TB-Profiler result

Run: df4202d6-ce56-41d4-83cf-607371159107

Summary

Run ID: df4202d6-ce56-41d4-83cf-607371159107

Sample name:

Date: 11-01-2023 15:49:00

Number of reads: 1424315

Percentage reads mapped: 6.94

Median coverage: 0

Strain:

Spoligotype:

Drug-resistance: Sensitive


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4.3.1 Euro-American (LAM) None 1.0
lineage4.3.2.1 Euro-American (LAM) RD761 0.97
lineage4.1.1.3 Euro-American (X-type) RD193 0.07
lineage4.2.2.1 Euro-American None 1.0
lineage1.1.3.3 Indo-Oceanic RD239 1.0
lineage1.2.1.2.1 Indo-Oceanic RD239 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin
isoniazid
ethambutol
pyrazinamide
moxifloxacin
levofloxacin
bedaquiline
delamanid
pretomanid
linezolid
streptomycin
amikacin
kanamycin
capreomycin
clofazimine
ethionamide
para-aminosalicylic_acid
cycloserine
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrB 6100 c.861G>A synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6115 c.876A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6121 c.882C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6127 c.888G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6133 c.894G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6136 c.897G>A synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6151 c.912C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6172 c.933C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6184 c.945C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6193 c.954G>A synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6196 c.957C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6202 c.963C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6203 p.Ser322Ala missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6214 c.975G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6223 c.984G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6229 c.990G>A synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6598 c.-704C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6610 c.-692C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6613 c.-689A>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6616 c.-686A>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6619 c.-683T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6634 c.-668T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6637 c.-665T>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6640 c.-662A>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6643 c.-659A>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6646 c.-656C>T upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6655 c.-647T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6673 c.-629A>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6676 c.-626T>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6700 c.-602T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6703 c.-599G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6706 c.-596G>A upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6709 c.-593A>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6712 c.-590G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6727 c.-575G>T upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6728 c.-574_-572delCTAinsTTG upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6745 c.-557T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6754 c.-548C>T upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6763 c.-539G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6772 c.-530C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6775 c.-527G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6793 c.-509T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6798 p.Gly520Ala missense_variant 1.0 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 6808 c.-494C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6824 c.-478C>T upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6841 c.-461T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6862 c.-440C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6869 c.-433T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6872 c.-430_-428delTTGinsCTT upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6878 c.-424T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6889 c.-413G>A upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6898 c.-404G>T upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6985 c.-317C>T upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6988 c.-314C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7006 c.-296T>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 7010 p.Leu591Met missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7015 c.-287G>A upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7018 c.-284G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7024 c.-278G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7033 c.-269G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 7051 p.Glu604Asp missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7060 c.-242T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7066 c.-236G>T upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7078 c.-224A>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7081 c.-221T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7084 c.-218A>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7090 c.-212C>T upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7093 c.-209T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7100 c.-202T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7123 c.-179C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7126 c.-176G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7129 c.-173T>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7132 c.-170T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7135 c.-167G>A upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7136 c.-166T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7141 c.-161T>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7144 c.-158A>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7150 c.-152G>A upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7153 c.-149G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7168 c.-134C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7178 c.-124T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7186 c.-116C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7189 c.-113C>T upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7198 c.-104C>T upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 7210 p.Asp657Glu missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7213 c.-89G>A upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7216 c.-86G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7225 c.-77T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7234 c.-68C>A upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7391 c.90C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7394 c.93T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7397 c.96G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7403 c.102C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7412 c.111C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7421 c.120G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7424 c.123G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7427 c.126G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7433 c.132G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7439 c.138C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7442 c.141G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7451 c.150C>A synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7457 c.156T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7463 c.162G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7466 c.165G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7469 c.168C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7472 c.171T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7475 c.174A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7480 p.Phe60Tyr missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7484 c.183T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7499 c.198G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7511 c.210C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7523 c.222C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7526 c.225G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7547 c.246C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7553 c.252C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7559 c.258G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7565 c.264C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7574 c.273G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7585 p.Ser95Thr missense_variant 1.0 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7589 c.288G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7595 c.294C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7607 c.306C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7637 c.336C>A synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7655 c.354G>A synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7739 c.438C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7745 c.444G>A synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7760 c.459C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7763 c.462T>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7778 c.477G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7781 c.480G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7782 p.Gln161Met missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7797 c.496_498delCTAinsTTG synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7802 c.501C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7811 c.510C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7814 c.513C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7832 c.531G>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7835 c.534A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7841 c.540C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7847 c.546G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7853 c.552C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7859 c.558A>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7865 c.564T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7868 p.Ile189Met missense_variant 1.0 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7890 c.589C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7898 p.Asp199Glu missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 8561 c.1260A>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8571 c.1270C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8576 c.1275C>G synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8580 p.Ile427Val missense_variant 0.97 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 8603 c.1302A>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8609 c.1308G>C synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8619 c.1318T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8624 c.1323G>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8633 c.1332C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8636 c.1335A>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8642 c.1341A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8645 c.1344C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8649 p.Arg450Lys missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8666 c.1365G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8672 c.1371A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8693 c.1392T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8696 c.1395G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8699 c.1398A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8711 c.1410A>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8783 c.1482G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8786 c.1485T>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8792 c.1491G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8799 p.Ala500Ser missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8810 c.1509A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8817 p.Ser506Ala missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8828 c.1527T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8829 c.1528_1530delTTGinsCTC synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8837 c.1536C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8846 c.1545C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8852 c.1551T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8858 c.1557T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8870 c.1569G>C synonymous_variant 0.99 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8873 c.1572A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8897 c.1596T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8903 c.1602T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8915 c.1614A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8942 c.1641G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8945 c.1644G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8946 c.1645T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8957 c.1656C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8967 p.Ala556Lys missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8978 c.1677C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8987 c.1686C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8990 c.1689C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8993 c.1692C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8996 c.1695T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8998 p.Leu566Trp missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9018 p.Gln573Lys missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9023 c.1722A>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9026 c.1725G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9029 c.1728T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9035 c.1734G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9044 c.1743C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9047 c.1746C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9062 c.1761C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9063 p.Ser588Ala missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9068 c.1767G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9071 c.1770G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9080 c.1779G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9089 c.1788G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9095 c.1794C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9099 c.1798_1800delTTAinsCTG synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9113 c.1812C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9116 c.1815G>A synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9119 c.1818A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9128 c.1827C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9251 c.1950G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9263 c.1962C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9267 p.Asn656Gly missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9272 c.1971C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9276 c.1975C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9281 c.1980C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9287 c.1986G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9296 c.1995T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9304 p.Gly668Glu missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9308 c.2007C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9330 p.Asn677His missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9345 c.2044_2046delAGGinsCGA synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9351 c.2050_2052delTCGinsAGT synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9356 c.2055G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9377 c.2076A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9383 c.2082T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9386 c.2085T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9392 c.2091C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9395 c.2094G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9413 c.2112G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
