T>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472880 n.1035G>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472953 n.1108G>A non_coding_transcript_exon_variant 0.97 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472957 n.1112C>T non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472969 n.1124A>G non_coding_transcript_exon_variant 0.97 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472978 n.1133T>C non_coding_transcript_exon_variant 0.97 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473026 n.1181T>C non_coding_transcript_exon_variant 0.97 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473088 n.1243A>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473100 n.1255G>A non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473104 n.1259C>T non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473110 n.1265T>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473111 n.1266A>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473121 n.1276T>C non_coding_transcript_exon_variant 0.98 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473123 n.1278A>T non_coding_transcript_exon_variant 0.99 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473173 n.1328C>T non_coding_transcript_exon_variant 1.0 streptomycin Not assoc w R
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1473276 n.1431A>G non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473290 n.1445C>T non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473291 n.1446_1447insT non_coding_transcript_exon_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473301 n.1456T>C non_coding_transcript_exon_variant 1.0 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrl 1473679 n.22T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473696 n.39T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1473698 n.41G>A non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1473699 n.42A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1473717 n.60G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473731 n.74T>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473756 n.99G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473757 n.100T>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473758 n.101G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1473768 n.111A>G non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1473770 n.113T>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473806 n.149C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473832 n.175C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1473833 n.176_177insT non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473844 n.187C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473870 n.213G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473871 n.214T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473876 n.219G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473887 n.230_231insA non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1473898 n.241C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473899 n.242A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474135 n.478G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474140 n.483C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474151 n.494C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474174 n.517A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474183 n.526T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474184 n.527C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474186 n.529A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474201 n.544T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474218 n.561T>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474249 n.592G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474266 n.609T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474269 n.612C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474288 n.631_637delCCTTTTCinsTTGCACAGCTTG non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474296 n.640_647delCTCCGGAG non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474306 n.649A>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474310 n.653T>G non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474348 n.691C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474351 n.694G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474353 n.696A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474359 n.702C>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474362 n.705A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474387 n.730C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474402 n.745T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474409 n.756_776delACCCACACGCGCATACGCGCG non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474435 n.778G>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474437 n.782_784delATA non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474444 n.787G>C non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474454 n.797G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474496 n.839C>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474497 n.840G>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474506 n.849C>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474507 n.850G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474537 n.880G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474626 n.969T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474632 n.975G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474636 n.979A>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1474638 n.981C>A non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474639 n.982G>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474662 n.1005C>T non_coding_transcript_exon_variant 0.92 capreomycin
linezolid
