TB-Profiler result

Run: fb652162-5f81-4fa0-8ca0-e0811d6ffc75

Summary

Run ID: fb652162-5f81-4fa0-8ca0-e0811d6ffc75

Sample name:

Date: 04-08-2023 20:26:02

Number of reads: 2047700

Percentage reads mapped: 18.64

Median coverage: 43

Strain: lineage2.2

Spoligotype:

Drug-resistance: Pre-XDR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage2.2 East-Asian (Beijing) RD105;RD207 0.95
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.Ser450Leu Assoc w R
isoniazid fabG1 c.-15C>T Assoc w R
katG p.Ser315Thr Assoc w R
ethambutol embA c.-11C>A Uncertain significance
embB p.Met306Val Assoc w R
pyrazinamide pncA p.Leu27Pro Assoc w R
moxifloxacin gyrA p.Asp94Gly Assoc w R
levofloxacin gyrA p.Asp94Gly Assoc w R
bedaquiline
delamanid
pretomanid
linezolid
streptomycin rpsL p.Lys43Arg Assoc w R
amikacin
kanamycin
capreomycin
clofazimine
ethionamide fabG1 c.-15C>T Assoc w R
para-aminosalicylic_acid
cycloserine
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
gyrA 7582 p.Asp94Gly missense_variant 0.98 ofloxacin Uncertain significance
moxifloxacin Assoc w R
levofloxacin Assoc w R
fluoroquinolones Uncertain significance
ciprofloxacin Uncertain significance
rpoB 761155 p.Ser450Leu missense_variant 0.27 rifampicin Assoc w R
rpsL 781687 p.Lys43Arg missense_variant 0.28 streptomycin Assoc w R
fabG1 1673425 c.-15C>T upstream_gene_variant 1.0 isoniazid Assoc w R
ethionamide Assoc w R
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid Assoc w R
pncA 2289162 p.Leu27Pro missense_variant 1.0 pyrazinamide Assoc w R
embA 4243222 c.-11C>A upstream_gene_variant 0.96 ethambutol Uncertain significance
embB 4247429 p.Met306Val missense_variant 0.9 ethambutol Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrB 6100 c.861G>A synonymous_variant 0.15 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6115 c.876A>G synonymous_variant 0.14 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6121 c.882C>T synonymous_variant 0.15 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6127 c.888G>C synonymous_variant 0.15 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6133 c.894G>C synonymous_variant 0.16 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6136 c.897G>A synonymous_variant 0.16 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6151 c.912C>T synonymous_variant 0.18 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6172 c.933C>T synonymous_variant 0.15 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6184 c.945C>T synonymous_variant 0.12 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6193 c.954G>A synonymous_variant 0.11 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6196 c.957C>T synonymous_variant 0.12 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6202 c.963C>T synonymous_variant 0.12 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6203 p.Ser322Ala missense_variant 0.12 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6214 c.975G>C synonymous_variant 0.12 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6223 c.984G>C synonymous_variant 0.15 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6229 c.990G>A synonymous_variant 0.11 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6595 c.-707G>A upstream_gene_variant 0.12 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6598 c.-704C>G upstream_gene_variant 0.25 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6610 c.-692C>G upstream_gene_variant 0.37 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6613 c.-689A>G upstream_gene_variant 0.36 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6616 c.-686A>G upstream_gene_variant 0.38 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6634 c.-668T>C upstream_gene_variant 0.56 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6637 c.-665T>G upstream_gene_variant 0.56 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6640 c.-662A>C upstream_gene_variant 0.55 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6643 c.-659A>G upstream_gene_variant 0.55 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6646 c.-656C>T upstream_gene_variant 0.55 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6655 c.-647T>C upstream_gene_variant 0.62 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6673 c.-629A>C upstream_gene_variant 0.73 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6676 c.-626T>G upstream_gene_variant 0.74 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6700 c.-602T>C upstream_gene_variant 0.77 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6703 c.-599G>C upstream_gene_variant 0.77 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6706 c.-596G>A upstream_gene_variant 0.76 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6709 c.-593A>G upstream_gene_variant 0.77 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6712 c.-590G>C upstream_gene_variant 0.77 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6727 c.