fgd1 490941 c.159C>T synonymous_variant 1.0 delamanid
fgd1 490948 p.Ser56Ala missense_variant 1.0 delamanid
fgd1 490962 c.180T>C synonymous_variant 1.0 delamanid
fgd1 490971 c.189A>G synonymous_variant 1.0 delamanid
fgd1 490974 c.192T>C synonymous_variant 1.0 delamanid
fgd1 490978 p.Asn66Gln missense_variant 1.0 delamanid
fgd1 490984 c.202C>T synonymous_variant 1.0 delamanid
fgd1 490988 p.Leu69Gln missense_variant 1.0 delamanid
fgd1 490998 c.216T>C synonymous_variant 1.0 delamanid
fgd1 491010 c.228C>T synonymous_variant 1.0 delamanid
fgd1 491013 c.231C>G synonymous_variant 1.0 delamanid
fgd1 491025 c.243C>T synonymous_variant 1.0 delamanid
fgd1 491031 c.249C>G synonymous_variant 1.0 delamanid
fgd1 491039 p.Ile86Thr missense_variant 1.0 delamanid
fgd1 491043 c.261T>C synonymous_variant 1.0 delamanid
fgd1 491046 c.264G>A synonymous_variant 1.0 delamanid
fgd1 491049 c.267T>C synonymous_variant 1.0 delamanid
fgd1 491064 c.282A>G synonymous_variant 1.0 delamanid
fgd1 491077 p.Asn99Gly missense_variant 1.0 delamanid
fgd1 491082 c.300T>C synonymous_variant 1.0 delamanid
fgd1 491083 p.Val101Ile missense_variant 1.0 delamanid
fgd1 491091 c.309T>G synonymous_variant 1.0 delamanid
fgd1 491094 c.312C>A synonymous_variant 1.0 delamanid
fgd1 491097 c.315G>C synonymous_variant 1.0 delamanid
fgd1 491112 c.330G>C synonymous_variant 1.0 delamanid
fgd1 491115 c.333G>C synonymous_variant 1.0 delamanid
fgd1 491121 c.339A>G synonymous_variant 1.0 delamanid
fgd1 491137 p.Glu119Ile missense_variant 1.0 delamanid
fgd1 491144 p.Ala121Glu missense_variant 1.0 delamanid
fgd1 491166 c.384G>T synonymous_variant 1.0 delamanid
fgd1 491172 c.390C>G synonymous_variant 1.0 delamanid
fgd1 491184 c.402A>G synonymous_variant 1.0 delamanid
fgd1 491190 c.408G>C synonymous_variant 1.0 delamanid
fgd1 491191 p.Gly137Arg missense_variant 1.0 delamanid
fgd1 491196 c.414A>C synonymous_variant 1.0 delamanid
fgd1 491202 c.420G>C synonymous_variant 1.0 delamanid
fgd1 491203 p.Gln141Glu missense_variant 1.0 delamanid
fgd1 491213 p.Ser144Thr missense_variant 1.0 delamanid
fgd1 491220 p.Asp146Glu missense_variant 1.0 delamanid
fgd1 491223 c.441C>T synonymous_variant 1.0 delamanid
fgd1 491232 c.450T>C synonymous_variant 1.0 delamanid
fgd1 491235 p.Asp151Glu missense_variant 1.0 delamanid
fgd1 491241 p.Asp153Glu missense_variant 1.0 delamanid
fgd1 491244 c.462T>C synonymous_variant 1.0 delamanid
mshA 575705 c.358T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575734 c.387T>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 575737 c.390T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575740 c.393G>T synonymous_variant 1.0 ethionamide
isoniazid
mshA 575743 c.396C>T synonymous_variant 1.0 ethionamide
isoniazid
mshA 575744 p.Ala133Thr missense_variant 1.0 ethionamide
isoniazid
mshA 575755 c.408G>A synonymous_variant 1.0 ethionamide
isoniazid
mshA 575761 c.414C>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 575767 c.420G>A synonymous_variant 1.0 ethionamide
isoniazid
mshA 575785 c.438T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575792 p.Asp149Asn missense_variant 1.0 ethionamide
isoniazid
mshA 575795 p.Ile150Leu missense_variant 1.0 ethionamide
isoniazid
mshA 575800 c.453G>T synonymous_variant 1.0 ethionamide
isoniazid
mshA 575812 c.465C>T synonymous_variant 1.0 ethionamide
isoniazid
mshA 575818 c.471G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575827 c.480G>A synonymous_variant 1.0 ethionamide
isoniazid
mshA 575829 p.Val161Ala missense_variant 1.0 ethionamide
isoniazid
mshA 575839 c.492G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575842 c.495G>C synonymous_variant 1.0 ethionamide
isoniazid
ccsA 620311 p.Leu141Val missense_variant 1.0 capreomycin
amikacin Uncertain significance
ccsA 620314 c.424C>T synonymous_variant 1.0 capreomycin
amikacin
ccsA 620317 p.Val143Ile missense_variant 1.0 capreomycin
amikacin
ccsA 620322 c.432G>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620328 c.438G>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620338 p.Thr150Ala missense_variant 1.0 capreomycin
amikacin
ccsA 620349 c.459A>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620354 p.Trp155Tyr missense_variant 1.0 capreomycin
amikacin
ccsA 620362 p.Ala158Thr missense_variant 1.0 capreomycin
amikacin Uncertain significance
ccsA 620365 p.Asn159Tyr missense_variant 1.0 capreomycin
amikacin
ccsA 620388 c.498A>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620397 c.507C>G synonymous_variant 1.0 capreomycin
amikacin
ccsA 620412 c.522T>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620415 c.525T>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620421 c.531G>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620430 c.540C>T synonymous_variant 1.0 capreomycin
amikacin
ccsA 620439 c.549T>G synonymous_variant 1.0 capreomycin
amikacin
ccsA 620442 c.552G>T synonymous_variant 0.98 capreomycin
amikacin
ccsA 620445 c.555A>T synonymous_variant 1.0 capreomycin
amikacin
ccsA 620454 c.564C>A synonymous_variant 1.0 capreomycin
amikacin
ccsA 620460 c.570T>G synonymous_variant 1.0 capreomycin
amikacin
ccsA 620463 c.573C>G synonymous_variant 1.0 capreomycin
amikacin
ccsA 620466 c.576C>A synonymous_variant 1.0 capreomycin
amikacin
ccsA 620473 c.583C>T synonymous_variant 1.0 capreomycin
amikacin
rpoB 760070 c.264T>G synonymous_variant 1.0 rifampicin
rpoB 760079 c.273G>A synonymous_variant 1.0 rifampicin
rpoB 760091 c.285G>C synonymous_variant 1.0 rifampicin
rpoB 760101 c.295T>C synonymous_variant 0.99 rifampicin
rpoB 760110 c.304_306delTCTinsAGC synonymous_variant 1.0 rifampicin
rpoB 760118 c.312T>G synonymous_variant 1.0 rifampicin
rpoB 760121 c.315T>C synonymous_variant 1.0 rifampicin
rpoB 760130 p.Asp108Glu missense_variant 1.0 rifampicin Uncertain significance
rpoB 760139 c.333A>G synonymous_variant 1.0 rifampicin
rpoB 760181 c.375T>C synonymous_variant 1.0 rifampicin
rpoB 760184 c.378A>G synonymous_variant 1.0 rifampicin
rpoB 760196 c.390C>G synonymous_variant 1.0 rifampicin
rpoB 760235 c.429T>C synonymous_variant 1.0 rifampicin
rpoB 760244 c.438G>C synonymous_variant 1.0 rifampicin
rpoB 760256 c.450C>T synonymous_variant 1.0 rifampicin
rpoB 760274 p.Glu156Asp missense_variant 0.99 rifampicin Uncertain significance
rpoB 760276 p.Lys157Met missense_variant 1.0 rifampicin
rpoB 760283 c.477G>C synonymous_variant 1.0 rifampicin
rpoB 760298 c.492G>C synonymous_variant 1.0 rifampicin
rpoB 760307 c.501T>C synonymous_variant 1.0 rifampicin
rpoB 760313 c.507G>C synonymous_variant 1.0 rifampicin
rpoB 760317 c.511_513delAGCinsTCG synonymous_variant 1.0 rifampicin
rpoB 760325 c.519G>C synonymous_variant 1.0 rifampicin
rpoB 760328 c.522G>C synonymous_variant 1.0 rifampicin
rpoB 760331 c.525G>T synonymous_variant 1.0 rifampicin
rpoB 760337 c.531C>G synonymous_variant 0.99 rifampicin
rpoB 760340 c.534G>T synonymous_variant 0.97 rifampicin
rpoB 760343 c.537G>C synonymous_variant 1.0 rifampicin
rpoB 760357 p.Thr184Ser missense_variant 1.0 rifampicin
rpoB 760361 c.555T>C synonymous_variant 1.0 rifampicin
rpoB 760370 c.564C>G synonymous_variant 1.0 rifampicin
rpoB 760376 p.Asp190Glu missense_variant 1.0 rifampicin
rpoB 760382 c.576G>C synonymous_variant 1.0 rifampicin
rpoB 760388 c.582C>T synonymous_variant 1.0 rifampicin
rpoB 760400 c.594G>C synonymous_variant 1.0 rifampicin
rpoB 760415 c.609C>T synonymous_variant 1.0 rifampicin
rpoB 760418 c.612G>C synonymous_variant 1.0 rifampicin
rpoB 760430 c.624T>C synonymous_variant 1.0 rifampicin
rpoB 760460 c.654G>C synonymous_variant 1.0 rifampicin
rpoB 760475 c.669A>G synonymous_variant 1.0 rifampicin
rpoB 760481 c.675G>C synonymous_variant 1.0 rifampicin
rpoB 760484 c.678A>G synonymous_variant 1.0 rifampicin
rpoB 760502 c.696C>G synonymous_variant 1.0 rifampicin
rpoB 760522 p.Ser239Asn missense_variant 1.0 rifampicin
rpoB 760532 c.726T>C synonymous_variant 1.0 rifampicin
rpoB 760541 c.735G>C synonymous_variant 1.0 rifampicin
rpoB 760561 c.757_758delCG frameshift_variant 1.0 rifampicin
rpoB 760567 p.Ser254Trp missense_variant 1.0 rifampicin
rpoB 760568 c.762_763insGC frameshift_variant 1.0 rifampicin
rpoB 760571 c.765G>C synonymous_variant 1.0 rifampicin
rpoB 760588 p.Thr261Ile missense_variant 1.0 rifampicin
rpoB 760591 p.Val262Ala missense_variant 1.0 rifampicin Uncertain significance
rpoB 760595 c.789C>T synonymous_variant 1.0 rifampicin
rpoB 760596 p.Thr264Pro missense_variant 1.0 rifampicin
rpoB 760608 c.802C>T synonymous_variant 1.0 rifampicin
rpoB 760611 c.805T>C synonymous_variant 1.0 rifampicin
rpoB 760634 c.828T>C synonymous_variant 1.0 rifampicin
rpoB 760646 c.840C>G synonymous_variant 1.0 rifampicin
rpoB 760655 c.849A>G synonymous_variant 1.0 rifampicin
rpoB 760661 c.855A>G synonymous_variant 1.0 rifampicin
rpoB 760668 p.Thr288Ala missense_variant 1.0 rifampicin
rpoB 760674 c.868T>C synonymous_variant 1.0 rifampicin
rpoB 760679 c.873A>G synonymous_variant 1.0 rifampicin
rpoB 760683 c.877T>C synonymous_variant 1.0 rifampicin
rpoB 760703 c.897C>T synonymous_variant 1.0 rifampicin
rpoB 760721 c.915C>G synonymous_variant 1.0 rifampicin
rpoB 760727 c.921C>G synonymous_variant 1.0 rifampicin
rpoB 760730 c.924T>C synonymous_variant 1.0 rifampicin
rpoB 760736 c.930C>G synonymous_variant 1.0 rifampicin
rpoB 760748 c.942C>G synonymous_variant 1.0 rifampicin
rpoB 760787 c.981G>C synonymous_variant 1.0 rifampicin
rpoB 760793 c.987A>G synonymous_variant 1.0 rifampicin
rpoB 760805 c.999G>C synonymous_variant 1.0 rifampicin
rpoB 760817 c.1011A>G synonymous_variant 1.0 rifampicin
rpoB 760820 c.1014T>C synonymous_variant 1.0 rifampicin
rpoB 760826 c.1020C>G synonymous_variant 1.0 rifampicin
rpoB 760830 c.1024T>C synonymous_variant 1.0 rifampicin
rpoB 760841 c.1035T>C synonymous_variant 1.0 rifampicin
rpoB 760858 p.Val351Ala missense_variant 1.0 rifampicin
rpoB 760862 c.1056G>C synonymous_variant 1.0 rifampicin
rpoB 760865 c.1059C>T synonymous_variant 0.99 rifampicin
rpoB 760886 p.Glu360Asp missense_variant 1.0 rifampicin
rpoB 760887 p.Thr361Val missense_variant 1.0 rifampicin
rpoB 760910 c.1104C>T synonymous_variant 1.0 rifampicin
rpoB 760916 c.1110C>T synonymous_variant 1.0 rifampicin
rpoB 760928 c.1122G>C synonymous_variant 1.0 rifampicin
rpoB 760943 c.1137C>T synonymous_variant 1.0 rifampicin
rpoB 760946 c.1140A>G synonymous_variant 1.0 rifampicin
rpoB 760965 p.Met387Leu missense_variant 1.0 rifampicin
rpoB 760970 c.1164G>C synonymous_variant 1.0 rifampicin
rpoB 760973 c.1167G>T synonymous_variant 0.99 rifampicin
rpoB 760982 c.1176G>C synonymous_variant 1.0 rifampicin
rpoB 760985 c.1179G>C synonymous_variant 1.0 rifampicin
rpoB 760988 c.1182C>G synonymous_variant 1.0 rifampicin
rpoB 760991 c.1185G>T synonymous_variant 1.0 rifampicin
rpoB 760997 c.1191G>C synonymous_variant 1.0 rifampicin
rpoB 761006 c.1200C>G synonymous_variant 1.0 rifampicin
rpoB 761015 c.1209G>C synonymous_variant 1.0 rifampicin
rpoB 761027 c.1221A>C synonymous_variant 1.0 rifampicin
rpoB 761036 c.1230G>C synonymous_variant 1.0 rifampicin
rpoB 761037 c.1231T>C synonymous_variant 1.0 rifampicin
rpoB 761051 c.1245G>T synonymous_variant 1.0 rifampicin
rpoB 761054 c.1248G>C synonymous_variant 1.0 rifampicin
rpoB 761057 c.1251G>C synonymous_variant 1.0 rifampicin
rpoB 761060 c.1254C>G synonymous_variant 1.0 rifampicin
rpoB 761063 c.1257C>G synonymous_variant 1.0 rifampicin
rpoB 761084 c.1278C>A synonymous_variant 1.0 rifampicin
rpoB 761097 c.1291_1293delAGCinsTCG synonymous_variant 1.0 rifampicin
rpoB 761102 c.1296A>G synonymous_variant 1.0 rifampicin
rpoB 761132 c.1326G>C synonymous_variant 1.0 rifampicin
rpoB 761133 c.1327T>C synonymous_variant 1.0 rifampicin
rpoB 761147 c.1341C>T synonymous_variant 1.0 rifampicin
rpoB 761150 c.1344A>T synonymous_variant 1.0 rifampicin
rpoB 761165 c.1359G>C synonymous_variant 1.0 rifampicin
rpoB 761171 c.1365C>T synonymous_variant 1.0 rifampicin
rpoB 761178 p.Ser458Thr missense_variant 1.0 rifampicin
rpoB 761186 p.Glu460Asp missense_variant 1.0 rifampicin
rpoB 761189 c.1383T>C synonymous_variant 1.0 rifampicin
rpoB 761195 c.1389G>C synonymous_variant 1.0 rifampicin
rpoB 761198 c.1392G>C synonymous_variant 1.0 rifampicin
rpoB 761219 c.1413G>C synonymous_variant 1.0 rifampicin
rpoB 761234 c.1428G>C synonymous_variant 1.0 rifampicin
rpoB 761246 c.1440C>T synonymous_variant 1.0 rifampicin
rpoB 761249 c.1443A>G synonymous_variant 1.0 rifampicin
rpoB 761255 c.1449T>G synonymous_variant 1.0 rifampicin
rpoB 761258 c.1452G>A synonymous_variant 1.0 rifampicin
rpoB 761261 c.1455G>C synonymous_variant 0.94 rifampicin
rpoB 761264 c.1458C>G synonymous_variant 1.0 rifampicin
rpoB 761273 c.1467T>C synonymous_variant 1.0 rifampicin
rpoB 761303 c.1497G>C synonymous_variant 0.99 rifampicin
rpoB 761318 c.1512G>T synonymous_variant 1.0 rifampicin
rpoB 761327 c.1521A>G synonymous_variant 1.0 rifampicin
rpoB 761333 c.1527G>T synonymous_variant 0.99 rifampicin
rpoB 761339 c.1533C>G synonymous_variant 1.0 rifampicin
rpoB 761345 c.1539G>C synonymous_variant 1.0 rifampicin
rpoB 761346 p.Val514Ser missense_variant 1.0 rifampicin
rpoB 761354 c.1548C>A synonymous_variant 1.0 rifampicin
rpoB 761357 c.1551G>T synonymous_variant 1.0 rifampicin
rpoB 761360 c.1554T>C synonymous_variant 1.0 rifampicin
rpoB 761362 p.Ser519Thr missense_variant 1.0 rifampicin
rpoB 761373 p.Val523His missense_variant 1.0 rifampicin
rpoB 761384 c.1578C>G synonymous_variant 0.99 rifampicin
rpoB 761393 c.1587G>A synonymous_variant 1.0 rifampicin
rpoB 761414 c.1608A>G synonymous_variant 1.0 rifampicin
rpoB 761423 c.1617T>C synonymous_variant 1.0 rifampicin
rpoB 761471 c.1665C>T synonymous_variant 1.0 rifampicin
rpoB 761482 p.Ala559Gly missense_variant 1.0 rifampicin
rpoB 761497 p.Tyr564Phe missense_variant 0.97 rifampicin