rrl 1474664 n.1007G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474666 n.1009T>G non_coding_transcript_exon_variant 0.92 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474670 n.1013C>G non_coding_transcript_exon_variant 0.92 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474673 n.1016T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474676 n.1019T>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474679 n.1022G>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474684 n.1027T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474687 n.1030C>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474688 n.1031G>A non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474708 n.1052dupG non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1474711 n.1054_1055insA non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1474714 n.1058delT non_coding_transcript_exon_variant 0.92 capreomycin
linezolid
rrl 1474717 n.1060A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1474722 n.1065T>C non_coding_transcript_exon_variant 0.95 capreomycin Uncertain significance
linezolid
rrl 1474734 n.1077G>T non_coding_transcript_exon_variant 0.95 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474736 n.1079C>T non_coding_transcript_exon_variant 0.33 capreomycin
linezolid
rrl 1474749 n.1092C>T non_coding_transcript_exon_variant 0.97 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474753 n.1097delC non_coding_transcript_exon_variant 0.97 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474760 n.1103A>G non_coding_transcript_exon_variant 0.97 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474794 n.1137C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474803 n.1146G>A non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474812 n.1155G>A non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474823 n.1166C>G non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474824 n.1167A>G non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474825 n.1168G>A non_coding_transcript_exon_variant 0.98 capreomycin
linezolid
rrl 1474827 n.1170C>T non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474830 n.1173A>G non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474831 n.1174A>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474837 n.1180A>G non_coding_transcript_exon_variant 0.98 capreomycin
linezolid
rrl 1474896 n.1239A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474903 n.1246T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474904 n.1247G>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474913 n.1256T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474932 n.1275C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475060 n.1404delC non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475065 n.1408G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475067 n.1410A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475076 n.1419C>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475079 n.1422T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475081 n.1424C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475090 n.1433A>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475113 n.1456C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475114 n.1457C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475116 n.1459G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475419 n.1762C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1475422 n.1765A>G non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1475429 n.1772G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475443 n.1786G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475452 n.1795C>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475460 n.1803A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475475 n.1818C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1475479 n.1822C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475480 n.1823A>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475481 n.1824C>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475482 n.1825A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475483 n.1826C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475526 n.1869C>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475531 n.1874C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475538 n.1881T>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475539 n.1882A>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475545 n.1888T>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475550 n.1893A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475555 n.1898T>C non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1475699 n.2042C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475735 n.2078T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475753 n.2096C>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1475758 n.2101A>G non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1475769 n.2112T>C non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1475775 n.2118G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475791 n.2134A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475883 n.2226A>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475884 n.2227A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475892 n.2235A>G non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1475897 n.2240T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475916 n.2259C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475975 n.2318C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475977 n.2320A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475988 n.2331A>G non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476030 n.2373A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1476032 n.2375C>A non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1476034 n.2377C>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1476035 n.2378G>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1476044 n.2387T>G non_coding_transcript_exon_variant 0.98 capreomycin Uncertain significance
linezolid