-575G>T upstream_gene_variant 0.77 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6728 c.-574_-572delCTAinsTTG upstream_gene_variant 0.77 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6745 c.-557T>C upstream_gene_variant 0.79 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6754 c.-548C>T upstream_gene_variant 0.8 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6763 c.-539G>C upstream_gene_variant 0.8 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6772 c.-530C>G upstream_gene_variant 0.79 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6775 c.-527G>C upstream_gene_variant 0.79 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6793 c.-509T>C upstream_gene_variant 0.78 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6798 p.Gly520Ala missense_variant 0.77 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 6808 c.-494C>G upstream_gene_variant 0.74 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6824 c.-478C>T upstream_gene_variant 0.67 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6841 c.-461T>C upstream_gene_variant 0.62 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6862 c.-440C>G upstream_gene_variant 0.58 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6869 c.-433T>C upstream_gene_variant 0.5 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6872 c.-430_-428delTTGinsCTT upstream_gene_variant 0.47 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6878 c.-424T>C upstream_gene_variant 0.47 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6889 c.-413G>A upstream_gene_variant 0.43 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6898 c.-404G>T upstream_gene_variant 0.34 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6982 c.-320A>G upstream_gene_variant 0.16 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6985 c.-317C>T upstream_gene_variant 0.16 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6988 c.-314C>G upstream_gene_variant 0.16 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7006 c.-296T>G upstream_gene_variant 0.19 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 7010 p.Leu591Met missense_variant 0.22 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7015 c.-287G>A upstream_gene_variant 0.2 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7018 c.-284G>C upstream_gene_variant 0.21 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7024 c.-278G>C upstream_gene_variant 0.24 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7033 c.-269G>C upstream_gene_variant 0.35 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 7051 p.Glu604Asp missense_variant 0.5 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7060 c.-242T>C upstream_gene_variant 0.54 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7066 c.-236G>T upstream_gene_variant 0.54 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7078 c.-224A>G upstream_gene_variant 0.57 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7081 c.-221T>C upstream_gene_variant 0.57 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7084 c.-218A>G upstream_gene_variant 0.59 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7090 c.-212C>T upstream_gene_variant 0.59 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7093 c.-209T>C upstream_gene_variant 0.59 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7100 c.-202T>C upstream_gene_variant 0.61 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7123 c.-179C>G upstream_gene_variant 0.6 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7126 c.-176G>C upstream_gene_variant 0.6 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7129 c.-173T>G upstream_gene_variant 0.59 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7132 c.-170T>C upstream_gene_variant 0.58 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7135 c.-167G>A upstream_gene_variant 0.59 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7136 c.-166T>C upstream_gene_variant 0.6 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7141 c.-161T>G upstream_gene_variant 0.58 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7144 c.-158A>G upstream_gene_variant 0.59 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7150 c.-152G>A upstream_gene_variant 0.6 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7153 c.-149G>C upstream_gene_variant 0.6 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7168 c.-134C>G upstream_gene_variant 0.6 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7178 c.-124T>C upstream_gene_variant 0.53 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7186 c.-116C>G upstream_gene_variant 0.5 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7189 c.-113C>T upstream_gene_variant 0.48 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7198 c.