rpoB 761502 p.Pro566Ser missense_variant 1.0 rifampicin
rpoB 761505 p.Ser567Ala missense_variant 1.0 rifampicin
rpoB 761508 p.Ser568Thr missense_variant 1.0 rifampicin
rpoB 761516 c.1710G>C synonymous_variant 1.0 rifampicin
rpoB 761528 c.1722C>T synonymous_variant 0.99 rifampicin
rpoB 761531 c.1725C>T synonymous_variant 1.0 rifampicin
rpoB 761537 c.1731C>G synonymous_variant 1.0 rifampicin
rpoB 761555 c.1749G>C synonymous_variant 1.0 rifampicin
rpoB 761558 c.1752C>G synonymous_variant 1.0 rifampicin
rpoB 761564 c.1758G>C synonymous_variant 1.0 rifampicin
rpoB 761570 c.1764T>C synonymous_variant 0.99 rifampicin
rpoB 761573 c.1767C>G synonymous_variant 1.0 rifampicin
rpoB 761579 c.1773G>C synonymous_variant 1.0 rifampicin
rpoB 761612 c.1806G>T synonymous_variant 1.0 rifampicin
rpoB 761615 c.1809A>C synonymous_variant 1.0 rifampicin
rpoB 761636 c.1830G>T synonymous_variant 1.0 rifampicin
rpoB 761645 c.1839C>G synonymous_variant 1.0 rifampicin
rpoB 761657 c.1851C>T synonymous_variant 1.0 rifampicin
rpoB 761666 c.1860G>C synonymous_variant 1.0 rifampicin
rpoB 761669 c.1863C>T synonymous_variant 1.0 rifampicin
rpoB 761675 c.1869G>T synonymous_variant 1.0 rifampicin
rpoB 761681 c.1875G>A synonymous_variant 1.0 rifampicin
rpoB 761682 c.1876C>T synonymous_variant 1.0 rifampicin
rpoB 761687 c.1881C>T synonymous_variant 1.0 rifampicin
rpoB 761690 c.1884G>C synonymous_variant 1.0 rifampicin
rpoB 761693 c.1887G>C synonymous_variant 1.0 rifampicin
rpoB 761705 c.1899C>A synonymous_variant 1.0 rifampicin
rpoB 761720 c.1914C>G synonymous_variant 1.0 rifampicin
rpoB 761723 c.1917A>G synonymous_variant 0.37 rifampicin
rpoB 761724 p.Glu640Lys missense_variant 0.37 rifampicin
rpoB 761727 p.Ser641Ala missense_variant 0.98 rifampicin
rpoB 761728 c.1923dupC frameshift_variant 1.0 rifampicin
rpoB 761732 c.1926C>T synonymous_variant 1.0 rifampicin
rpoB 761741 c.1935G>A synonymous_variant 1.0 rifampicin
rpoB 761750 c.1944G>T synonymous_variant 1.0 rifampicin
rpoB 761760 p.Ile652Val missense_variant 1.0 rifampicin
rpoB 761765 c.1959T>C synonymous_variant 1.0 rifampicin
rpoB 761772 p.His656Ala missense_variant 1.0 rifampicin
rpoB 761778 p.Asn658Asp missense_variant 1.0 rifampicin
rpoB 761791 p.Arg662Gln missense_variant 1.0 rifampicin
rpoB 761794 p.Thr663Ser missense_variant 1.0 rifampicin
rpoB 761802 p.Met666Leu missense_variant 1.0 rifampicin
rpoB 761813 c.2007T>C synonymous_variant 1.0 rifampicin
rpoB 761819 c.2013G>C synonymous_variant 1.0 rifampicin
rpoB 761834 c.2028T>C synonymous_variant 0.97 rifampicin
rpoB 761847 p.Cys681Lys missense_variant 1.0 rifampicin
rpoB 761863 p.Ala686Glu missense_variant 1.0 rifampicin
rpoB 761867 c.2061C>G synonymous_variant 1.0 rifampicin
rpoB 761868 p.Asp688Gln missense_variant 1.0 rifampicin
rpoB 761873 c.2067A>G synonymous_variant 1.0 rifampicin
rpoB 761891 c.2085G>C synonymous_variant 1.0 rifampicin
rpoB 761909 c.2103T>C synonymous_variant 1.0 rifampicin
rpoB 761912 c.2106T>C synonymous_variant 1.0 rifampicin
rpoB 761915 p.Asp703Glu missense_variant 1.0 rifampicin Uncertain significance
rpoB 761916 p.Asp704Asn missense_variant 1.0 rifampicin
rpoB 761924 c.2118G>A synonymous_variant 1.0 rifampicin
rpoB 761930 c.2124G>C synonymous_variant 1.0 rifampicin
rpoB 761933 c.2127G>C synonymous_variant 1.0 rifampicin
rpoB 761936 c.2130C>T synonymous_variant 1.0 rifampicin
rpoB 761948 c.2142G>C synonymous_variant 1.0 rifampicin
rpoB 761954 c.2148C>A synonymous_variant 1.0 rifampicin
rpoB 761955 p.Ile717Val missense_variant 1.0 rifampicin
rpoB 761969 c.2163G>A synonymous_variant 1.0 rifampicin
rpoB 761990 c.2184G>C synonymous_variant 1.0 rifampicin
rpoB 762008 c.2202C>T synonymous_variant 1.0 rifampicin
rpoB 762014 c.2208C>G synonymous_variant 1.0 rifampicin
rpoB 762038 c.2232C>T synonymous_variant 1.0 rifampicin
rpoB 762047 c.2241G>A synonymous_variant 1.0 rifampicin
rpoB 762053 c.2247T>C synonymous_variant 1.0 rifampicin
rpoB 762056 c.2250G>A synonymous_variant 1.0 rifampicin
rpoB 762065 c.2259T>G synonymous_variant 1.0 rifampicin
rpoB 762083 c.2277T>C synonymous_variant 1.0 rifampicin
rpoB 762086 c.2280G>C synonymous_variant 1.0 rifampicin
rpoB 762101 c.2295C>G synonymous_variant 1.0 rifampicin
rpoB 762114 p.Ile770Val missense_variant 1.0 rifampicin
rpoB 762122 c.2316C>T synonymous_variant 1.0 rifampicin
rpoB 762131 c.2325C>G synonymous_variant 1.0 rifampicin
rpoB 762134 c.2328C>A synonymous_variant 1.0 rifampicin
rpoB 762137 c.2331C>T synonymous_variant 1.0 rifampicin
rpoB 762140 c.2334G>C synonymous_variant 1.0 rifampicin
rpoB 762143 c.2337T>C synonymous_variant 1.0 rifampicin
rpoB 762149 c.2343G>T synonymous_variant 1.0 rifampicin
rpoB 762158 c.2352G>C synonymous_variant 1.0 rifampicin
rpoB 762167 c.2361T>C synonymous_variant 1.0 rifampicin
rpoB 762176 c.2370T>C synonymous_variant 1.0 rifampicin
rpoB 762185 c.2379G>C synonymous_variant 1.0 rifampicin
rpoB 762194 c.2388G>C synonymous_variant 1.0 rifampicin
rpoB 762233 c.2427G>C synonymous_variant 1.0 rifampicin
rpoB 762236 c.2430G>C synonymous_variant 1.0 rifampicin
rpoB 762245 c.2439G>C synonymous_variant 1.0 rifampicin
rpoB 762275 c.2469C>T synonymous_variant 0.99 rifampicin
rpoB 762284 c.2478G>C synonymous_variant 1.0 rifampicin
rpoB 762293 c.2487T>C synonymous_variant 1.0 rifampicin
rpoB 762296 c.2490G>C synonymous_variant 1.0 rifampicin
rpoB 762317 c.2511A>G synonymous_variant 1.0 rifampicin
rpoB 762323 c.2517C>A synonymous_variant 1.0 rifampicin
rpoB 762329 c.2523G>C synonymous_variant 1.0 rifampicin
rpoB 762338 c.2532T>C synonymous_variant 1.0 rifampicin
rpoB 762341 c.2535G>C synonymous_variant 1.0 rifampicin
rpoB 762347 c.2541T>C synonymous_variant 1.0 rifampicin
rpoB 762350 c.2544C>G synonymous_variant 1.0 rifampicin
rpoB 762353 c.2547C>T synonymous_variant 1.0 rifampicin
rpoB 762356 p.Glu850Asp missense_variant 1.0 rifampicin
rpoB 762362 p.Glu852Asp missense_variant 1.0 rifampicin
rpoB 762368 p.Glu854Asp missense_variant 1.0 rifampicin
rpoB 762369 c.2563T>C synonymous_variant 1.0 rifampicin
rpoC 762374 c.-996G>T upstream_gene_variant 1.0 rifampicin
rpoC 762380 c.-990T>C upstream_gene_variant 1.0 rifampicin
rpoC 762383 c.-987C>G upstream_gene_variant 1.0 rifampicin
rpoC 762386 c.-984C>T upstream_gene_variant 1.0 rifampicin
rpoC 762392 c.-978G>C upstream_gene_variant 1.0 rifampicin
rpoC 762395 c.-975G>T upstream_gene_variant 1.0 rifampicin
rpoC 762398 c.-972T>C upstream_gene_variant 1.0 rifampicin
rpoC 762404 c.-966T>C upstream_gene_variant 1.0 rifampicin
rpoC 762410 c.-960T>G upstream_gene_variant 1.0 rifampicin
rpoC 762416 c.-954A>G upstream_gene_variant 1.0 rifampicin
rpoC 762449 c.-921C>A upstream_gene_variant 1.0 rifampicin
rpoC 762452 c.-918G>C upstream_gene_variant 1.0 rifampicin
rpoC 762470 c.-900G>C upstream_gene_variant 1.0 rifampicin
rpoC 762491 c.-879T>C upstream_gene_variant 1.0 rifampicin
rpoC 762509 c.-861T>G upstream_gene_variant 1.0 rifampicin
rpoB 762510 p.Ala902Pro missense_variant 1.0 rifampicin Uncertain significance
rpoC 762515 c.-855C>T upstream_gene_variant 1.0 rifampicin
rpoC 762533 c.-837T>C upstream_gene_variant 1.0 rifampicin
rpoC 762536 c.-834T>C upstream_gene_variant 1.0 rifampicin
rpoC 762537 c.-833T>C upstream_gene_variant 1.0 rifampicin
rpoC 762551 c.-819C>T upstream_gene_variant 1.0 rifampicin
rpoC 762557 c.-813G>A upstream_gene_variant 1.0 rifampicin
rpoC 762560 c.-810A>C upstream_gene_variant 1.0 rifampicin
rpoC 762563 c.-807G>T upstream_gene_variant 0.99 rifampicin
rpoC 762581 c.-789T>C upstream_gene_variant 1.0 rifampicin
rpoC 762587 c.-783G>A upstream_gene_variant 1.0 rifampicin
rpoC 762596 c.-774G>C upstream_gene_variant 1.0 rifampicin
rpoB 762596 c.2789_2790insC frameshift_variant 1.0 rifampicin
rpoC 762827 c.-543G>C upstream_gene_variant 1.0 rifampicin
rpoC 762830 c.-540C>G upstream_gene_variant 1.0 rifampicin
rpoC 762857 c.-513C>G upstream_gene_variant 1.0 rifampicin
rpoC 762860 c.-510G>C upstream_gene_variant 1.0 rifampicin
rpoC 762863 c.-507T>C upstream_gene_variant 1.0 rifampicin
rpoC 762866 c.-504C>T upstream_gene_variant 1.0 rifampicin
rpoB 762879 p.Met1025Leu missense_variant 1.0 rifampicin
rpoC 762894 c.-476C>T upstream_gene_variant 1.0 rifampicin
rpoC 762899 c.-471G>C upstream_gene_variant 1.0 rifampicin
rpoC 762917 c.-453C>G upstream_gene_variant 1.0 rifampicin
rpoC 762920 c.-450C>T upstream_gene_variant 1.0 rifampicin
rpoC 762923 c.-447C>G upstream_gene_variant 1.0 rifampicin
rpoC 762929 c.-441G>C upstream_gene_variant 1.0 rifampicin
rpoC 762959 c.-411G>C upstream_gene_variant 1.0 rifampicin
rpoC 762962 c.-408C>T upstream_gene_variant 1.0 rifampicin
rpoC 762995 c.-375G>T upstream_gene_variant 1.0 rifampicin
rpoC 763031 c.-339T>G upstream_gene_variant 1.0 rifampicin
rpoC 763034 c.-336C>G upstream_gene_variant 1.0 rifampicin
rpoC 763040 c.-330C>G upstream_gene_variant 1.0 rifampicin
rpoC 763070 c.-300T>C upstream_gene_variant 0.99 rifampicin
rpoC 763082 c.-288C>T upstream_gene_variant 1.0 rifampicin
rpoC 763088 c.-282C>G upstream_gene_variant 1.0 rifampicin
rpoC 763094 c.-276G>C upstream_gene_variant 1.0 rifampicin
rpoC 763115 c.-255T>C upstream_gene_variant 1.0 rifampicin
rpoC 763127 c.-243G>C upstream_gene_variant 1.0 rifampicin
rpoC 763136 c.-234C>T upstream_gene_variant 1.0 rifampicin
rpoC 763145 c.-225G>A upstream_gene_variant 1.0 rifampicin
rpoC 763157 c.-213G>T upstream_gene_variant 1.0 rifampicin
rpoC 763166 c.-204A>G upstream_gene_variant 1.0 rifampicin
rpoC 763172 c.-198G>C upstream_gene_variant 1.0 rifampicin
rpoC 763193 c.-177C>G upstream_gene_variant 1.0 rifampicin
rpoC 763202 c.-168A>G upstream_gene_variant 1.0 rifampicin
rpoC 763205 c.-165G>C upstream_gene_variant 1.0 rifampicin
rpoB 763207 p.Ser1134Lys missense_variant 1.0 rifampicin
rpoC 763214 c.-156T>C upstream_gene_variant 1.0 rifampicin
rpoC 763217 c.-153G>C upstream_gene_variant 1.0 rifampicin
rpoC 763220 c.-150G>C upstream_gene_variant 1.0 rifampicin
rpoC 763226 c.-144A>G upstream_gene_variant 1.0 rifampicin
rpoB 763227 p.Leu1141Met missense_variant 1.0 rifampicin
rpoB 763235 p.Glu1143Asp missense_variant 1.0 rifampicin
rpoC 763238 c.-132T>C upstream_gene_variant 1.0 rifampicin
rpoB 763241 p.Glu1145Asp missense_variant 1.0 rifampicin
rpoC 763259 c.-111G>C upstream_gene_variant 1.0 rifampicin
rpoC 763262 c.-108C>T upstream_gene_variant 1.0 rifampicin
rpoC 763265 c.-105G>C upstream_gene_variant 1.0 rifampicin
rpoC 763268 c.-102C>G upstream_gene_variant 1.0 rifampicin
rpoC 763283 c.-87T>C upstream_gene_variant 1.0 rifampicin
rpoC 763295 c.-75C>T upstream_gene_variant 1.0 rifampicin
rpoC 763365 c.-5_-4insT upstream_gene_variant 1.0 rifampicin
rpoC 763402 c.33C>T synonymous_variant 1.0 rifampicin
rpoC 763408 c.39T>C synonymous_variant 1.0 rifampicin
rpoC 763411 c.42T>C synonymous_variant 1.0 rifampicin
rpoC 763414 c.45T>G synonymous_variant 1.0 rifampicin
rpoC 763415 p.Thr16Ser missense_variant 1.0 rifampicin
rpoC 763423 p.Glu18Asp missense_variant 1.0 rifampicin Uncertain significance
rpoC 763430 c.61_63delAGGinsCGA synonymous_variant 1.0 rifampicin
rpoC 763433 p.Gln22Asn missense_variant 1.0 rifampicin
rpoC 763443 p.Tyr25Phe missense_variant 1.0 rifampicin
rpoC 763450 c.81G>A synonymous_variant 1.0 rifampicin
rpoC 763456 c.87A>G synonymous_variant 1.0 rifampicin
rpoC 763468 c.99G>C synonymous_variant 1.0 rifampicin
rpoC 763486 c.117T>C synonymous_variant 1.0 rifampicin
rpoC 763492 c.123G>C synonymous_variant 1.0 rifampicin
rpoC 763528 c.159G>A synonymous_variant 1.0 rifampicin
rpoC 763531 c.162G>T synonymous_variant 1.0 rifampicin
rpoC 763546 c.177A>G synonymous_variant 1.0 rifampicin
rpoC 763570 c.201G>C synonymous_variant 1.0 rifampicin
rpoC 763594 c.225C>T synonymous_variant 1.0 rifampicin
rpoC 763633 c.264T>C synonymous_variant 1.0 rifampicin
rpoC 763657 c.288G>A synonymous_variant 1.0 rifampicin
rpoC 763660 c.291T>G synonymous_variant 1.0 rifampicin
rpoC 763666 c.297G>C synonymous_variant 1.0 rifampicin
rpoC 763669 c.300C>G synonymous_variant 0.99 rifampicin
rpoC 763675 c.306C>G synonymous_variant 1.0 rifampicin
rpoC 763696 c.327T>C synonymous_variant 1.0 rifampicin
rpoC 763699 c.330G>T synonymous_variant 0.99 rifampicin
rpoC 763702 c.333C>G synonymous_variant 1.0 rifampicin
rpoC 763708 c.339G>C synonymous_variant 1.0 rifampicin
rpoC 763711 c.342G>C synonymous_variant 1.0 rifampicin
rpoC 763714 c.345G>C synonymous_variant 1.0 rifampicin
rpoC 763717 c.348T>C synonymous_variant 1.0 rifampicin
rpoC 763723 c.354G>C synonymous_variant 1.0 rifampicin
rpoC 763732 c.363C>A synonymous_variant 1.0 rifampicin
rpoC 763741 c.372C>T synonymous_variant 1.0 rifampicin
rpoC 763744 c.375G>C synonymous_variant 1.0 rifampicin
rpoC 763747 c.378G>A synonymous_variant 1.0 rifampicin
rpoC 763765 c.396T>C synonymous_variant 1.0 rifampicin
rpoC 763774 c.405G>C synonymous_variant 1.0 rifampicin
rpoC 763781 p.Ser138Ala missense_variant 1.0 rifampicin
rpoC 763792 p.Glu141Asp missense_variant 1.0 rifampicin
rpoC 763796 p.Met143Leu missense_variant 1.0 rifampicin
rpoC 763801 c.432C>T synonymous_variant 1.0 rifampicin
rpoC 763804 c.435C>T synonymous_variant 1.0 rifampicin
rpoC 763807 c.438T>C synonymous_variant 1.0 rifampicin
rpoC 763816 c.447C>G synonymous_variant 1.0 rifampicin
rpoC 763831 c.462A>G synonymous_variant 1.0 rifampicin
rpoC 763836 p.Ala156Glu missense_variant 1.0 rifampicin
rpoC 763840 c.471G>C synonymous_variant 1.0 rifampicin
rpoC 763844 p.Arg159Lys missense_variant 0.98 rifampicin
rpoC 763857 p.Glu163Ala missense_variant 1.0 rifampicin
rpoC 763861 c.492C>T synonymous_variant 1.0 rifampicin
rpoC 763870 c.501C>T synonymous_variant 1.0 rifampicin
rpoC 763872 p.Gly168Ala missense_variant 1.0 rifampicin
rpoC 763876 p.Glu169Asp missense_variant 1.0 rifampicin
rpoC 763879 c.510A>G synonymous_variant 1.0 rifampicin
rpoC 763888 c.519G>T synonymous_variant 1.0 rifampicin
rpoC 763891 c.522G>C synonymous_variant 1.0 rifampicin
rpoC 763894 c.525A>G synonymous_variant 1.0 rifampicin
rpoC 763900 c.531G>C synonymous_variant 1.0 rifampicin
rpoC 763933 c.564C>T synonymous_variant 1.0 rifampicin
rpoC 763940 p.Ala191Ser missense_variant 1.0 rifampicin
rpoC 763945 c.576T>C synonymous_variant 0.98 rifampicin
rpoC 763947 p.Ala193Val missense_variant 0.98 rifampicin
rpoC 763951 c.582G>C synonymous_variant 1.0 rifampicin
rpoC 763960 c.591T>G synonymous_variant 1.0 rifampicin
rpoC 763969 c.600C>T synonymous_variant 1.0 rifampicin
rpoC 763987 c.618C>T synonymous_variant 1.0 rifampicin
rpoC 763991 p.Ile208Leu missense_variant 1.0 rifampicin
rpoC 763996 c.627T>C synonymous_variant 1.0 rifampicin
rpoC 763999 c.630C>T synonymous_variant 1.0 rifampicin
rpoC 764002 c.633C>G synonymous_variant 1.0 rifampicin
rpoC 764003 p.Ala212Ser missense_variant 1.0 rifampicin
rpoC 764024 c.655_657delTTGinsCTC synonymous_variant 1.0 rifampicin
rpoC 764029 p.Glu220Asp missense_variant 1.0 rifampicin
rpoC 764032 p.Asp221Glu missense_variant 1.0 rifampicin
rpoC 764040 p.Ser224Thr missense_variant 1.0 rifampicin
rpoC 764044 c.675T>C synonymous_variant 1.0 rifampicin
rpoC 764054 c.685C>T synonymous_variant 1.0 rifampicin
rpoC 764059 c.690G>T synonymous_variant 1.0 rifampicin