rrl 1476045 n.2388G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1476047 n.2390G>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1476049 n.2392C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476058 n.2401T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476076 n.2419A>G non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1476086 n.2429G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476088 n.2431A>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476099 n.2442A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476103 n.2446C>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1476105 n.2450delA non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1476110 n.2453G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476115 n.2458T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476131 n.2474C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476160 n.2503T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476194 n.2537A>G non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476200 n.2543A>T non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476201 n.2544C>T non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476214 n.2557G>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476221 n.2564T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476224 n.2567A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476245 n.2588C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476251 n.2594T>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476252 n.2595T>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476256 n.2599A>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476281 n.2624T>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476297 n.2640C>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476298 n.2641C>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476300 n.2643G>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476301 n.2644A>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476309 n.2652G>C non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476524 n.2867C>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1476525 n.2868A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476539 n.2882A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476540 n.2883C>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476584 n.2927C>T non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476585 n.2928A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476608 n.2951C>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476614 n.2957A>T non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1476616 n.2959A>G non_coding_transcript_exon_variant 1.0 capreomycin
linezolid
rrl 1476619 n.2962C>T non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476628 n.2971T>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476629 n.2972C>A non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid
rrl 1476630 n.2973A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476661 n.3004A>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476665 n.3008T>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476666 n.3009C>T non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476675 n.3018C>G non_coding_transcript_exon_variant 1.0 capreomycin Uncertain significance
linezolid Uncertain significance
rpsA 1833571 c.30A>G synonymous_variant 1.0 pyrazinamide
rpsA 1833580 c.39C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833589 c.48A>C synonymous_variant 1.0 pyrazinamide
rpsA 1833595 c.54T>C synonymous_variant 1.0 pyrazinamide
rpsA 1833596 p.Ser19Ala missense_variant 1.0 pyrazinamide
rpsA 1833604 c.63C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833607 c.66T>C synonymous_variant 1.0 pyrazinamide
rpsA 1833616 c.75A>C synonymous_variant 1.0 pyrazinamide
rpsA 1833619 c.78A>C synonymous_variant 1.0 pyrazinamide
rpsA 1833623 p.Lys28Ala missense_variant 1.0 pyrazinamide
rpsA 1833646 c.105T>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
rpsA 1833652 c.111C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833664 c.123C>A synonymous_variant 1.0 pyrazinamide
rpsA 1833679 c.138G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833685 c.144G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833694 c.153G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833697 c.156C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833709 c.168C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833727 c.186G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833730 c.189C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833733 c.192C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833734 c.193_195delGCCinsTT frameshift_variant&missense_variant 1.0 pyrazinamide Uncertain significance
rpsA 1833742 c.201A>G synonymous_variant 1.0 pyrazinamide
rpsA 1833745 c.204G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833754 c.213G>A synonymous_variant 1.0 pyrazinamide
rpsA 1833760 c.219C>T synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
rpsA 1833769 c.228C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833787 c.246C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833790 c.249T>C synonymous_variant 1.0 pyrazinamide
rpsA 1833793 c.252C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833799 c.258C>G synonymous_variant 0.97 pyrazinamide
rpsA 1833802 c.261A>G synonymous_variant 1.0 pyrazinamide
rpsA 1833808 c.267G>T synonymous_variant 1.0 pyrazinamide
rpsA 1833811 c.270G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833835 c.294C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833838 c.297G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833841 c.300C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833847 c.306C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833856 c.315A>G synonymous_variant 1.0 pyrazinamide
rpsA 1833874 c.333T>C synonymous_variant 1.0 pyrazinamide
rpsA 1833886 c.345C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833894 p.Ala118Glu missense_variant 1.0 pyrazinamide
rpsA 1833919 c.378C>T synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
rpsA 1833920 p.Lys127Arg missense_variant 1.0 pyrazinamide
rpsA 1833928 c.387G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833931 c.390C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833949 c.408T>C synonymous_variant 1.0 pyrazinamide
rpsA 1833952 c.411C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833964 c.423C>T synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
rpsA 1833970 c.429G>T synonymous_variant 1.0 pyrazinamide