-104C>T upstream_gene_variant 0.43 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 7210 p.Asp657Glu missense_variant 0.29 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7213 c.-89G>A upstream_gene_variant 0.29 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7216 c.-86G>C upstream_gene_variant 0.29 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7225 c.-77T>C upstream_gene_variant 0.22 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7234 c.-68C>A upstream_gene_variant 0.13 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7355 c.54T>A synonymous_variant 0.1 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7362 p.Glu21Gln missense_variant 1.0 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7391 c.90C>T synonymous_variant 0.38 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7394 c.93T>C synonymous_variant 0.39 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7397 c.96G>C synonymous_variant 0.38 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7403 c.102C>T synonymous_variant 0.35 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7412 c.111C>G synonymous_variant 0.36 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7421 c.120G>C synonymous_variant 0.34 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7424 c.123G>C synonymous_variant 0.36 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7427 c.126G>C synonymous_variant 0.35 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7433 c.132G>C synonymous_variant 0.35 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7439 c.138C>T synonymous_variant 0.36 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7442 c.141G>C synonymous_variant 0.33 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7451 c.150C>A synonymous_variant 0.35 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7457 c.156T>C synonymous_variant 0.3 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7463 c.162G>C synonymous_variant 0.3 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7466 c.165G>C synonymous_variant 0.29 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7469 c.168C>G synonymous_variant 0.28 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7472 c.171T>C synonymous_variant 0.3 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7475 c.174A>G synonymous_variant 0.31 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7480 p.Phe60Tyr missense_variant 0.31 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7484 c.183T>C synonymous_variant 0.42 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7499 c.198G>C synonymous_variant 0.54 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7511 c.210C>T synonymous_variant 0.62 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7523 c.222C>G synonymous_variant 0.57 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7526 c.225G>C synonymous_variant 0.57 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7547 c.246C>T synonymous_variant 0.59 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7553 c.252C>T synonymous_variant 0.59 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7559 c.258G>C synonymous_variant 0.56 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7565 c.264C>T synonymous_variant 0.57 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7574 c.273G>C synonymous_variant 0.6 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7585 p.Ser95Thr missense_variant 1.0 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7589 c.288G>C synonymous_variant 0.59 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7595 c.294C>T synonymous_variant 0.59 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7607 c.306C>T synonymous_variant 0.62 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7637 c.336C>A synonymous_variant 0.62 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7655 c.354G>A synonymous_variant 0.47 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7658 c.357A>G synonymous_variant 0.43 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7661 c.360C>T synonymous_variant 0.41 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7664 c.363T>C synonymous_variant 0.41 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7670 c.369A>G synonymous_variant 0.5 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7671 p.Pro124Ala missense_variant 0.48 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7676 c.375G>C synonymous_variant 0.5 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7679 c.378G>C synonymous_variant 0.5 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7683 c.382_384delAGGinsCGT synonymous_variant 0.5 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7694 c.393A>G synonymous_variant 0.52 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7697 c.396C>T synonymous_variant 0.5 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7703 c.402G>C synonymous_variant 0.47 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7706 