rpoC 764083 c.714A>G synonymous_variant 1.0 rifampicin
rpoC 764084 p.Asn239Val missense_variant 1.0 rifampicin
rpoC 764095 c.726C>T synonymous_variant 1.0 rifampicin
rpoC 764098 c.729A>G synonymous_variant 1.0 rifampicin
rpoC 764143 c.774G>C synonymous_variant 1.0 rifampicin
rpoC 764147 p.Ser260Ala missense_variant 1.0 rifampicin
rpoC 764150 p.Ile261Val missense_variant 1.0 rifampicin
rpoC 764165 p.Glu266Gln missense_variant 1.0 rifampicin
rpoC 764176 c.807C>T synonymous_variant 1.0 rifampicin
rpoC 764177 p.Ile270Leu missense_variant 1.0 rifampicin
rpoC 764182 c.813C>T synonymous_variant 1.0 rifampicin
rpoC 764188 c.819A>G synonymous_variant 1.0 rifampicin
rpoC 764195 p.Ser276Asn missense_variant 1.0 rifampicin
rpoC 764203 c.834G>C synonymous_variant 1.0 rifampicin
rpoC 764206 p.Asp279Glu missense_variant 1.0 rifampicin
rpoC 764207 p.Val280Thr missense_variant 1.0 rifampicin
rpoC 764215 c.846A>C synonymous_variant 1.0 rifampicin
rpoC 764217 p.Asn283Ser missense_variant 1.0 rifampicin
rpoC 764242 c.873C>T synonymous_variant 1.0 rifampicin
rpoC 764254 c.885G>C synonymous_variant 1.0 rifampicin
rpoC 764266 c.897T>G synonymous_variant 1.0 rifampicin
rpoC 764278 c.909A>G synonymous_variant 1.0 rifampicin
rpoC 764279 p.Gln304Asn missense_variant 1.0 rifampicin
rpoC 764284 c.915G>C synonymous_variant 1.0 rifampicin
rpoC 764285 p.Gly306Thr missense_variant 1.0 rifampicin
rpoC 764293 c.924G>A synonymous_variant 1.0 rifampicin
rpoC 764296 c.927G>C synonymous_variant 1.0 rifampicin
rpoC 764297 p.Met310Gly missense_variant 1.0 rifampicin
rpoC 764311 c.942C>G synonymous_variant 1.0 rifampicin
rpoC 764317 c.948C>G synonymous_variant 1.0 rifampicin
rpoC 764320 c.951C>G synonymous_variant 1.0 rifampicin
rpoC 764332 c.963G>A synonymous_variant 1.0 rifampicin
rpoC 764338 c.969G>A synonymous_variant 1.0 rifampicin
rpoC 764353 c.984G>T synonymous_variant 1.0 rifampicin
rpoC 764365 c.996C>T synonymous_variant 1.0 rifampicin
rpoC 764371 c.1002G>C synonymous_variant 1.0 rifampicin
rpoC 764377 c.1008C>G synonymous_variant 1.0 rifampicin
rpoC 764380 c.1011G>C synonymous_variant 1.0 rifampicin
rpoC 764387 c.1018T>C synonymous_variant 1.0 rifampicin
rpoC 764405 c.1036_1038delAGGinsCGC synonymous_variant 1.0 rifampicin
rpoC 764428 c.1059G>C synonymous_variant 1.0 rifampicin
rpoC 764431 c.1062G>C synonymous_variant 1.0 rifampicin
rpoC 764434 c.1065A>G synonymous_variant 1.0 rifampicin
rpoC 764435 c.1066_1068delAGGinsCGA synonymous_variant 1.0 rifampicin
rpoC 764458 c.1089G>C synonymous_variant 1.0 rifampicin
rpoC 764461 c.1092A>G synonymous_variant 1.0 rifampicin
rpoC 764497 c.1128A>G synonymous_variant 1.0 rifampicin
rpoC 764510 c.1141C>T synonymous_variant 1.0 rifampicin
rpoC 764524 c.1155C>G synonymous_variant 1.0 rifampicin
rpoC 764530 c.1161C>G synonymous_variant 1.0 rifampicin
rpoC 764534 c.1165C>A synonymous_variant 1.0 rifampicin
rpoC 764539 c.1170C>T synonymous_variant 1.0 rifampicin
rpoC 764542 c.1173C>T synonymous_variant 1.0 rifampicin
rpoC 764545 c.1176C>A synonymous_variant 1.0 rifampicin
rpoC 764560 c.1191T>C synonymous_variant 0.99 rifampicin
rpoC 764575 c.1206T>G synonymous_variant 1.0 rifampicin
rpoC 764611 c.1242G>T synonymous_variant 1.0 rifampicin
rpoC 764626 c.1257C>T synonymous_variant 1.0 rifampicin
rpoC 764632 c.1263T>C synonymous_variant 1.0 rifampicin
rpoC 764650 c.1281G>T synonymous_variant 0.99 rifampicin
rpoC 764668 c.1299C>T synonymous_variant 1.0 rifampicin
rpoC 764692 c.1323C>T synonymous_variant 1.0 rifampicin
rpoC 764713 c.1344G>T synonymous_variant 1.0 rifampicin
rpoC 764716 c.1347G>C synonymous_variant 1.0 rifampicin
rpoC 764746 c.1377G>T synonymous_variant 1.0 rifampicin
rpoC 764752 c.1383G>C synonymous_variant 1.0 rifampicin
rpoC 764758 c.1389C>G synonymous_variant 1.0 rifampicin
rpoC 764764 c.1395T>C synonymous_variant 1.0 rifampicin
rpoC 764791 c.1422C>G synonymous_variant 1.0 rifampicin
rpoC 764803 c.1434C>T synonymous_variant 1.0 rifampicin
rpoC 764809 c.1440C>T synonymous_variant 1.0 rifampicin
rpoC 764810 p.Pro481Ala missense_variant 1.0 rifampicin
rpoC 764815 c.1446A>G synonymous_variant 1.0 rifampicin
rpoC 764824 c.1455T>C synonymous_variant 1.0 rifampicin
rpoC 764827 c.1458G>C synonymous_variant 1.0 rifampicin
rpoC 764858 c.1489T>C synonymous_variant 1.0 rifampicin
rpoC 764869 c.1500C>T synonymous_variant 1.0 rifampicin
rpoC 764875 c.1506C>A synonymous_variant 1.0 rifampicin
rpoC 764887 c.1518G>C synonymous_variant 1.0 rifampicin
rpoC 764888 c.1519T>C synonymous_variant 1.0 rifampicin
rpoC 764911 c.1542A>G synonymous_variant 1.0 rifampicin
rpoC 764912 p.Met515Gln missense_variant 1.0 rifampicin
rpoC 764932 c.1563C>A synonymous_variant 1.0 rifampicin
rpoC 764948 c.1579_1581delTTGinsCTC synonymous_variant 1.0 rifampicin
rpoC 764968 c.1599T>C synonymous_variant 1.0 rifampicin
rpoC 765004 c.1635G>C synonymous_variant 1.0 rifampicin
rpoC 765007 c.1638T>G synonymous_variant 1.0 rifampicin
rpoC 765008 c.1639T>C synonymous_variant 1.0 rifampicin
rpoC 765011 c.1642_1644delAGCinsTCG synonymous_variant 0.99 rifampicin
rpoC 765016 c.1647C>G synonymous_variant 1.0 rifampicin
rpoC 765019 c.1650A>G synonymous_variant 1.0 rifampicin
rpoC 765040 c.1671T>C synonymous_variant 1.0 rifampicin
rpoC 765041 c.1672T>C synonymous_variant 1.0 rifampicin
rpoC 765047 c.1678T>C synonymous_variant 1.0 rifampicin
rpoC 765055 c.1686C>G synonymous_variant 1.0 rifampicin
rpoC 765073 c.1704G>C synonymous_variant 1.0 rifampicin
rpoC 765076 c.1707A>G synonymous_variant 1.0 rifampicin
rpoC 765079 c.1710T>G synonymous_variant 1.0 rifampicin
rpoC 765082 c.1713G>C synonymous_variant 1.0 rifampicin
rpoC 765085 c.1716T>C synonymous_variant 1.0 rifampicin
rpoC 765089 c.1720T>C synonymous_variant 1.0 rifampicin
rpoC 765100 c.1731G>C synonymous_variant 1.0 rifampicin
rpoC 765103 c.1734G>T synonymous_variant 1.0 rifampicin
rpoC 765121 c.1752G>T synonymous_variant 1.0 rifampicin
rpoC 765283 c.1914C>G synonymous_variant 1.0 rifampicin
rpoC 765288 p.Leu640Gln missense_variant 1.0 rifampicin
rpoC 765292 c.1923G>T synonymous_variant 1.0 rifampicin
rpoC 765300 p.Val644Ala missense_variant 1.0 rifampicin
rpoC 765305 p.Ile646Val missense_variant 1.0 rifampicin Uncertain significance
rpoC 765319 c.1950A>G synonymous_variant 1.0 rifampicin
rpoC 765323 c.1955_1957delGCC disruptive_inframe_deletion 1.0 rifampicin
rpoC 765328 p.His653Gln missense_variant 1.0 rifampicin Uncertain significance
rpoC 765330 p.Ser654Asn missense_variant 1.0 rifampicin
rpoC 765334 c.1965C>T synonymous_variant 1.0 rifampicin
rpoC 765343 c.1974G>A synonymous_variant 1.0 rifampicin
rpoC 765352 c.1983G>C synonymous_variant 1.0 rifampicin
rpoC 765356 p.Met663Val missense_variant 1.0 rifampicin
rpoC 765370 c.2001G>C synonymous_variant 1.0 rifampicin
rpoC 765379 c.2010G>C synonymous_variant 1.0 rifampicin
rpoC 765382 c.2013G>T synonymous_variant 1.0 rifampicin
rpoC 765383 p.Met672Leu missense_variant 1.0 rifampicin
rpoC 765403 c.2034G>C synonymous_variant 1.0 rifampicin
rpoC 765405 p.Leu679His missense_variant 1.0 rifampicin
rpoC 765409 c.2040T>G synonymous_variant 0.99 rifampicin
rpoC 765421 c.2052C>G synonymous_variant 1.0 rifampicin
rpoC 765449 p.Ala694Ser missense_variant 1.0 rifampicin
rpoC 765454 c.2085C>G synonymous_variant 1.0 rifampicin
rpoC 765469 c.2100G>C synonymous_variant 1.0 rifampicin
rpoC 765478 c.2109T>G synonymous_variant 1.0 rifampicin
rpoC 765480 p.Tyr704Phe missense_variant 1.0 rifampicin
rpoC 765499 c.2130C>G synonymous_variant 1.0 rifampicin
rpoC 765517 c.2148C>G synonymous_variant 1.0 rifampicin
rpoC 765533 p.Tyr722His missense_variant 1.0 rifampicin
rpoC 765544 c.2175C>G synonymous_variant 1.0 rifampicin
rpoC 765547 c.2178C>T synonymous_variant 1.0 rifampicin
rpoC 765548 c.2179_2181delAGCinsTCG synonymous_variant 0.98 rifampicin
rpoC 765553 c.2184C>T synonymous_variant 1.0 rifampicin
rpoC 765556 c.2187G>C synonymous_variant 1.0 rifampicin
rpoC 765562 c.2193G>T synonymous_variant 0.98 rifampicin
rpoC 765591 p.Arg741Gln missense_variant 1.0 rifampicin
rpoC 765596 p.Lys743Ala missense_variant 1.0 rifampicin
rpoC 765607 c.2238C>G synonymous_variant 1.0 rifampicin
rpoC 765612 p.His748Arg missense_variant 1.0 rifampicin
rpoC 765620 p.Glu751Lys missense_variant 1.0 rifampicin
rpoC 765826 c.2457T>C synonymous_variant 1.0 rifampicin
rpoC 765835 c.2466C>T synonymous_variant 1.0 rifampicin
rpoC 765841 c.2472G>T synonymous_variant 1.0 rifampicin
rpoC 765861 p.Phe831Tyr missense_variant 0.98 rifampicin
rpoC 765875 p.Val836Ile missense_variant 1.0 rifampicin
rpoC 765907 c.2538G>T synonymous_variant 1.0 rifampicin
rpoC 765910 c.2541G>C synonymous_variant 1.0 rifampicin
rpoC 765928 c.2559C>G synonymous_variant 1.0 rifampicin
rpoC 765940 c.2571A>T synonymous_variant 1.0 rifampicin
rpoC 765947 c.2578T>C synonymous_variant 1.0 rifampicin
rpoC 765962 c.2593_2595delTTGinsCTT synonymous_variant 1.0 rifampicin
rpoC 765967 c.2598C>T synonymous_variant 1.0 rifampicin
rpoC 765973 c.2604C>G synonymous_variant 1.0 rifampicin
rpoC 765979 c.2610C>G synonymous_variant 1.0 rifampicin
rpoC 765982 c.2613C>T synonymous_variant 1.0 rifampicin
rpoC 765994 c.2625A>T synonymous_variant 1.0 rifampicin
rpoC 766003 c.2634G>C synonymous_variant 1.0 rifampicin
rpoC 766009 c.2640G>C synonymous_variant 1.0 rifampicin
rpoC 766012 c.2643C>G synonymous_variant 1.0 rifampicin
rpoC 766021 c.2652G>C synonymous_variant 1.0 rifampicin
rpoC 766027 c.2658G>C synonymous_variant 1.0 rifampicin
rpoC 766309 c.2940G>C synonymous_variant 1.0 rifampicin
rpoC 766312 c.2943T>C synonymous_variant 1.0 rifampicin
rpoC 766315 c.2946C>G synonymous_variant 1.0 rifampicin
rpoC 766321 c.2952C>G synonymous_variant 1.0 rifampicin
rpoC 766333 c.2964G>T synonymous_variant 1.0 rifampicin
rpoC 766345 c.2976T>C synonymous_variant 1.0 rifampicin
rpoC 766348 c.2979A>G synonymous_variant 1.0 rifampicin
rpoC 766351 c.2982C>G synonymous_variant 1.0 rifampicin
rpoC 766353 p.Val995Ala missense_variant 1.0 rifampicin
rpoC 766369 c.3000C>G synonymous_variant 1.0 rifampicin
rpoC 766375 c.3006C>G synonymous_variant 1.0 rifampicin
rpoC 766381 c.3012C>T synonymous_variant 1.0 rifampicin
rpoC 766384 c.3015A>G synonymous_variant 1.0 rifampicin
rpoC 766390 c.3021C>T synonymous_variant 1.0 rifampicin
rpoC 766393 c.3024C>T synonymous_variant 1.0 rifampicin
rpoC 766408 c.3039C>T synonymous_variant 1.0 rifampicin
rpoC 766435 p.Glu1022Asp missense_variant 1.0 rifampicin
rpoC 766501 c.3132G>C synonymous_variant 1.0 rifampicin
rpoC 766507 c.3138C>T synonymous_variant 1.0 rifampicin
rpoC 766513 c.3144C>T synonymous_variant 1.0 rifampicin
rpoC 766522 c.3153C>A synonymous_variant 1.0 rifampicin
rpoC 766528 c.3159T>G synonymous_variant 1.0 rifampicin
rpoC 766531 c.3162G>C synonymous_variant 1.0 rifampicin
rpoC 766534 c.3165C>G synonymous_variant 1.0 rifampicin
rpoC 766537 c.3168G>A synonymous_variant 1.0 rifampicin
rpoC 766540 p.Asp1057Glu missense_variant 1.0 rifampicin
rpoC 766549 c.3180G>C synonymous_variant 1.0 rifampicin
rpoC 766570 c.3201T>C synonymous_variant 1.0 rifampicin
rpoC 766573 c.3204T>G synonymous_variant 1.0 rifampicin
rpoC 766594 c.3225G>T synonymous_variant 1.0 rifampicin
rpoC 766607 p.Ile1080Leu missense_variant 1.0 rifampicin
rpoC 766618 c.3249G>T synonymous_variant 1.0 rifampicin
rpoC 766624 c.3255G>C synonymous_variant 1.0 rifampicin
rpoC 766630 c.3261G>C synonymous_variant 1.0 rifampicin
rpoC 766633 c.3264G>C synonymous_variant 1.0 rifampicin
rpoC 766642 c.3273C>T synonymous_variant 1.0 rifampicin
rpoC 766645 c.3276A>G synonymous_variant 1.0 rifampicin
rpoC 766651 c.3282T>C synonymous_variant 1.0 rifampicin
rpoC 766657 c.3288A>G synonymous_variant 1.0 rifampicin
rpoC 766837 c.3468G>C synonymous_variant 1.0 rifampicin
rpoC 766843 c.3474T>G synonymous_variant 1.0 rifampicin
rpoC 766846 c.3477C>A synonymous_variant 1.0 rifampicin
rpoC 766858 c.3489C>T synonymous_variant 1.0 rifampicin
rpoC 766861 c.3492G>C synonymous_variant 1.0 rifampicin
rpoC 766867 c.3498C>G synonymous_variant 1.0 rifampicin
rpoC 766876 c.3507C>T synonymous_variant 1.0 rifampicin
rpoC 766883 p.Ser1172Ala missense_variant 1.0 rifampicin Uncertain significance
rpoC 766891 c.3522G>A synonymous_variant 1.0 rifampicin
rpoC 766894 c.3525T>C synonymous_variant 1.0 rifampicin
rpoC 766895 c.3526T>C synonymous_variant 1.0 rifampicin
rpoC 766900 c.3531T>C synonymous_variant 1.0 rifampicin
rpoC 766909 c.3540G>C synonymous_variant 1.0 rifampicin
rpoC 766911 p.Ile1181Thr missense_variant 1.0 rifampicin
rpoC 766915 p.Asp1182Glu missense_variant 1.0 rifampicin
rpoC 766918 c.3549C>T synonymous_variant 1.0 rifampicin
rpoC 766921 c.3552G>C synonymous_variant 1.0 rifampicin
rpoC 766931 p.Ala1188Ser missense_variant 1.0 rifampicin Uncertain significance
rpoC 766942 c.3573C>T synonymous_variant 1.0 rifampicin
rpoC 766945 c.3576A>C synonymous_variant 1.0 rifampicin
rpoC 766963 c.3594T>C synonymous_variant 1.0 rifampicin
rpoC 766996 c.3627C>T synonymous_variant 1.0 rifampicin
rpoC 767002 c.3633G>C synonymous_variant 1.0 rifampicin
rpoC 767008 c.3639G>A synonymous_variant 1.0 rifampicin
rpoC 767023 c.3654C>T synonymous_variant 1.0 rifampicin
rpoC 767044 c.3675G>C synonymous_variant 1.0 rifampicin
rpoC 767080 c.3711G>C synonymous_variant 1.0 rifampicin
rpoC 767095 c.3726C>T synonymous_variant 1.0 rifampicin
rpoC 767098 c.3729T>C synonymous_variant 1.0 rifampicin
rpoC 767104 c.3735C>G synonymous_variant 1.0 rifampicin
rpoC 767107 c.3738C>T synonymous_variant 1.0 rifampicin
rpoC 767119 c.3750A>G synonymous_variant 1.0 rifampicin
rpoC 767125 c.3756G>C synonymous_variant 1.0 rifampicin
rpoC 767134 c.3765C>T synonymous_variant 1.0 rifampicin
rpoC 767138 c.3769C>T synonymous_variant 1.0 rifampicin
rpoC 767149 c.3780C>T synonymous_variant 1.0 rifampicin
rpoC 767158 c.3789T>C synonymous_variant 1.0 rifampicin
rpoC 767179 c.3810C>T synonymous_variant 1.0 rifampicin
rpoC 767180 p.Ala1271Ser missense_variant 1.0 rifampicin
rpoC 767191 c.3822C>G synonymous_variant 1.0 rifampicin
rpoC 767197 c.3828G>A synonymous_variant 1.0 rifampicin
rpoC 767203 c.3834C>G synonymous_variant 1.0 rifampicin
rpoC 767206 c.3837C>G synonymous_variant 1.0 rifampicin
rpoC 767209 c.3840T>C synonymous_variant 1.0 rifampicin
rpoC 767212 c.3843G>C synonymous_variant 1.0 rifampicin
rpoC 767221 c.3852C>G synonymous_variant 1.0 rifampicin
rpoC 767230 c.3861G>C synonymous_variant 1.0 rifampicin
rpoC 767233 c.3864T>C synonymous_variant 1.0 rifampicin
rpoC 767254 c.3885G>C synonymous_variant 1.0 rifampicin
rpoC 767264 p.Ala1299Ser missense_variant 1.0 rifampicin
rpoC 767267 p.Ala1300Asn missense_variant 1.0 rifampicin
rpoC 767281 c.3912C>G synonymous_variant 1.0 rifampicin
rpoC 767284 c.3915C>G synonymous_variant 1.0 rifampicin
rpsL 781559 c.-1G>C upstream_gene_variant 1.0 streptomycin
rpsL 781572 p.Gln5Asn missense_variant 1.0 streptomycin
rpsL 781586 c.27C>T synonymous_variant 1.0 streptomycin
rpsL 781595 c.36T>C synonymous_variant 0.99 streptomycin
rpsL 781608 p.Ser17Ala missense_variant 0.99 streptomycin
rpsL 781616 c.57C>G synonymous_variant 0.99 streptomycin
rpsL 781628 c.69T>C synonymous_variant 0.99 streptomycin
rpsL 781649 c.90T>C synonymous_variant 0.99 streptomycin