rpsA 1833979 c.438T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834000 c.459G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834015 c.474G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834018 c.477C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834021 c.480C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834030 c.489C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834033 c.492C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834034 p.Ile165Val missense_variant 1.0 pyrazinamide
rpsA 1834093 c.552G>T synonymous_variant 1.0 pyrazinamide
rpsA 1834144 c.603G>A synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
rpsA 1834151 c.610_612delAATinsCC frameshift_variant&missense_variant 1.0 pyrazinamide Uncertain significance
rpsA 1834154 c.613_615delAACinsCG frameshift_variant&missense_variant 1.0 pyrazinamide Uncertain significance
rpsA 1834157 c.616T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834162 c.621A>G synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
rpsA 1834165 c.624A>G synonymous_variant 1.0 pyrazinamide
rpsA 1834167 c.628_629delAC frameshift_variant 1.0 pyrazinamide Uncertain significance
rpsA 1834172 c.631_632insGG frameshift_variant 0.95 pyrazinamide Uncertain significance
rpsA 1834177 c.636A>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
rpsA 1834186 c.645C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834189 c.648G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834195 c.654G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834213 c.672G>C synonymous_variant 0.97 pyrazinamide
rpsA 1834234 c.693G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834240 c.699T>C synonymous_variant 0.97 pyrazinamide
rpsA 1834249 c.708T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834261 c.720A>C synonymous_variant 1.0 pyrazinamide
rpsA 1834264 c.723G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834279 c.738C>T synonymous_variant 0.97 pyrazinamide Not assoc w R - Interim
rpsA 1834298 p.Gln253Glu missense_variant 0.98 pyrazinamide
rpsA 1834303 c.762T>G synonymous_variant 1.0 pyrazinamide
rpsA 1834307 p.Asp256Asn missense_variant 0.98 pyrazinamide
rpsA 1834340 p.Met267Leu missense_variant 1.0 pyrazinamide Uncertain significance
rpsA 1834348 c.807T>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
rpsA 1834354 c.813G>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
rpsA 1834357 c.816T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834361 c.820T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834366 c.825A>G synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
rpsA 1834369 c.828C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834375 c.834G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834378 c.837T>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
rpsA 1834387 c.846C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834399 p.His286Gln missense_variant 1.0 pyrazinamide
rpsA 1834411 c.870T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834417 c.876G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834423 c.882G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834451 c.910T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834459 c.918G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834465 c.924T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834468 c.927A>G synonymous_variant 1.0 pyrazinamide
rpsA 1834474 c.933C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834483 c.942G>A synonymous_variant 1.0 pyrazinamide
rpsA 1834489 c.948T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834528 c.987T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834534 c.993C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834540 c.999G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834543 c.1002C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834546 c.1005T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834552 c.1011G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834555 c.1014T>G synonymous_variant 1.0 pyrazinamide
rpsA 1834557 p.Ala339Val missense_variant 1.0 pyrazinamide
rpsA 1834606 c.1065C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834609 c.1068T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834619 c.1078T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834622 c.1081_1083delTCGinsAGC synonymous_variant 1.0 pyrazinamide
rpsA 1834633 c.1092A>G synonymous_variant 1.0 pyrazinamide
rpsA 1834639 c.1098T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834650 p.Thr370Ser missense_variant 1.0 pyrazinamide
rpsA 1834652 p.Glu371Pro missense_variant 1.0 pyrazinamide
rpsA 1834663 c.1122C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834667 p.Ala376Ser missense_variant 1.0 pyrazinamide
rpsA 1834690 c.1149T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834733 p.Ala398Pro missense_variant 1.0 pyrazinamide
rpsA 1834738 c.1197A>G synonymous_variant 1.0 pyrazinamide
rpsA 1834753 c.1212T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834759 c.1218A>C synonymous_variant 1.0 pyrazinamide
rpsA 1834765 p.Glu408Asp missense_variant 1.0 pyrazinamide
rpsA 1834776 p.Ala412Glu missense_variant 1.0 pyrazinamide
rpsA 1834780 c.1239A>G synonymous_variant 1.0 pyrazinamide
rpsA 1834788 p.Ala416Gly missense_variant 1.0 pyrazinamide
rpsA 1834792 c.1251G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834804 c.1263C>G synonymous_variant 1.0 pyrazinamide
katG 2155632 c.480A>C synonymous_variant 1.0 isoniazid
katG 2155635 c.477C>G synonymous_variant 1.0 isoniazid
katG 2155674 c.438G>A synonymous_variant 0.87 isoniazid
katG 2155680 c.432G>C synonymous_variant 0.88 isoniazid
katG 2155691 c.421T>C synonymous_variant 1.0 isoniazid
katG 2155696 p.Ala139Gly missense_variant 0.88 isoniazid
katG 2155716 c.396T>G synonymous_variant 1.0 isoniazid
katG 2155737 c.375C>T synonymous_variant 0.86 isoniazid
katG 2155743 c.369G>T synonymous_variant 0.86 isoniazid
katG 2155761 c.351C>T synonymous_variant 0.86 isoniazid
katG 2155765 p.His116Ile missense_variant 1.0 isoniazid
katG 2155768 p.Ile115Thr missense_variant 0.86 isoniazid
Rv2477c 2783821 c.222A>G synonymous_variant 1.0 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
mtrB 3627002 c.-389G>C upstream_gene_variant 1.0 bedaquiline
rifampicin