c.405C>G synonymous_variant 0.44 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7710 c.409T>C synonymous_variant 0.46 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7715 c.414G>C synonymous_variant 0.42 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7725 c.424C>T synonymous_variant 0.39 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7728 c.427_429delAGGinsCGT synonymous_variant 0.39 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7739 c.438C>T synonymous_variant 0.47 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7745 c.444G>A synonymous_variant 0.53 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7760 c.459C>T synonymous_variant 0.64 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7763 c.462T>G synonymous_variant 0.61 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7778 c.477G>C synonymous_variant 0.51 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7781 c.480G>C synonymous_variant 0.51 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7782 p.Gln161Met missense_variant 0.53 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7797 c.496_498delCTAinsTTG synonymous_variant 0.54 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7802 c.501C>G synonymous_variant 0.54 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7811 c.510C>T synonymous_variant 0.51 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7814 c.513C>G synonymous_variant 0.5 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7832 c.531G>T synonymous_variant 0.5 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7835 c.534A>G synonymous_variant 0.51 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7841 c.540C>T synonymous_variant 0.53 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7847 c.546G>C synonymous_variant 0.55 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7853 c.552C>T synonymous_variant 0.55 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7859 c.558A>C synonymous_variant 0.55 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7865 c.564T>C synonymous_variant 0.54 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7868 p.Ile189Met missense_variant 0.53 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7890 c.589C>T synonymous_variant 0.4 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7898 p.Asp199Glu missense_variant 0.22 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7901 c.600G>C synonymous_variant 0.1 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7906 p.Phe202Tyr missense_variant 0.1 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8121 c.820T>C synonymous_variant 0.18 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8129 c.828T>C synonymous_variant 0.2 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8156 c.855T>C synonymous_variant 0.17 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8159 c.858G>C synonymous_variant 0.17 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8168 c.867A>G synonymous_variant 0.16 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8174 c.873C>G synonymous_variant 0.1 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8177 c.876A>C synonymous_variant 0.11 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8327 c.1026C>T synonymous_variant 0.14 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8330 c.1029C>G synonymous_variant 0.14 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8571 c.1270C>T synonymous_variant 0.14 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8576 c.1275C>G synonymous_variant 0.15 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8580 p.Ile427Val missense_variant 0.16 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 8585 c.1284C>T synonymous_variant 0.17 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8603 c.1302A>C synonymous_variant 0.21 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8609 c.1308G>C synonymous_variant 0.21 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8619 c.1318T>C synonymous_variant 0.24 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8624 c.1323G>T synonymous_variant 0.21 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8633 c.1332C>G synonymous_variant 0.23 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8636 c.1335A>C synonymous_variant 0.22 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8642 c.1341A>G synonymous_variant 0.21 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8645 c.1344C>G synonymous_variant 0.22 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8649 p.Arg450Lys missense_variant 0.22 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8666 c.1365G>C synonymous_variant 0.28 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8672 c.1371A>G synonymous_variant 0.29 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8693 c.1392T>C synonymous_variant 0.22 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8696 