rpsL 781655 c.96T>C synonymous_variant 0.99 streptomycin
rpsL 781658 c.99A>C synonymous_variant 0.99 streptomycin
rpsL 781670 c.111G>C synonymous_variant 0.99 streptomycin
rpsL 781706 c.147T>C synonymous_variant 0.99 streptomycin
rpsL 781715 c.156T>G synonymous_variant 0.98 streptomycin
rpsL 781721 c.162C>T synonymous_variant 0.98 streptomycin
rpsL 781725 p.Lys56Arg missense_variant 0.98 streptomycin
rpsL 781728 c.169T>C synonymous_variant 0.98 streptomycin
rpsL 781733 c.174G>C synonymous_variant 0.98 streptomycin
rpsL 781736 c.177T>C synonymous_variant 0.98 streptomycin
rpsL 781737 p.Gln60Ala missense_variant 0.98 streptomycin
rpsL 781742 c.183C>G synonymous_variant 0.98 streptomycin
rpsL 781751 c.192G>C synonymous_variant 0.99 streptomycin
rpsL 781754 c.195G>T synonymous_variant 0.99 streptomycin
rpsL 781760 c.201T>C synonymous_variant 0.99 streptomycin
rpsL 781763 c.204C>G synonymous_variant 0.99 streptomycin
rpsL 781766 c.207C>T synonymous_variant 0.99 streptomycin
rpsL 781772 c.213C>T synonymous_variant 0.99 streptomycin
rpsL 781802 c.243G>C synonymous_variant 1.0 streptomycin
rpsL 781814 c.255C>T synonymous_variant 1.0 streptomycin
rpsL 781817 c.258G>T synonymous_variant 1.0 streptomycin
rpsL 781829 c.270G>C synonymous_variant 1.0 streptomycin
rpsL 781832 c.273T>C synonymous_variant 1.0 streptomycin
rpsL 781859 c.300T>C synonymous_variant 1.0 streptomycin
rpsL 781868 c.309T>C synonymous_variant 1.0 streptomycin
rpsL 781871 c.312G>C synonymous_variant 1.0 streptomycin
rpsL 781877 c.318T>A synonymous_variant 1.0 streptomycin
rpsL 781892 c.333A>G synonymous_variant 1.0 streptomycin
rpsL 781898 c.339A>T synonymous_variant 1.0 streptomycin
rpsL 781907 c.348T>C synonymous_variant 1.0 streptomycin
rpsL 781916 c.357T>C synonymous_variant 1.0 streptomycin
rpsL 781929 p.Gly124Ser missense_variant 1.0 streptomycin Uncertain significance
rpsL 781933 c.374G>A splice_region_variant&stop_retained_variant 1.0 streptomycin
rplC 800612 c.-197A>G upstream_gene_variant 1.0 linezolid
rplC 800618 c.-191T>G upstream_gene_variant 1.0 linezolid
rplC 800621 c.-188G>A upstream_gene_variant 1.0 linezolid
rplC 800633 c.-176T>C upstream_gene_variant 1.0 linezolid
rplC 800639 c.-170C>T upstream_gene_variant 1.0 linezolid
rplC 800645 c.-164C>G upstream_gene_variant 1.0 linezolid
rplC 800648 c.-161A>G upstream_gene_variant 1.0 linezolid Uncertain significance
rplC 800654 c.-155T>C upstream_gene_variant 1.0 linezolid
rplC 800672 c.-137G>C upstream_gene_variant 1.0 linezolid
rplC 800690 c.-119C>T upstream_gene_variant 1.0 linezolid Uncertain significance
rplC 800693 c.-116A>C upstream_gene_variant 1.0 linezolid
rplC 800703 c.-106_-104delTTGinsCTC upstream_gene_variant 1.0 linezolid
rplC 800715 c.-94A>C upstream_gene_variant 1.0 linezolid
rplC 800720 c.-89T>C upstream_gene_variant 1.0 linezolid
rplC 800723 c.-86C>G upstream_gene_variant 1.0 linezolid
rplC 800735 c.-74C>G upstream_gene_variant 1.0 linezolid
rplC 800762 c.-47T>G upstream_gene_variant 1.0 linezolid
rplC 800780 c.-29C>G upstream_gene_variant 1.0 linezolid
rplC 800796 c.-12_-9delTTGG upstream_gene_variant 1.0 linezolid
rplC 800808 c.-1A>C upstream_gene_variant 1.0 linezolid
rplC 800815 c.7C>A synonymous_variant 1.0 linezolid
rplC 800820 c.12G>A synonymous_variant 1.0 linezolid
rplC 800823 c.15C>A synonymous_variant 1.0 linezolid
rplC 800829 c.21C>G synonymous_variant 1.0 linezolid
rplC 800832 c.24T>C synonymous_variant 1.0 linezolid
rplC 800856 c.48A>G synonymous_variant 1.0 linezolid
rplC 800865 p.Glu19Asp missense_variant 1.0 linezolid
rplC 800867 p.Ser20Asn missense_variant 1.0 linezolid
rplC 800872 c.64_66delAGAinsCGG synonymous_variant 0.96 linezolid
rplC 800877 c.69A>T synonymous_variant 1.0 linezolid
rplC 800880 c.72A>C synonymous_variant 1.0 linezolid
rplC 800886 c.78G>A synonymous_variant 1.0 linezolid
rplC 800892 c.84G>C synonymous_variant 1.0 linezolid
rplC 800904 c.96G>C synonymous_variant 1.0 linezolid
rplC 800910 c.102C>T synonymous_variant 1.0 linezolid
rplC 800916 c.108A>G synonymous_variant 1.0 linezolid
rplC 800928 c.120C>G synonymous_variant 1.0 linezolid
rplC 800931 c.123G>C synonymous_variant 1.0 linezolid
rplC 800932 p.Pro42Thr missense_variant 1.0 linezolid
rplC 800937 c.129A>G synonymous_variant 1.0 linezolid
rplC 800939 p.Arg44Gln missense_variant 1.0 linezolid
rplC 800946 c.138T>C synonymous_variant 1.0 linezolid
rplC 800949 c.141T>C synonymous_variant 1.0 linezolid
rplC 800964 c.156G>C synonymous_variant 1.0 linezolid
rplC 800967 c.159C>G synonymous_variant 1.0 linezolid
fbiC 1303647 c.717G>C synonymous_variant 1.0 delamanid
fbiC 1303659 c.729T>C synonymous_variant 1.0 delamanid
fbiC 1303660 p.Val244Thr missense_variant 1.0 delamanid
fbiC 1303668 c.738C>G synonymous_variant 1.0 delamanid
fbiC 1303674 c.744C>G synonymous_variant 1.0 delamanid
fbiC 1303677 c.747C>T synonymous_variant 1.0 delamanid
fbiC 1303686 c.756C>G synonymous_variant 1.0 delamanid
fbiC 1303689 c.759T>C synonymous_variant 1.0 delamanid
fbiC 1303695 c.765T>C synonymous_variant 1.0 delamanid
fbiC 1303701 c.771C>G synonymous_variant 1.0 delamanid
fbiC 1303704 c.774T>C synonymous_variant 1.0 delamanid
fbiC 1303713 c.783C>G synonymous_variant 1.0 delamanid
fbiC 1303727 p.Thr266Asn missense_variant 1.0 delamanid
fbiC 1303731 c.801A>G synonymous_variant 1.0 delamanid
fbiC 1303732 p.Ser268Thr missense_variant 1.0 delamanid
fbiC 1303746 p.Asp272Glu missense_variant 1.0 delamanid
fbiC 1303750 p.Leu274Ile missense_variant 1.0 delamanid
fbiC 1303761 c.831T>C synonymous_variant 1.0 delamanid
fbiC 1303768 p.Ser280Val missense_variant 1.0 delamanid
atpE 1461080 c.36C>T synonymous_variant 1.0 bedaquiline
atpE 1461086 c.42A>G synonymous_variant 1.0 bedaquiline
atpE 1461087 c.43C>T synonymous_variant 1.0 bedaquiline
atpE 1461101 c.57T>A synonymous_variant 0.99 bedaquiline
atpE 1461113 c.69C>T synonymous_variant 1.0 bedaquiline
atpE 1461132 p.Val30Ile missense_variant 1.0 bedaquiline
atpE 1461146 c.102G>T synonymous_variant 1.0 bedaquiline
atpE 1461149 c.105T>G synonymous_variant 1.0 bedaquiline
atpE 1461161 c.117C>G synonymous_variant 1.0 bedaquiline
atpE 1461164 c.120C>T synonymous_variant 1.0 bedaquiline
atpE 1461167 c.123G>T synonymous_variant 1.0 bedaquiline
atpE 1461170 c.126A>G synonymous_variant 1.0 bedaquiline
atpE 1461179 c.135G>T synonymous_variant 1.0 bedaquiline
atpE 1461182 c.138A>G synonymous_variant 1.0 bedaquiline
atpE 1461185 c.141G>C synonymous_variant 1.0 bedaquiline
atpE 1461197 c.153A>C synonymous_variant 1.0 bedaquiline
atpE 1461219 c.175T>C synonymous_variant 1.0 bedaquiline
atpE 1461230 c.186G>T synonymous_variant 0.99 bedaquiline
atpE 1461233 c.189A>G synonymous_variant 1.0 bedaquiline
atpE 1461251 c.207G>C synonymous_variant 1.0 bedaquiline
atpE 1461254 c.210T>C synonymous_variant 1.0 bedaquiline
atpE 1461261 c.217C>T synonymous_variant 1.0 bedaquiline
atpE 1461275 c.231T>G synonymous_variant 1.0 bedaquiline
rrs 1471922 n.78delT non_coding_transcript_exon_variant 0.98 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1471925 n.80T>C non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1471931 n.87delA non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1471934 n.89A>G non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin Uncertain significance
rrs 1471985 n.140T>C non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1471986 n.141C>T non_coding_transcript_exon_variant 1.0 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin Uncertain significance
rrs 1472030 n.185G>A non_coding_transcript_exon_variant 0.98 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472031 n.186G>C non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472032 n.187G>A non_coding_transcript_exon_variant 0.98 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin Uncertain significance
rrs 1472033 n.188A>C non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472035 n.190G>T non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472040 n.195T>G non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472041 n.196C>T non_coding_transcript_exon_variant 1.0 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin Uncertain significance
rrs 1472042 n.197T>G non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472043 n.198T>A non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472050 n.205G>C non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472053 n.211_212delGC non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472061 n.216A>T non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472106 n.261G>A non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472108 n.263C>T non_coding_transcript_exon_variant 1.0 linezolid
kanamycin Uncertain significance
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472113 n.268T>C non_coding_transcript_exon_variant 1.0 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin Uncertain significance
rrs 1472150 n.305T>A non_coding_transcript_exon_variant 1.0 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472251 n.406G>A non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472286 n.441C>G non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472287 n.442C>T non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472289 n.444T>G non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472290 n.445C>G non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472297 n.453_465delGTCCGGGTTCTCT non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472315 n.470T>G non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472324 n.479G>C non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472325 n.480G>C non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472327 n.482G>A non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472328 n.483G>C non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472337 n.492C>G non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472380 n.535G>C non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472446 n.601T>A non_coding_transcript_exon_variant 0.99 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472452 n.607G>A non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472464 n.619A>G non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472612 n.767G>T non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472734 n.889C>T non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472741 n.896G>A non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472846 n.1001C>T non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472847 n.1002G>A non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472848 n.1003T>C non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472860 n.1015C>T non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472861 n.1016G>A non_coding_transcript_exon_variant 1.0 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472956 n.1111T>C non_coding_transcript_exon_variant 1.0 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472957 n.1112C>T non_coding_transcript_exon_variant 1.0 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin Uncertain significance
rrs 1472969 n.1124A>G non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472970 n.1125C>G non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472977 n.1132G>C non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472978 n.1133T>C non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472989 n.1144G>A non_coding_transcript_exon_variant 1.0 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472990 n.1145A>G non_coding_transcript_exon_variant 1.0 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1473082 n.1237G>A non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1473088 n.1243A>G non_coding_transcript_exon_variant 1.0 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1473099 n.1254T>A non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1473104 n.1259C>T non_coding_transcript_exon_variant 1.0 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1473105 n.1260G>A non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1473110 n.1265T>G non_coding_transcript_exon_variant 1.0 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1473111 n.1266A>G non_coding_transcript_exon_variant 1.0 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1473121 n.1276T>C non_coding_transcript_exon_variant 0.99 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1473123 n.1278A>T non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1473129 n.1284C>T non_coding_transcript_exon_variant 0.99 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1473145 n.1300C>T non_coding_transcript_exon_variant 1.0 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1473166 n.1321G>A non_coding_transcript_exon_variant 1.0 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1473288 n.1443C>T non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1473290 n.1445C>T non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1473291 n.1446G>T non_coding_transcript_exon_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrl 1473684 n.27G>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473699 n.43delG non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473707 n.50T>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473717 n.60G>A non_coding_transcript_exon_variant 1.0 linezolid Uncertain significance
rrl 1473731 n.74T>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473746 n.89T>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473756 n.99G>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473758 n.101G>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473770 n.113T>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473806 n.149C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473812 n.155G>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473814 n.157A>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473815 n.158T>G non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473829 n.172G>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473831 n.174G>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473832 n.175C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473839 n.182G>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473876 n.219G>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473887 n.230T>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473888 n.231T>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473898 n.241C>T non_coding_transcript_exon_variant 1.0 linezolid Uncertain significance
rrl 1473899 n.242A>G non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473916 n.259C>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473923 n.266C>G non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473924 n.267_268insT non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473937 n.280C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473943 n.286G>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473945 n.288T>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473946 n.289A>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1473950 n.293G>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474030 n.373G>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474044 n.387C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474051 n.394T>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474054 n.397T>C non_coding_transcript_exon_variant 1.0 linezolid Uncertain significance