mtrB 3627008 c.-395G>C upstream_gene_variant 1.0 bedaquiline
rifampicin
mtrB 3627011 c.-398T>G upstream_gene_variant 1.0 bedaquiline
rifampicin
mtrB 3627017 c.-404G>A upstream_gene_variant 1.0 bedaquiline
rifampicin
mtrB 3627023 c.-410C>G upstream_gene_variant 1.0 bedaquiline
rifampicin
mtrB 3627035 c.-422G>A upstream_gene_variant 1.0 bedaquiline
rifampicin
mtrA 3627038 c.310_312delATGinsGC frameshift_variant&missense_variant 1.0 bedaquiline
rifampicin
mtrB 3627059 c.-446G>C upstream_gene_variant 1.0 bedaquiline
rifampicin
mtrB 3627062 c.-449G>A upstream_gene_variant 1.0 bedaquiline
rifampicin
mtrB 3627065 c.-452G>C upstream_gene_variant 1.0 bedaquiline
rifampicin
mtrA 3627068 c.282T>C synonymous_variant 1.0 bedaquiline
rifampicin Not assoc w R - Interim
mtrB 3627071 c.-458G>C upstream_gene_variant 1.0 bedaquiline
rifampicin
mtrB 3627083 c.-470G>C upstream_gene_variant 1.0 bedaquiline
rifampicin
mtrB 3627092 c.-479C>G upstream_gene_variant 1.0 bedaquiline
rifampicin
mtrA 3627098 c.252A>C synonymous_variant 1.0 bedaquiline
rifampicin Not assoc w R - Interim
mtrA 3627119 c.231T>G synonymous_variant 1.0 bedaquiline
rifampicin Not assoc w R - Interim
mtrB 3627125 c.-512C>G upstream_gene_variant 1.0 bedaquiline
rifampicin
mtrB 3627128 c.-515T>C upstream_gene_variant 1.0 bedaquiline
rifampicin
mtrB 3627139 c.-526T>C upstream_gene_variant 1.0 bedaquiline
rifampicin
rpoA 3877587 c.921A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3877590 c.918G>C synonymous_variant 1.0 rifampicin
rpoA 3877600 p.Gln303Ala missense_variant 1.0 rifampicin
rpoA 3877613 p.Ile299Val missense_variant 1.0 rifampicin
rpoA 3877617 c.891G>C synonymous_variant 1.0 rifampicin
rpoA 3877638 c.870T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3877653 c.855C>T synonymous_variant 1.0 rifampicin
rpoA 3877656 c.852T>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3877662 c.846C>T synonymous_variant 1.0 rifampicin
rpoA 3877665 c.843C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3877674 c.834C>G synonymous_variant 1.0 rifampicin
rpoA 3877686 c.822A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3877692 c.816G>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3877704 c.804G>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3877716 c.792C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3877731 c.777G>C synonymous_variant 1.0 rifampicin
rpoA 3877734 c.774G>C synonymous_variant 1.0 rifampicin
rpoA 3877737 c.771G>C synonymous_variant 1.0 rifampicin
rpoA 3877740 c.768G>C synonymous_variant 1.0 rifampicin
rpoA 3877743 c.765T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3877752 p.Asp252Glu missense_variant 1.0 rifampicin
rpoA 3877764 p.Ala248Gly missense_variant 1.0 rifampicin
rpoA 3877770 c.738A>C synonymous_variant 1.0 rifampicin
rpoA 3877773 c.735G>C synonymous_variant 1.0 rifampicin
rpoA 3877776 c.732T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3877785 c.723C>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3877797 c.711G>C synonymous_variant 1.0 rifampicin
rpoA 3877800 c.708G>C synonymous_variant 1.0 rifampicin
rpoA 3877803 c.705G>C synonymous_variant 1.0 rifampicin
rpoA 3877824 c.684G>A synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3877833 c.675C>G synonymous_variant 1.0 rifampicin
rpoA 3877836 c.672A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3877839 c.669G>T synonymous_variant 1.0 rifampicin
rpoA 3877842 c.666A>C synonymous_variant 1.0 rifampicin
rpoA 3877856 c.652T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3877857 c.651G>A synonymous_variant 1.0 rifampicin
rpoA 3877866 c.642G>C synonymous_variant 1.0 rifampicin
rpoA 3877875 c.633T>G synonymous_variant 1.0 rifampicin
rpoA 3877881 c.627G>C synonymous_variant 1.0 rifampicin
rpoA 3877884 c.624G>C synonymous_variant 1.0 rifampicin
rpoA 3877893 c.615C>G synonymous_variant 1.0 rifampicin
rpoA 3877898 p.Pro204Ala missense_variant 1.0 rifampicin
rpoA 3877905 c.603A>C synonymous_variant 1.0 rifampicin
rpoA 3877908 c.600T>C synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3877932 c.576G>C synonymous_variant 1.0 rifampicin
rpoA 3877936 p.Lys191Arg missense_variant 1.0 rifampicin
rpoA 3877956 c.552G>A synonymous_variant 1.0 rifampicin
rpoA 3877962 c.546G>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
rpoA 3877971 p.Asp179Glu missense_variant 1.0 rifampicin Uncertain significance
rpoA 3877974 c.534G>C synonymous_variant 1.0 rifampicin
rpoA 3877989 c.519A>G synonymous_variant 1.0 rifampicin Not assoc w R - Interim
clpC1 4038746 c.1959C>G synonymous_variant 1.0 pyrazinamide
clpC1 4038755 c.1950G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038767 c.1938G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038770 c.1935C>T synonymous_variant 1.0 pyrazinamide
clpC1 4038773 c.1932T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038779 c.1926C>G synonymous_variant 1.0 pyrazinamide
clpC1 4038782 c.1923G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038790 c.1915C>T synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4038795 p.Ser637Thr missense_variant 1.0 pyrazinamide
clpC1 4038812 c.1893T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038815 c.1890G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038842 c.1863G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038860 c.1845G>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4038878 c.1827A>G synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4038890 c.1815G>A synonymous_variant 1.0 pyrazinamide
clpC1 4038905 c.1800A>G synonymous_variant 1.0 pyrazinamide
clpC1 4038911 c.1794G>T synonymous_variant 1.0 pyrazinamide
clpC1 4038914 c.1791G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038917 c.1788C>T synonymous_variant 1.0 pyrazinamide
clpC1 4038923 c.1782A>G synonymous_variant 1.0 pyrazinamide
clpC1 4038932 c.1773G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038941 c.1764G>C synonymous_variant 0.98 pyrazinamide
clpC1 4038953 c.1752A>G synonymous_variant 1.0 pyrazinamide
clpC1 4038956 c.1749T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038962 c.1743C>T synonymous_variant 1.0 pyrazinamide