c.1395G>C synonymous_variant 0.17 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8699 c.1398A>G synonymous_variant 0.14 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8783 c.1482G>C synonymous_variant 0.23 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8786 c.1485T>G synonymous_variant 0.27 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8792 c.1491G>C synonymous_variant 0.3 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8799 p.Ala500Ser missense_variant 0.31 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8804 c.1503C>G synonymous_variant 0.3 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8810 c.1509A>G synonymous_variant 0.32 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8817 p.Ser506Ala missense_variant 0.35 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8828 c.1527T>C synonymous_variant 0.35 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8829 c.1528_1530delTTGinsCTC synonymous_variant 0.35 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8837 c.1536C>G synonymous_variant 0.45 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8840 c.1539C>T synonymous_variant 0.48 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8852 c.1551T>C synonymous_variant 0.51 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8858 c.1557T>C synonymous_variant 0.56 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8870 c.1569G>C synonymous_variant 0.6 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8873 c.1572A>G synonymous_variant 0.61 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8897 c.1596T>C synonymous_variant 0.68 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8903 c.1602T>C synonymous_variant 0.71 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8915 c.1614A>G synonymous_variant 0.71 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8921 c.1620C>T synonymous_variant 0.69 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8942 c.1641G>C synonymous_variant 0.69 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8945 c.1644G>C synonymous_variant 0.68 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8946 c.1645T>C synonymous_variant 0.68 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8957 c.1656C>T synonymous_variant 0.72 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8967 p.Ala556Lys missense_variant 0.7 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8978 c.1677C>T synonymous_variant 0.7 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8987 c.1686C>G synonymous_variant 0.67 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8990 c.1689C>G synonymous_variant 0.67 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8993 c.1692C>T synonymous_variant 0.65 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8996 c.1695T>C synonymous_variant 0.64 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8998 p.Leu566Trp missense_variant 0.65 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9018 p.Gln573Lys missense_variant 0.59 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9023 c.1722A>C synonymous_variant 0.57 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9026 c.1725G>C synonymous_variant 0.54 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9029 c.1728T>C synonymous_variant 0.55 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9035 c.1734G>C synonymous_variant 0.54 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9044 c.1743C>G synonymous_variant 0.49 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9047 c.1746C>T synonymous_variant 0.49 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9062 c.1761C>T synonymous_variant 0.42 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9063 p.Ser588Ala missense_variant 0.42 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9068 c.1767G>C synonymous_variant 0.43 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9071 c.1770G>C synonymous_variant 0.43 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9080 c.1779G>C synonymous_variant 0.4 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9089 c.1788G>C synonymous_variant 0.37 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9095 c.1794C>T synonymous_variant 0.36 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9099 c.1798_1800delTTAinsCTG synonymous_variant 0.33 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9113 c.1812C>G synonymous_variant 0.22 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9116 c.1815G>A synonymous_variant 0.12 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9304 p.Gly668Asp missense_variant 0.96 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
fgd1 490941 c.159C>T synonymous_variant 0.12 delamanid
fgd1 490948 p.Ser56Ala missense_variant 0.12 delamanid
fgd1 490962 c.180T>C synonymous_variant 0.12 delamanid
fgd1 490971 c.189A>G synonymous_variant 0.12 delamanid