rrl 1474056 n.399T>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474061 n.404T>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474074 n.417C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474089 n.432C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474093 n.436G>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474100 n.443C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474103 n.446A>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474107 n.449_450insCT non_coding_transcript_exon_variant 0.99 linezolid
rrl 1474109 n.453_454delAT non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474130 n.473C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474140 n.483C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474151 n.494C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474181 n.524_525insT non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474184 n.527C>A non_coding_transcript_exon_variant 0.98 linezolid
rrl 1474185 n.529delA non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474249 n.592G>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474263 n.606G>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474282 n.625G>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474308 n.651G>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474310 n.653T>G non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474356 n.699T>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474362 n.705A>G non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474387 n.730C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474413 n.756A>C non_coding_transcript_exon_variant 0.99 linezolid
rrl 1474415 n.759_781delCACACGCGCATACGCGCGTGTGA non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474496 n.839C>G non_coding_transcript_exon_variant 0.99 linezolid
rrl 1474497 n.840G>C non_coding_transcript_exon_variant 0.99 linezolid
rrl 1474506 n.849C>G non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474507 n.850G>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474626 n.969T>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474632 n.975G>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474636 n.979A>T non_coding_transcript_exon_variant 0.99 linezolid
rrl 1474637 n.980C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474638 n.981C>G non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474639 n.982G>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474640 n.983C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474717 n.1060A>G non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474722 n.1065T>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474743 n.1086T>G non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474760 n.1103A>G non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474794 n.1137C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474803 n.1146G>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474812 n.1155G>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474830 n.1173A>G non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474913 n.1256T>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1474932 n.1275C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475031 n.1374G>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475061 n.1406delA non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475076 n.1419C>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475090 n.1433A>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475114 n.1457C>T non_coding_transcript_exon_variant 1.0 linezolid Uncertain significance
rrl 1475120 n.1463G>T non_coding_transcript_exon_variant 0.99 linezolid
rrl 1475129 n.1472G>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475202 n.1545G>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475209 n.1552G>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475213 n.1556C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475220 n.1563G>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475429 n.1772G>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475443 n.1786G>A non_coding_transcript_exon_variant 0.98 linezolid
rrl 1475452 n.1795C>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475475 n.1818C>T non_coding_transcript_exon_variant 0.99 linezolid
rrl 1475479 n.1822C>T non_coding_transcript_exon_variant 1.0 linezolid Uncertain significance
rrl 1475480 n.1823A>T non_coding_transcript_exon_variant 0.99 linezolid
rrl 1475505 n.1848G>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475526 n.1869C>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475531 n.1874C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475573 n.1916G>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475649 n.1992A>G non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475659 n.2002G>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475760 n.2105_2106delGC non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475764 n.2107A>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1475765 n.2108A>T non_coding_transcript_exon_variant 0.99 linezolid
rrl 1475975 n.2318C>T non_coding_transcript_exon_variant 0.99 linezolid
rrl 1475977 n.2320A>G non_coding_transcript_exon_variant 0.99 linezolid
rrl 1475988 n.2331A>G non_coding_transcript_exon_variant 0.98 linezolid Uncertain significance
rrl 1475989 n.2332T>C non_coding_transcript_exon_variant 0.98 linezolid
rrl 1475993 n.2336C>T non_coding_transcript_exon_variant 0.98 linezolid Uncertain significance
rrl 1475997 n.2340A>T non_coding_transcript_exon_variant 0.99 linezolid
rrl 1476030 n.2373A>G non_coding_transcript_exon_variant 0.93 linezolid
rrl 1476032 n.2375C>A non_coding_transcript_exon_variant 0.91 linezolid
rrl 1476033 n.2376T>G non_coding_transcript_exon_variant 0.91 linezolid
rrl 1476034 n.2377C>G non_coding_transcript_exon_variant 0.91 linezolid
rrl 1476035 n.2378G>C non_coding_transcript_exon_variant 0.91 linezolid
rrl 1476044 n.2387T>G non_coding_transcript_exon_variant 0.83 linezolid
rrl 1476045 n.2388G>T non_coding_transcript_exon_variant 0.83 linezolid
rrl 1476046 n.2389G>T non_coding_transcript_exon_variant 0.83 linezolid
rrl 1476047 n.2390G>T non_coding_transcript_exon_variant 0.83 linezolid
rrl 1476049 n.2392C>T non_coding_transcript_exon_variant 0.85 linezolid
rrl 1476056 n.2399G>A non_coding_transcript_exon_variant 0.95 linezolid Uncertain significance
rrl 1476058 n.2401T>C non_coding_transcript_exon_variant 0.96 linezolid
rrl 1476085 n.2428G>A non_coding_transcript_exon_variant 0.98 linezolid
rrl 1476086 n.2429G>A non_coding_transcript_exon_variant 0.98 linezolid
rrl 1476088 n.2431A>C non_coding_transcript_exon_variant 0.98 linezolid
rrl 1476099 n.2442A>G non_coding_transcript_exon_variant 0.98 linezolid
rrl 1476103 n.2446C>G non_coding_transcript_exon_variant 0.98 linezolid
rrl 1476105 n.2448G>A non_coding_transcript_exon_variant 0.98 linezolid
rrl 1476106 n.2449A>T non_coding_transcript_exon_variant 0.98 linezolid
rrl 1476110 n.2453G>C non_coding_transcript_exon_variant 0.98 linezolid
rrl 1476114 n.2457T>C non_coding_transcript_exon_variant 0.98 linezolid Uncertain significance
rrl 1476115 n.2458T>C non_coding_transcript_exon_variant 0.98 linezolid
rrl 1476131 n.2474C>T non_coding_transcript_exon_variant 0.99 linezolid
rrl 1476160 n.2503T>C non_coding_transcript_exon_variant 0.99 linezolid
rrl 1476214 n.2557G>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1476215 n.2558C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1476221 n.2564T>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1476224 n.2567A>G non_coding_transcript_exon_variant 1.0 linezolid
rrl 1476251 n.2594T>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1476281 n.2624T>C non_coding_transcript_exon_variant 1.0 linezolid
rrl 1476297 n.2640C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1476299 n.2642C>T non_coding_transcript_exon_variant 1.0 linezolid Uncertain significance
rrl 1476584 n.2927C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1476594 n.2937C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1476597 n.2940G>A non_coding_transcript_exon_variant 0.99 linezolid
rrl 1476603 n.2946G>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1476608 n.2951C>G non_coding_transcript_exon_variant 1.0 linezolid
rrl 1476619 n.2962C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1476628 n.2971T>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1476665 n.3008T>A non_coding_transcript_exon_variant 1.0 linezolid
rrl 1476666 n.3009C>T non_coding_transcript_exon_variant 1.0 linezolid
rrl 1476674 n.3017T>C non_coding_transcript_exon_variant 1.0 linezolid Uncertain significance
rrl 1476684 n.3027C>T non_coding_transcript_exon_variant 1.0 linezolid
inhA 1674855 c.654C>G synonymous_variant 1.0 ethionamide
isoniazid
inhA 1674858 c.657G>A synonymous_variant 1.0 ethionamide
isoniazid
inhA 1674876 c.675C>T synonymous_variant 1.0 ethionamide
isoniazid
inhA 1674879 c.678T>C synonymous_variant 1.0 ethionamide
isoniazid
inhA 1674892 p.Asn231Asp missense_variant 1.0 ethionamide
isoniazid
inhA 1674903 c.702T>C synonymous_variant 1.0 ethionamide
isoniazid
inhA 1674904 p.Ala235Pro missense_variant 1.0 ethionamide
isoniazid
inhA 1674909 c.708G>A synonymous_variant 1.0 ethionamide
isoniazid
inhA 1674912 c.711G>C synonymous_variant 1.0 ethionamide
isoniazid
inhA 1674915 c.714C>G synonymous_variant 1.0 ethionamide
isoniazid
inhA 1674942 c.741T>C synonymous_variant 1.0 ethionamide
isoniazid
inhA 1674949 c.748C>T synonymous_variant 1.0 ethionamide
isoniazid
inhA 1674954 c.753G>C synonymous_variant 1.0 ethionamide
isoniazid
inhA 1674957 c.756G>C synonymous_variant 1.0 ethionamide
isoniazid
inhA 1674963 c.762G>C synonymous_variant 1.0 ethionamide
isoniazid
inhA 1674966 c.765T>C synonymous_variant 1.0 ethionamide
isoniazid
inhA 1674975 c.774C>T synonymous_variant 1.0 ethionamide
isoniazid
inhA 1674977 p.Tyr259Phe missense_variant 1.0 ethionamide
isoniazid
inhA 1674993 c.792G>T synonymous_variant 1.0 ethionamide
isoniazid
rpsA 1833511 c.-31G>T upstream_gene_variant 1.0 pyrazinamide
rpsA 1833514 c.-28C>A upstream_gene_variant 1.0 pyrazinamide
rpsA 1833517 c.-24delC upstream_gene_variant 1.0 pyrazinamide
rpsA 1833536 c.-6A>C upstream_gene_variant 1.0 pyrazinamide
rpsA 1833547 c.6G>A synonymous_variant 1.0 pyrazinamide
rpsA 1833589 c.48A>C synonymous_variant 1.0 pyrazinamide
rpsA 1833595 c.54T>G synonymous_variant 1.0 pyrazinamide
rpsA 1833596 p.Ser19Ala missense_variant 1.0 pyrazinamide
rpsA 1833604 c.63C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833616 c.75A>T synonymous_variant 1.0 pyrazinamide
rpsA 1833619 c.78A>C synonymous_variant 1.0 pyrazinamide
rpsA 1833625 c.84A>G synonymous_variant 1.0 pyrazinamide
rpsA 1833664 c.123C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833676 c.135A>G synonymous_variant 1.0 pyrazinamide
rpsA 1833679 c.138G>T synonymous_variant 1.0 pyrazinamide
rpsA 1833685 c.144G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833691 c.150G>A synonymous_variant 1.0 pyrazinamide
rpsA 1833694 c.153G>T synonymous_variant 1.0 pyrazinamide
rpsA 1833697 c.156C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833700 c.159C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833709 c.168C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833724 c.183C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833727 c.186G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833733 c.192C>G synonymous_variant 0.98 pyrazinamide
rpsA 1833734 p.Ala65Ser missense_variant 1.0 pyrazinamide
rpsA 1833742 c.201A>G synonymous_variant 1.0 pyrazinamide
rpsA 1833745 c.204G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833748 c.207C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833760 c.219C>T synonymous_variant 1.0 pyrazinamide
rpsA 1833787 c.246C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833790 c.249T>C synonymous_variant 1.0 pyrazinamide
rpsA 1833802 c.261A>G synonymous_variant 1.0 pyrazinamide
rpsA 1833811 c.270G>T synonymous_variant 1.0 pyrazinamide
rpsA 1833823 c.282G>A synonymous_variant 1.0 pyrazinamide
rpsA 1833832 c.291G>A synonymous_variant 1.0 pyrazinamide
rpsA 1833838 c.297G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833841 c.300C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833847 c.306C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833856 c.315A>G synonymous_variant 1.0 pyrazinamide
rpsA 1833862 c.321G>T synonymous_variant 1.0 pyrazinamide
rpsA 1833874 c.333T>G synonymous_variant 1.0 pyrazinamide
rpsA 1833886 c.345C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833894 p.Ala118Glu missense_variant 1.0 pyrazinamide
rpsA 1833928 c.387G>C synonymous_variant 1.0 pyrazinamide
rpsA 1833949 c.408T>C synonymous_variant 1.0 pyrazinamide
rpsA 1833961 c.420C>G synonymous_variant 1.0 pyrazinamide
rpsA 1833970 c.429G>T synonymous_variant 1.0 pyrazinamide
rpsA 1833979 c.438T>C synonymous_variant 1.0 pyrazinamide
rpsA 1833991 c.450C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834000 c.459G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834009 c.468C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834012 c.471G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834015 c.474G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834021 c.480C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834030 c.489C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834033 c.492C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834073 p.Lys178Arg missense_variant 1.0 pyrazinamide
rpsA 1834096 c.555G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834099 c.558C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834108 c.567C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834114 c.573G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834177 c.636A>C synonymous_variant 1.0 pyrazinamide
rpsA 1834228 c.687C>A synonymous_variant 1.0 pyrazinamide
rpsA 1834231 c.690T>G synonymous_variant 1.0 pyrazinamide
rpsA 1834234 c.693G>T synonymous_variant 1.0 pyrazinamide
rpsA 1834240 c.699T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834246 c.705G>T synonymous_variant 1.0 pyrazinamide
rpsA 1834249 c.708T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834252 c.711C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834261 c.720A>G synonymous_variant 1.0 pyrazinamide
rpsA 1834264 c.723G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834279 c.738C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834294 c.753G>T synonymous_variant 1.0 pyrazinamide
rpsA 1834297 c.756C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834303 c.762T>G synonymous_variant 1.0 pyrazinamide
rpsA 1834306 c.765T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834327 c.786G>T synonymous_variant 1.0 pyrazinamide