clpC1 4038965 c.1740T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038971 c.1734T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038974 c.1731T>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4038986 c.1719C>T synonymous_variant 1.0 pyrazinamide
clpC1 4038989 c.1716T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038997 c.1708T>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4039004 c.1701C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039022 c.1683A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039067 c.1638G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039073 c.1632C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039079 c.1626C>G synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4039085 c.1620A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039091 c.1614G>T synonymous_variant 0.98 pyrazinamide
clpC1 4039097 c.1608G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039103 c.1602T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039106 c.1599G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039121 c.1584T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039133 c.1572C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039142 c.1563A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039145 c.1560G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039169 p.Glu512Asp missense_variant 1.0 pyrazinamide
clpC1 4039172 c.1533A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039181 c.1522_1524delTTGinsCC frameshift_variant&missense_variant 1.0 pyrazinamide
clpC1 4039187 c.1518G>T synonymous_variant 1.0 pyrazinamide
clpC1 4039199 p.Ala502Glu missense_variant 1.0 pyrazinamide
clpC1 4039220 c.1485G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039382 c.1323C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039391 c.1314T>G synonymous_variant 1.0 pyrazinamide
clpC1 4039409 c.1296T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039412 c.1293T>G synonymous_variant 1.0 pyrazinamide
clpC1 4039415 p.Glu430Asp missense_variant 1.0 pyrazinamide Uncertain significance
clpC1 4039421 c.1284C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039427 p.Glu426Asp missense_variant 1.0 pyrazinamide
clpC1 4039430 c.1275T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039442 c.1263A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039448 c.1257A>G synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4039454 c.1251A>G synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4039463 c.1242C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039466 c.1239T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039469 c.1236T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039472 c.1233G>T synonymous_variant 1.0 pyrazinamide
clpC1 4039481 c.1224T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039484 c.1221T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039487 c.1218G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039517 c.1188C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039556 c.1149G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039559 c.1146C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039565 c.1140G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039570 p.Met379Leu missense_variant 1.0 pyrazinamide Uncertain significance
clpC1 4039571 c.1134G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039574 p.Ala377Gly missense_variant 1.0 pyrazinamide
clpC1 4039586 c.1119G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039610 c.1095G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039616 c.1089G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039634 c.1069_1071delGAGinsAC frameshift_variant&missense_variant 1.0 pyrazinamide
clpC1 4039649 c.1056G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039682 c.1023C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039694 c.1011G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039724 c.981A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039733 c.972G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039748 c.957G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039751 c.954A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039757 c.948A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039766 c.939T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039769 c.936C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039778 c.927A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039787 c.918G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039793 c.912C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039817 c.888A>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4039820 c.885T>G synonymous_variant 1.0 pyrazinamide
clpC1 4039831 c.874T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039832 c.873C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039850 c.855T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039865 c.840T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039898 c.807C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039904 c.801A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039913 c.792C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039931 c.774T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039934 c.771G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039937 c.768G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039943 c.762G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039946 c.759A>T synonymous_variant 1.0 pyrazinamide
clpC1 4039952 c.753T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039955 c.750G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039958 c.747G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039979 c.726C>G synonymous_variant 1.0 pyrazinamide
clpC1 4040002 p.His235Asn missense_variant 1.0 pyrazinamide
clpC1 4040003 c.702G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040015 c.690G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040021 c.684A>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4040024 c.681A>G synonymous_variant 1.0 pyrazinamide
clpC1 4040033 c.672G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040042 c.663C>T synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
clpC1 4040066 c.639G>C synonymous_variant 1.0 pyrazinamide