fgd1 490974 c.192T>C synonymous_variant 0.13 delamanid
fgd1 490978 p.Asn66Gln missense_variant 0.13 delamanid
fgd1 490984 c.202C>T synonymous_variant 0.15 delamanid
fgd1 490988 p.Leu69Gln missense_variant 0.15 delamanid
fgd1 490998 c.216T>C synonymous_variant 0.23 delamanid
fgd1 491010 c.228C>T synonymous_variant 0.24 delamanid
fgd1 491013 c.231C>G synonymous_variant 0.23 delamanid
fgd1 491025 c.243C>T synonymous_variant 0.29 delamanid
fgd1 491031 c.249C>G synonymous_variant 0.32 delamanid
fgd1 491039 p.Ile86Thr missense_variant 0.32 delamanid
fgd1 491043 c.261T>C synonymous_variant 0.32 delamanid
fgd1 491046 c.264G>A synonymous_variant 0.3 delamanid
fgd1 491049 c.267T>C synonymous_variant 0.32 delamanid
fgd1 491064 c.282A>G synonymous_variant 0.35 delamanid
fgd1 491077 p.Asn99Gly missense_variant 0.31 delamanid
fgd1 491082 c.300T>C synonymous_variant 0.31 delamanid
fgd1 491083 p.Val101Ile missense_variant 0.31 delamanid
fgd1 491091 c.309T>G synonymous_variant 0.34 delamanid
fgd1 491094 c.312C>A synonymous_variant 0.38 delamanid
fgd1 491097 c.315G>C synonymous_variant 0.45 delamanid
fgd1 491112 c.330G>C synonymous_variant 0.45 delamanid
fgd1 491115 c.333G>C synonymous_variant 0.46 delamanid
fgd1 491121 c.339A>G synonymous_variant 0.47 delamanid
fgd1 491137 p.Glu119Ile missense_variant 0.44 delamanid
fgd1 491144 p.Ala121Glu missense_variant 0.46 delamanid
fgd1 491166 c.384G>T synonymous_variant 0.43 delamanid
fgd1 491172 c.390C>G synonymous_variant 0.37 delamanid
fgd1 491184 c.402A>G synonymous_variant 0.27 delamanid
fgd1 491190 c.408G>C synonymous_variant 0.27 delamanid
fgd1 491191 p.Gly137Arg missense_variant 0.27 delamanid
fgd1 491196 c.414A>C synonymous_variant 0.27 delamanid
fgd1 491202 c.420G>C synonymous_variant 0.25 delamanid
fgd1 491203 p.Gln141Glu missense_variant 0.25 delamanid
fgd1 491213 p.Ser144Thr missense_variant 0.23 delamanid
fgd1 491220 p.Asp146Glu missense_variant 0.22 delamanid
fgd1 491223 c.441C>T synonymous_variant 0.22 delamanid
fgd1 491232 c.450T>C synonymous_variant 0.21 delamanid
fgd1 491235 p.Asp151Glu missense_variant 0.21 delamanid
fgd1 491241 p.Asp153Glu missense_variant 0.17 delamanid
fgd1 491244 c.462T>C synonymous_variant 0.15 delamanid
fgd1 491742 c.960T>C synonymous_variant 1.0 delamanid
mshA 575705 c.358T>C synonymous_variant 0.15 ethionamide
isoniazid
mshA 575734 c.387T>G synonymous_variant 0.17 ethionamide
isoniazid
mshA 575737 c.390T>C synonymous_variant 0.17 ethionamide
isoniazid
mshA 575740 c.393G>T synonymous_variant 0.17 ethionamide
isoniazid
mshA 575743 c.396C>T synonymous_variant 0.18 ethionamide
isoniazid
mshA 575744 p.Ala133Thr missense_variant 0.19 ethionamide
isoniazid
mshA 575755 c.408G>A synonymous_variant 0.2 ethionamide
isoniazid
mshA 575761 c.414C>G synonymous_variant 0.2 ethionamide
isoniazid
mshA 575767 c.420G>A synonymous_variant 0.2 ethionamide
isoniazid
mshA 575785 c.438T>C synonymous_variant 0.19 ethionamide
isoniazid
mshA 575792 p.Asp149Asn missense_variant 0.2 ethionamide
isoniazid
mshA 575795 p.Ile150Leu missense_variant 0.19 ethionamide
isoniazid
mshA 575800 c.453G>T synonymous_variant 0.18 ethionamide
isoniazid
mshA 575812 c.465C>T synonymous_variant 0.15 ethionamide
isoniazid
mshA 575818 c.471G>C synonymous_variant 0.16 ethionamide
isoniazid
mshA 575827 c.480G>A synonymous_variant 0.16 ethionamide
isoniazid
mshA 575829 p.Val161Ala missense_variant 0.16 ethionamide
isoniazid
mshA 575839 c.492G>C synonymous_variant 0.16 ethionamide
isoniazid
mshA 575842 c.495G>C synonymous_variant 0.16 ethionamide
isoniazid
ccsA 620311 p.Leu141Val missense_variant 0.15 capreomycin
amikacin Uncertain significance
ccsA 620314 c.424C>T synonymous_variant 0.15 capreomycin
amikacin
ccsA 620317 p.Val143Ile missense_variant 0.16 capreomycin
amikacin
ccsA 620322 c.432G>C synonymous_variant 0.17 capreomycin
amikacin
ccsA 620328 c.438G>C synonymous_variant 0.2 capreomycin
amikacin
ccsA 620338 p.Thr150Ala missense_variant 0.26 capreomycin
amikacin
ccsA 620349 c.459A>C synonymous_variant 0.28 capreomycin
amikacin
ccsA 620354 p.Trp155Tyr missense_variant 0.27 capreomycin
amikacin
ccsA 620362 p.Ala158Thr missense_variant 0.29 capreomycin
amikacin Uncertain significance
ccsA 620365 p.Asn159Tyr missense_variant 0.29 capreomycin
amikacin
ccsA 620388 c.498A>C synonymous_variant 0.33 capreomycin
amikacin
ccsA 620397 c.507C>G synonymous_variant 0.34 capreomycin
amikacin
ccsA 620412 c.522T>C synonymous_variant 0.35 capreomycin
amikacin
ccsA 620415 c.525T>C synonymous_variant 0.35 capreomycin
amikacin
ccsA 620421 c.531G>C synonymous_variant 0.36 capreomycin
amikacin
ccsA 620430 c.540C>T synonymous_variant 0.3 capreomycin
amikacin
ccsA 620439 c.549T>G synonymous_variant 0.3 capreomycin
amikacin
ccsA 620442 c.552G>T synonymous_variant 0.27 capreomycin
amikacin
ccsA 620445 c.555A>T synonymous_variant 0.25 capreomycin
amikacin