rpsA 1834357 c.816T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834366 c.825A>G synonymous_variant 1.0 pyrazinamide
rpsA 1834375 c.834G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834396 c.855G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834411 c.870T>G synonymous_variant 1.0 pyrazinamide
rpsA 1834414 c.873C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834417 c.876G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834420 c.879C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834423 c.882G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834429 c.888C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834438 c.897C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834451 c.910T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834456 c.915T>G synonymous_variant 1.0 pyrazinamide
rpsA 1834468 c.927A>G synonymous_variant 1.0 pyrazinamide
rpsA 1834477 c.936C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834489 c.948T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834519 c.978G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834520 p.Ala327Ser missense_variant 1.0 pyrazinamide
rpsA 1834528 c.987T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834534 c.993C>T synonymous_variant 0.99 pyrazinamide
rpsA 1834543 c.1002C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834546 c.1005T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834552 c.1011G>T synonymous_variant 1.0 pyrazinamide
rpsA 1834555 c.1014T>G synonymous_variant 1.0 pyrazinamide
rpsA 1834557 p.Ala339Gly missense_variant 1.0 pyrazinamide
rpsA 1834606 c.1065C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834609 c.1068T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834619 c.1078T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834622 c.1081_1083delTCGinsAGC synonymous_variant 1.0 pyrazinamide
rpsA 1834633 c.1092A>G synonymous_variant 1.0 pyrazinamide
rpsA 1834639 c.1098T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834645 c.1104C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834666 c.1125G>C synonymous_variant 1.0 pyrazinamide
rpsA 1834667 p.Ala376Ser missense_variant 1.0 pyrazinamide
rpsA 1834690 c.1149T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834700 p.Gln387Ala missense_variant 0.99 pyrazinamide
rpsA 1834705 c.1164C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834720 c.1179C>G synonymous_variant 1.0 pyrazinamide
rpsA 1834732 c.1191T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834738 c.1197A>G synonymous_variant 1.0 pyrazinamide
rpsA 1834753 c.1212T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834759 c.1218A>C synonymous_variant 1.0 pyrazinamide
rpsA 1834765 p.Glu408Asp missense_variant 1.0 pyrazinamide
rpsA 1834774 c.1233C>T synonymous_variant 1.0 pyrazinamide
rpsA 1834776 p.Ala412Glu missense_variant 1.0 pyrazinamide
rpsA 1834780 c.1239A>G synonymous_variant 1.0 pyrazinamide
rpsA 1834789 c.1248T>C synonymous_variant 1.0 pyrazinamide
rpsA 1834813 c.1272G>T synonymous_variant 1.0 pyrazinamide
rpsA 1834830 p.Ala430Val missense_variant 1.0 pyrazinamide
kasA 2517917 c.-198G>C upstream_gene_variant 1.0 isoniazid
kasA 2517941 c.-174C>G upstream_gene_variant 1.0 isoniazid
kasA 2517953 c.-162C>T upstream_gene_variant 1.0 isoniazid
kasA 2517962 c.-153C>G upstream_gene_variant 1.0 isoniazid
kasA 2517968 c.-147T>A upstream_gene_variant 1.0 isoniazid
kasA 2517974 c.-141T>C upstream_gene_variant 1.0 isoniazid
kasA 2517989 c.-126T>C upstream_gene_variant 1.0 isoniazid
kasA 2517992 c.-123C>G upstream_gene_variant 1.0 isoniazid
kasA 2517993 c.-122_-121delGCinsAA upstream_gene_variant 1.0 isoniazid
kasA 2518002 c.-113C>G upstream_gene_variant 1.0 isoniazid
kasA 2518723 c.609G>A synonymous_variant 1.0 isoniazid
kasA 2518726 c.612G>C synonymous_variant 1.0 isoniazid
kasA 2518738 c.624G>C synonymous_variant 1.0 isoniazid
kasA 2518756 c.642G>C synonymous_variant 1.0 isoniazid
kasA 2518768 c.654C>G synonymous_variant 1.0 isoniazid
kasA 2518771 c.657C>G synonymous_variant 1.0 isoniazid
kasA 2518774 c.660C>T synonymous_variant 1.0 isoniazid
kasA 2518783 c.669T>G synonymous_variant 1.0 isoniazid
kasA 2518787 p.Arg225Lys missense_variant 1.0 isoniazid
kasA 2518792 c.678C>T synonymous_variant 1.0 isoniazid
kasA 2518795 c.681C>T synonymous_variant 1.0 isoniazid
kasA 2518798 c.684G>C synonymous_variant 1.0 isoniazid
kasA 2518822 c.708C>A synonymous_variant 1.0 isoniazid
kasA 2518825 c.711T>C synonymous_variant 1.0 isoniazid
kasA 2518846 c.732G>T synonymous_variant 1.0 isoniazid
kasA 2518849 c.735G>C synonymous_variant 1.0 isoniazid
kasA 2518853 p.Leu247Val missense_variant 1.0 isoniazid
kasA 2518864 c.750G>C synonymous_variant 1.0 isoniazid
kasA 2518879 c.765A>G synonymous_variant 1.0 isoniazid
ahpC 2726576 c.384C>T synonymous_variant 1.0 isoniazid
ahpC 2726593 p.Val134Ala missense_variant 1.0 isoniazid
ahpC 2726600 c.408T>C synonymous_variant 1.0 isoniazid
ahpC 2726613 p.Asn141Asp missense_variant 1.0 isoniazid
ahpC 2726619 p.Glu143Ile missense_variant 1.0 isoniazid
ahpC 2726624 c.432C>T synonymous_variant 1.0 isoniazid
ahpC 2726636 c.444G>C synonymous_variant 1.0 isoniazid
ahpC 2726638 p.Ala149Val missense_variant 1.0 isoniazid
ahpC 2726642 c.450C>G synonymous_variant 1.0 isoniazid
ahpC 2726645 c.453C>A synonymous_variant 1.0 isoniazid
ahpC 2726651 c.459G>C synonymous_variant 1.0 isoniazid
ahpC 2726657 c.465A>C synonymous_variant 1.0 isoniazid
ahpC 2726666 c.474C>G synonymous_variant 1.0 isoniazid
ahpC 2726669 c.477T>C synonymous_variant 1.0 isoniazid
ahpC 2726675 c.483A>G synonymous_variant 1.0 isoniazid
ahpC 2726678 c.486G>C synonymous_variant 1.0 isoniazid
ahpC 2726681 c.489A>C synonymous_variant 1.0 isoniazid
ahpC 2726687 c.495C>T synonymous_variant 1.0 isoniazid
ahpC 2726693 c.501C>G synonymous_variant 1.0 isoniazid
ahpC 2726696 c.504C>G synonymous_variant 1.0 isoniazid
ahpC 2726717 c.525A>C synonymous_variant 1.0 isoniazid
thyA 3073902 c.570C>A synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3073905 c.567C>G synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3073925 c.547T>C synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3073926 c.546G>A synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3073929 c.543T>C synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3073950 c.522G>C synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3073953 c.519T>G synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3073956 c.516G>C synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3073959 c.513T>C synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3073962 c.510G>A synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3073965 c.507C>T synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3073980 c.492C>T synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3073983 c.489C>G synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3073989 c.483T>C synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3073992 c.480C>T synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3073999 p.Arg158Lys missense_variant 1.0 para-aminosalicylic_acid
thyA 3074004 c.468T>C synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3074010 c.462C>G synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3074013 c.459C>T synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3074028 c.444G>C synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3074031 c.441T>C synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3074034 c.438T>C synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3074053 p.Arg140Gln missense_variant 1.0 para-aminosalicylic_acid
thyA 3074056 p.Glu139Pro missense_variant 1.0 para-aminosalicylic_acid
thyA 3074070 c.402C>T synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3074076 c.396C>A synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3074082 c.390G>T synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3074089 p.Ile128Asn missense_variant 1.0 para-aminosalicylic_acid
thyA 3074091 c.381C>G synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3074094 c.378G>C synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3074097 c.375C>G synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3074103 c.369C>G synonymous_variant 1.0 para-aminosalicylic_acid
thyA 3074108 p.Asp122Asn missense_variant 0.97 para-aminosalicylic_acid
thyA 3074112 c.360C>T synonymous_variant 0.97 para-aminosalicylic_acid
thyA 3074120 c.352T>C synonymous_variant 0.97 para-aminosalicylic_acid
thyA 3074127 c.345G>A synonymous_variant 0.97 para-aminosalicylic_acid
thyA 3074130 c.342G>C synonymous_variant 0.97 para-aminosalicylic_acid
rpoA 3877542 c.966C>A synonymous_variant 1.0 rifampicin
rpoA 3877545 c.963G>T synonymous_variant 1.0 rifampicin
rpoA 3877554 c.954G>A synonymous_variant 1.0 rifampicin
rpoA 3877560 c.948C>T synonymous_variant 1.0 rifampicin
rpoA 3877563 c.945C>T synonymous_variant 1.0 rifampicin
rpoA 3877569 p.Pro313Thr missense_variant 1.0 rifampicin
rpoA 3877587 c.921A>G synonymous_variant 1.0 rifampicin
rpoA 3877593 c.915C>T synonymous_variant 1.0 rifampicin
rpoA 3877614 c.894G>A synonymous_variant 1.0 rifampicin
rpoA 3877620 c.888G>A synonymous_variant 1.0 rifampicin
rpoA 3877638 c.870T>C synonymous_variant 1.0 rifampicin
rpoA 3877656 c.852T>G synonymous_variant 1.0 rifampicin
rpoA 3877665 c.843C>G synonymous_variant 1.0 rifampicin
rpoA 3877677 c.831G>C synonymous_variant 1.0 rifampicin
rpoA 3877680 c.828G>C synonymous_variant 1.0 rifampicin
rpoA 3877686 c.822A>G synonymous_variant 1.0 rifampicin
rpoA 3877692 c.816G>C synonymous_variant 1.0 rifampicin
rpoA 3877704 c.804G>T synonymous_variant 0.99 rifampicin
rpoA 3877728 c.780C>G synonymous_variant 1.0 rifampicin
rpoA 3877731 c.777G>C synonymous_variant 1.0 rifampicin
rpoA 3877734 c.774G>C synonymous_variant 1.0 rifampicin
rpoA 3877737 c.771G>C synonymous_variant 1.0 rifampicin
rpoA 3877743 c.765T>C synonymous_variant 1.0 rifampicin
rpoA 3877749 c.759C>T synonymous_variant 1.0 rifampicin
rpoA 3877752 p.Asp252Glu missense_variant 1.0 rifampicin
rpoA 3877755 c.753C>T synonymous_variant 0.99 rifampicin
rpoA 3877758 c.750G>C synonymous_variant 1.0 rifampicin
rpoA 3877764 c.744C>A synonymous_variant 1.0 rifampicin
rpoA 3877770 c.738A>G synonymous_variant 1.0 rifampicin
rpoA 3877773 c.735G>C synonymous_variant 1.0 rifampicin
rpoA 3877776 c.732T>C synonymous_variant 1.0 rifampicin
rpoA 3877782 c.726T>C synonymous_variant 1.0 rifampicin
rpoA 3877797 c.711G>A synonymous_variant 1.0 rifampicin
rpoA 3877815 c.693C>T synonymous_variant 0.99 rifampicin
rpoA 3877818 c.690A>G synonymous_variant 1.0 rifampicin
rpoA 3877836 c.672A>G synonymous_variant 1.0 rifampicin
rpoA 3877839 c.669G>A synonymous_variant 1.0 rifampicin
rpoA 3877848 c.660C>T synonymous_variant 1.0 rifampicin
rpoA 3877856 c.652T>C synonymous_variant 1.0 rifampicin
rpoA 3877875 c.633T>C synonymous_variant 1.0 rifampicin
rpoA 3877896 c.612G>A synonymous_variant 0.99 rifampicin
rpoA 3877905 c.603A>G synonymous_variant 1.0 rifampicin
rpoA 3877908 c.600T>C synonymous_variant 1.0 rifampicin
rpoA 3877920 c.588G>C synonymous_variant 1.0 rifampicin
rpoA 3877923 c.585C>T synonymous_variant 1.0 rifampicin
rpoA 3877929 p.Ile193Val missense_variant 1.0 rifampicin
rpoA 3877962 c.546G>T synonymous_variant 1.0 rifampicin
rpoA 3877971 p.Asp179Glu missense_variant 1.0 rifampicin
rpoA 3877974 c.534G>T synonymous_variant 1.0 rifampicin
rpoA 3877977 p.Lys177Asn missense_variant 1.0 rifampicin
rpoA 3877989 c.519A>G synonymous_variant 1.0 rifampicin
rpoA 3878001 c.507A>G synonymous_variant 1.0 rifampicin
rpoA 3878019 c.489A>C synonymous_variant 1.0 rifampicin
rpoA 3878022 c.486T>C synonymous_variant 1.0 rifampicin
rpoA 3878025 c.483C>T synonymous_variant 1.0 rifampicin
rpoA 3878028 c.480G>T synonymous_variant 1.0 rifampicin
rpoA 3878031 c.477T>C synonymous_variant 1.0 rifampicin
rpoA 3878034 c.474A>G synonymous_variant 1.0 rifampicin
rpoA 3878046 c.462T>C synonymous_variant 1.0 rifampicin
rpoA 3878050 p.Arg153Lys missense_variant 0.99 rifampicin
rpoA 3878055 c.453A>G synonymous_variant 1.0 rifampicin
rpoA 3878061 c.447G>C synonymous_variant 1.0 rifampicin
rpoA 3878070 c.438T>C synonymous_variant 1.0 rifampicin
rpoA 3878073 c.435C>T synonymous_variant 1.0 rifampicin
rpoA 3878079 c.429C>T synonymous_variant 1.0 rifampicin
rpoA 3878091 c.417C>T synonymous_variant 1.0 rifampicin
rpoA 3878102 p.Val136Ile missense_variant 1.0 rifampicin
rpoA 3878103 c.405A>G synonymous_variant 1.0 rifampicin
rpoA 3878118 c.390T>C synonymous_variant 1.0 rifampicin
rpoA 3878130 c.378C>G synonymous_variant 1.0 rifampicin
rpoA 3878142 p.Gly122Asp missense_variant 1.0 rifampicin Uncertain significance
rpoA 3878160 c.348C>G synonymous_variant 1.0 rifampicin
rpoA 3878163 c.345C>T synonymous_variant 1.0 rifampicin
rpoA 3878169 c.339G>C synonymous_variant 1.0 rifampicin
rpoA 3878184 c.324C>T synonymous_variant 1.0 rifampicin
rpoA 3878193 c.315T>C synonymous_variant 1.0 rifampicin
rpoA 3878196 p.Glu104Ala missense_variant 1.0 rifampicin
rpoA 3878205 c.303T>C synonymous_variant 1.0 rifampicin
rpoA 3878217 c.291A>G synonymous_variant 1.0 rifampicin
rpoA 3878259 c.249G>C synonymous_variant 1.0 rifampicin
rpoA 3878271 c.237T>C synonymous_variant 1.0 rifampicin
rpoA 3878283 p.Glu75Asp missense_variant 1.0 rifampicin Uncertain significance
rpoA 3878292 c.216T>C synonymous_variant 1.0 rifampicin
rpoA 3878298 c.210A>G synonymous_variant 1.0 rifampicin
rpoA 3878301 c.207C>G synonymous_variant 1.0 rifampicin
rpoA 3878310 c.198G>T synonymous_variant 1.0 rifampicin
rpoA 3878313 c.195G>C synonymous_variant 1.0 rifampicin
rpoA 3878322 c.186A>G synonymous_variant 1.0 rifampicin
rpoA 3878331 c.177A>G synonymous_variant 1.0 rifampicin
rpoA 3878337 c.171T>C synonymous_variant 1.0 rifampicin
rpoA 3878343 c.165C>T synonymous_variant 1.0 rifampicin
rpoA 3878346 c.162T>C synonymous_variant 1.0 rifampicin
rpoA 3878364 c.144A>C synonymous_variant 1.0 rifampicin
rpoA 3878367 c.141C>G synonymous_variant 1.0 rifampicin
rpoA 3878370 c.138T>C synonymous_variant 1.0 rifampicin
rpoA 3878373 c.135G>C synonymous_variant 1.0 rifampicin
rpoA 3878381 c.127C>T synonymous_variant 1.0 rifampicin
rpoA 3878391 c.117T>G synonymous_variant 1.0 rifampicin
rpoA 3878400 c.108T>C synonymous_variant 1.0 rifampicin
rpoA 3878433 c.75G>C synonymous_variant 1.0 rifampicin
rpoA 3878436 c.72A>G synonymous_variant 1.0 rifampicin
rpoA 3878442 c.66G>C synonymous_variant 1.0 rifampicin
rpoA 3878672 c.-165A>T upstream_gene_variant 1.0 rifampicin
rpoA 3878694 c.-187A>G upstream_gene_variant 1.0 rifampicin
rpoA 3878695 c.-188C>G upstream_gene_variant 1.0 rifampicin
rpoA 3878698 c.-191A>G upstream_gene_variant 1.0 rifampicin
rpoA 3878701 c.-194C>G upstream_gene_variant 1.0 rifampicin
clpC1 4038310 p.Val799Leu missense_variant 1.0 pyrazinamide
clpC1 4038313 p.Gln798Glu missense_variant 1.0 pyrazinamide
clpC1 4038314 c.2391T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038317 c.2388G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038320 c.2385G>T synonymous_variant 1.0 pyrazinamide
clpC1 4038329 p.Glu792Asn missense_variant 1.0 pyrazinamide
clpC1 4038338 c.2367C>T synonymous_variant 1.0 pyrazinamide
clpC1 4038353 p.Gln784Ala missense_variant 1.0 pyrazinamide
clpC1 4038356 c.2349T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038359 c.2346A>G synonymous_variant 1.0 pyrazinamide
clpC1 4038368 c.2337T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038374 c.2331C>T synonymous_variant 1.0 pyrazinamide
clpC1 4038380 c.2325C>G synonymous_variant 1.0 pyrazinamide
clpC1 4038383 c.2322G>T synonymous_variant 1.0 pyrazinamide
clpC1 4038388 c.2317T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038398 c.2307G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038403 c.2302T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038410 c.2295C>T synonymous_variant 1.0 pyrazinamide
clpC1 4038416 c.2289C>A synonymous_variant 1.0 pyrazinamide
clpC1 4038419 c.2286T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038519 p.Arg729Glu missense_variant 1.0 pyrazinamide
clpC1 4038529 p.Glu726Gln missense_variant 1.0 pyrazinamide
clpC1 4038530 c.2175G>A synonymous_variant 1.0 pyrazinamide
clpC1 4038533 p.Arg724Gln missense_variant 1.0 pyrazinamide
clpC1 4038536 c.2169C>G synonymous_variant 1.0 pyrazinamide
clpC1 4038545 p.His720Glu missense_variant 1.0 pyrazinamide
clpC1 4038563 c.2142C>T synonymous_variant 1.0 pyrazinamide
clpC1 4038584 c.2121G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038587 c.2118C>T synonymous_variant 1.0 pyrazinamide
clpC1 4038596 c.2109A>G synonymous_variant 1.0 pyrazinamide
clpC1 4038602 c.2103G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038613 p.Asn698His missense_variant 1.0 pyrazinamide
clpC1 4038623 c.2082A>G synonymous_variant 1.0 pyrazinamide
clpC1 4038704 c.2001T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038707 c.1998C>G synonymous_variant 1.0 pyrazinamide
clpC1 4038710 c.1995G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038713 c.1992T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038737 c.1968C>T synonymous_variant 1.0 pyrazinamide
clpC1 4038740 c.1965G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038749 c.1956C>A synonymous_variant 1.0 pyrazinamide
clpC1 4038755 c.1950G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038767 c.1938G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038770 c.1935C>T synonymous_variant 1.0 pyrazinamide
clpC1 4038773 c.1932T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038782 c.1923G>T synonymous_variant 1.0 pyrazinamide
clpC1 4038790 c.1915C>T synonymous_variant 1.0 pyrazinamide
clpC1 4038795 p.Ser637Thr missense_variant 1.0 pyrazinamide
clpC1 4038812 c.1893T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038815 c.1890G>T synonymous_variant 1.0 pyrazinamide
clpC1 4038838 c.1867C>T synonymous_variant 1.0 pyrazinamide
clpC1 4038845 c.1858_1860delTCGinsAGC synonymous_variant 1.0 pyrazinamide
clpC1 4038860 c.1845G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038878 c.1827A>G synonymous_variant 1.0 pyrazinamide
clpC1 4038908 c.1797C>G synonymous_variant 0.99 pyrazinamide
clpC1 4038911 c.1794G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038914 c.1791G>T synonymous_variant 1.0 pyrazinamide
clpC1 4038923 c.1782A>T synonymous_variant 1.0 pyrazinamide
clpC1 4038928 c.1777C>A synonymous_variant 0.99 pyrazinamide
clpC1 4038929 c.1776G>A synonymous_variant 1.0 pyrazinamide
clpC1 4038932 c.1773G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038941 c.1764G>C synonymous_variant 1.0 pyrazinamide
clpC1 4038953 c.1752A>G synonymous_variant 1.0 pyrazinamide
clpC1 4038956 c.1749T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038965 c.1740T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038971 c.1734T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038974 c.1731T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038989 c.1716T>C synonymous_variant 1.0 pyrazinamide
clpC1 4038997 c.1708T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039007 c.1698G>A synonymous_variant 0.99 pyrazinamide
clpC1 4039022 c.1683A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039046 c.1659C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039070 c.1635G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039077 p.Lys543Arg missense_variant 1.0 pyrazinamide
clpC1 4039079 c.1626C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039085 c.1620A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039091 c.1614G>T synonymous_variant 1.0 pyrazinamide
clpC1 4039097 c.1608G>T synonymous_variant 1.0 pyrazinamide
clpC1 4039103 c.1602T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039106 c.1599G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039121 c.1584T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039124 c.1581C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039142 c.1563A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039145 c.1560G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039169 p.Glu512Asp missense_variant 1.0 pyrazinamide
clpC1 4039172 c.1533A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039178 c.1527G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039183 c.1522T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039190 c.1515C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039196 c.1509G>A synonymous_variant 1.0 pyrazinamide
clpC1 4039199 p.Ala502Glu missense_variant 0.98 pyrazinamide
clpC1 4039208 c.1497C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039220 c.1485G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039262 c.1443C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039265 c.1440C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039271 c.1434G>A synonymous_variant 1.0 pyrazinamide
clpC1 4039283 c.1422C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039286 c.1417_1419delCTTinsTTA synonymous_variant 0.99 pyrazinamide
clpC1 4039289 c.1416T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039292 c.1413C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039304 c.1401G>A synonymous_variant 1.0 pyrazinamide
clpC1 4039316 p.Glu463Asp missense_variant 1.0 pyrazinamide
clpC1 4039319 c.1386T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039328 c.1377A>C synonymous_variant 1.0 pyrazinamide
clpC1 4039331 c.1374C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039337 p.Thr456Gln missense_variant 1.0 pyrazinamide
clpC1 4039346 p.Arg453Ser missense_variant 1.0 pyrazinamide
clpC1 4039360 p.Ser449Arg missense_variant 1.0 pyrazinamide
clpC1 4039361 c.1344C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039382 c.1323C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039391 c.1314T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039409 c.1296T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039412 c.1293T>G synonymous_variant 1.0 pyrazinamide
clpC1 4039415 p.Glu430Asp missense_variant 1.0 pyrazinamide Uncertain significance
clpC1 4039418 c.1287C>G synonymous_variant 0.99 pyrazinamide
clpC1 4039430 c.1275T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039442 c.1263A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039454 c.1251A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039466 c.1239T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039469 c.1236T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039472 c.1233G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039478 c.1227G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039481 c.1224T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039487 c.1218G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039522 c.1183C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039528 c.1177C>A synonymous_variant 1.0 pyrazinamide
clpC1 4039532 c.1173C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039541 c.1164C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039544 c.1161C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039559 c.1146C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039565 c.1140G>T synonymous_variant 1.0 pyrazinamide
clpC1 4039570 p.Met379Leu missense_variant 1.0 pyrazinamide
clpC1 4039571 c.1134G>A synonymous_variant 1.0 pyrazinamide
clpC1 4039574 p.Ala377Gly missense_variant 1.0 pyrazinamide
clpC1 4039586 c.1119G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039601 c.1104G>A synonymous_variant 1.0 pyrazinamide
clpC1 4039610 c.1095G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039616 c.1089G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039619 c.1086G>A synonymous_variant 1.0 pyrazinamide
clpC1 4039622 c.1083C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039649 c.1056G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039661 c.1044T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039682 c.1023C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039694 c.1011G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039724 c.981A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039733 c.972G>A synonymous_variant 1.0 pyrazinamide
clpC1 4039739 c.966C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039742 c.963C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039748 c.957G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039751 c.954A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039757 c.948A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039760 c.945T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039763 c.942C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039769 c.936C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039778 c.927A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039793 c.912C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039814 c.891C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039817 c.888A>C synonymous_variant 1.0 pyrazinamide
clpC1 4039820 c.885T>G synonymous_variant 1.0 pyrazinamide
clpC1 4039826 c.879C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039831 c.874T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039832 c.873C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039850 c.855T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039868 c.837C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039913 c.792C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039931 c.774T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039934 c.771G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039943 c.762G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039946 c.759A>G synonymous_variant 1.0 pyrazinamide
clpC1 4039952 c.753T>C synonymous_variant 1.0 pyrazinamide
clpC1 4039957 c.748C>T synonymous_variant 1.0 pyrazinamide
clpC1 4039958 c.747G>C synonymous_variant 1.0 pyrazinamide
clpC1 4039964 c.741C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039975 p.Asp244Asn missense_variant 1.0 pyrazinamide
clpC1 4039979 c.726C>G synonymous_variant 1.0 pyrazinamide
clpC1 4039982 c.723G>A synonymous_variant 1.0 pyrazinamide
clpC1 4040009 c.696C>G synonymous_variant 1.0 pyrazinamide
clpC1 4040015 c.690G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040021 c.684A>T synonymous_variant 1.0 pyrazinamide
clpC1 4040024 c.681A>G synonymous_variant 1.0 pyrazinamide
clpC1 4040033 c.672G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040048 c.657C>T synonymous_variant 1.0 pyrazinamide
clpC1 4040087 c.618G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040090 c.613_615delTCTinsAGC synonymous_variant 1.0 pyrazinamide
clpC1 4040093 c.612C>G synonymous_variant 1.0 pyrazinamide
clpC1 4040126 c.579C>T synonymous_variant 0.99 pyrazinamide
clpC1 4040141 c.564C>T synonymous_variant 1.0 pyrazinamide
clpC1 4040144 c.561G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040147 c.558A>G synonymous_variant 1.0 pyrazinamide
clpC1 4040153 c.552A>G synonymous_variant 1.0 pyrazinamide
clpC1 4040159 c.546G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040162 c.543G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040168 c.537G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040171 c.534C>G synonymous_variant 1.0 pyrazinamide
clpC1 4040174 c.531C>T synonymous_variant 1.0 pyrazinamide
clpC1 4040200 c.505T>C synonymous_variant 1.0 pyrazinamide
clpC1 4040201 c.504C>G synonymous_variant 1.0 pyrazinamide
clpC1 4040291 c.414G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040300 c.405C>T synonymous_variant 1.0 pyrazinamide
clpC1 4040309 c.396C>T synonymous_variant 1.0 pyrazinamide
clpC1 4040333 c.372G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040342 c.363C>A synonymous_variant 1.0 pyrazinamide
clpC1 4040348 c.357G>T synonymous_variant 1.0 pyrazinamide
clpC1 4040354 c.351A>G synonymous_variant 1.0 pyrazinamide
clpC1 4040357 c.348T>C synonymous_variant 1.0 pyrazinamide
clpC1 4040363 c.342A>C synonymous_variant 1.0 pyrazinamide
clpC1 4040366 c.339C>T synonymous_variant 1.0 pyrazinamide
clpC1 4040369 c.336C>G synonymous_variant 1.0 pyrazinamide
clpC1 4040375 c.330G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040380 c.325T>C synonymous_variant 1.0 pyrazinamide
clpC1 4040381 c.324T>C synonymous_variant 1.0 pyrazinamide
clpC1 4040387 c.318A>G synonymous_variant 1.0 pyrazinamide
clpC1 4040393 c.312G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040411 c.294T>C synonymous_variant 1.0 pyrazinamide
clpC1 4040423 c.282A>G synonymous_variant 1.0 pyrazinamide
clpC1 4040426 c.279T>C synonymous_variant 1.0 pyrazinamide
clpC1 4040431 c.274T>C synonymous_variant 1.0 pyrazinamide
clpC1 4040441 c.264C>G synonymous_variant 1.0 pyrazinamide
clpC1 4040444 c.261C>G synonymous_variant 1.0 pyrazinamide
clpC1 4040450 c.255A>G synonymous_variant 1.0 pyrazinamide
clpC1 4040456 c.249C>T synonymous_variant 1.0 pyrazinamide
clpC1 4040459 c.246C>G synonymous_variant 1.0 pyrazinamide
clpC1 4040462 c.243C>T synonymous_variant 1.0 pyrazinamide
clpC1 4040465 c.240T>C synonymous_variant 1.0 pyrazinamide
clpC1 4040480 c.225T>C synonymous_variant 1.0 pyrazinamide
clpC1 4040495 c.210C>T synonymous_variant 0.99 pyrazinamide
clpC1 4040522 c.183T>C synonymous_variant 1.0 pyrazinamide
clpC1 4040531 c.174T>G synonymous_variant 1.0 pyrazinamide
clpC1 4040546 c.159G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040558 c.147G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040561 c.144A>G synonymous_variant 1.0 pyrazinamide
clpC1 4040573 c.132T>C synonymous_variant 0.99 pyrazinamide
clpC1 4040579 c.126A>G synonymous_variant 1.0 pyrazinamide
clpC1 4040582 c.123G>C synonymous_variant 1.0 pyrazinamide
clpC1 4040585 c.120A>G synonymous_variant 1.0 pyrazinamide
clpC1 4040597 c.108C>T synonymous_variant 1.0 pyrazinamide
clpC1 4040600 c.103_105delTTAinsCTG synonymous_variant 1.0 pyrazinamide
clpC1 4040603 c.102T>G synonymous_variant 1.0 pyrazinamide
clpC1 4040606 c.99T>C synonymous_variant 1.0 pyrazinamide
clpC1 4040642 c.61_63delAGGinsCGC synonymous_variant 1.0 pyrazinamide
clpC1 4040654 c.51G>A synonymous_variant 1.0 pyrazinamide
clpC1 4040657 c.48T>C synonymous_variant 1.0 pyrazinamide
panD 4044114 p.Val56Glu missense_variant 1.0 pyrazinamide
panD 4044120 c.162A>G synonymous_variant 1.0 pyrazinamide
panD 4044123 c.159T>C synonymous_variant 1.0 pyrazinamide