ccsA 620454 c.564C>A synonymous_variant 0.18 capreomycin
amikacin
ccsA 620460 c.570T>G synonymous_variant 0.14 capreomycin
amikacin
ccsA 620463 c.573C>G synonymous_variant 0.13 capreomycin
amikacin
ccsA 620466 c.576C>A synonymous_variant 0.1 capreomycin
amikacin
ccsA 620625 p.Ile245Met missense_variant 0.97 capreomycin Uncertain significance
amikacin Uncertain significance
rpoB 760079 c.273G>A synonymous_variant 0.15 rifampicin
rpoB 760091 c.285G>C synonymous_variant 0.32 rifampicin
rpoB 760101 c.295T>C synonymous_variant 0.36 rifampicin
rpoB 760110 c.304_306delTCTinsAGC synonymous_variant 0.34 rifampicin
rpoB 760118 c.312T>G synonymous_variant 0.38 rifampicin
rpoB 760121 c.315T>C synonymous_variant 0.37 rifampicin
rpoB 760130 p.Asp108Glu missense_variant 0.51 rifampicin Uncertain significance
rpoB 760139 c.333A>G synonymous_variant 0.54 rifampicin
rpoB 760181 c.375T>C synonymous_variant 0.72 rifampicin
rpoB 760184 c.378A>G synonymous_variant 0.72 rifampicin
rpoB 760196 c.390C>G synonymous_variant 0.74 rifampicin
rpoB 760235 c.429T>C synonymous_variant 0.73 rifampicin
rpoB 760244 c.438G>C synonymous_variant 0.73 rifampicin
rpoB 760256 c.450C>T synonymous_variant 0.74 rifampicin
rpoB 760274 p.Glu156Asp missense_variant 0.72 rifampicin Uncertain significance
rpoB 760276 p.Lys157Met missense_variant 0.7 rifampicin
rpoB 760283 c.477G>C synonymous_variant 0.68 rifampicin
rpoB 760298 c.492G>C synonymous_variant 0.52 rifampicin
rpoB 760307 c.501T>C synonymous_variant 0.5 rifampicin
rpoB 760313 c.507G>C synonymous_variant 0.32 rifampicin
rpoB 760316 c.510C>G synonymous_variant 0.31 rifampicin
rpoB 760317 c.511_513delAGCinsTCG synonymous_variant 0.31 rifampicin
rpoB 760325 c.519G>C synonymous_variant 0.3 rifampicin
rpoB 760328 c.522G>C synonymous_variant 0.28 rifampicin
rpoB 760331 c.525G>T synonymous_variant 0.28 rifampicin
rpoB 760337 c.531C>G synonymous_variant 0.29 rifampicin
rpoB 760340 c.534G>T synonymous_variant 0.27 rifampicin
rpoB 760343 c.537G>C synonymous_variant 0.3 rifampicin
rpoB 760357 p.Thr184Ser missense_variant 0.46 rifampicin
rpoB 760361 c.555T>C synonymous_variant 0.44 rifampicin
rpoB 760370 c.564C>G synonymous_variant 0.53 rifampicin
rpoB 760376 p.Asp190Glu missense_variant 0.57 rifampicin
rpoB 760382 c.576G>C synonymous_variant 0.59 rifampicin
rpoB 760388 c.582C>T synonymous_variant 0.61 rifampicin
rpoB 760400 c.594G>C synonymous_variant 0.65 rifampicin
rpoB 760415 c.609C>T synonymous_variant 0.71 rifampicin
rpoB 760418 c.612G>C synonymous_variant 0.71 rifampicin
rpoB 760430 c.624T>C synonymous_variant 0.7 rifampicin
rpoB 760460 c.654G>C synonymous_variant 0.72 rifampicin
rpoB 760475 c.669A>G synonymous_variant 0.74 rifampicin
rpoB 760481 c.675G>C synonymous_variant 0.73 rifampicin
rpoB 760484 c.678A>G synonymous_variant 0.74 rifampicin
rpoB 760502 c.696C>G synonymous_variant 0.76 rifampicin
rpoB 760522 p.Ser239Asn missense_variant 0.76 rifampicin
rpoB 760532 c.726T>C synonymous_variant 0.77 rifampicin
rpoB 760541 c.735G>C synonymous_variant 0.74 rifampicin
rpoB 760561 c.757_758delCG frameshift_variant 0.65 rifampicin
rpoB 760567 p.Ser254Trp missense_variant 0.64 rifampicin
rpoB 760568 c.762_763insGC frameshift_variant 0.66 rifampicin
rpoB 760571 c.765G>C synonymous_variant 0.67 rifampicin
rpoB 760588 p.Thr261Ile missense_variant 0.73 rifampicin
rpoB 760591 p.Val262Ala missense_variant 0.73 rifampicin Uncertain significance
rpoB 760595 c.789C>T synonymous_variant 0.73 rifampicin
rpoB 760596 p.Thr264Pro missense_variant 0.74 rifampicin
rpoB 760608 c.802C>T synonymous_variant 0.76 rifampicin
rpoB 760611 c.805T>C synonymous_variant 0.79 rifampicin
rpoB 760634 c.828T>C synonymous_variant 0.78 rifampicin
rpoB 760646 c.840C>G synonymous_variant 0.72 rifampicin
rpoB 760655 c.849A>G synonymous_variant 0.72 rifampicin
rpoB 760661 c.855A>G synonymous_variant 0.71 rifampicin
rpoB 760668 p.Thr288Ala missense_variant 0.62 rifampicin
rpoB 760674 c.868T>C synonymous_variant 0.61 rifampicin
rpoB 760679 c.873A>G synonymous_variant 0.58 rifampicin
rpoB 760683 c.877T>C synonymous_variant 0.6 rifampicin
rpoB 760703 c.897C>T synonymous_variant 0.57 rifampicin
rpoB 760721 c.915C>G synonymous_variant 0.54 rifampicin
rpoB 760727 c.921C>G synonymous_variant 0.48 rifampicin
rpoB 760730 c.924T>C synonymous_variant 0.45 rifampicin
rpoB 760736 c.930C>G synonymous_variant 0.41 rifampicin
rpoB 760747 c.942C>G synonymous_variant 0.12 rifampicin
rpoB 760751 c.945G>C synonymous_variant 0.11 rifampicin
rpoB 760787 c.981G>C synonymous_variant 0.1 rifampicin
rpoB 760793 c.987A>G synonymous_variant 0.31 rifampicin
rpoB 760805 c.999G>C synonymous_variant 0.4 rifampicin
rpoB 760817 c.1011A>G synonymous_variant 0.48 rifampicin
rpoB 760820 c.1014T>C synonymous_variant 0.51 rifampicin
rpoB 760826 c.1020C>G synonymous_variant 0.53 rifampicin
rpoB 760830 c.1024T>C synonymous_variant 0.56 rifampicin
rpoB 760841 c.1035T>C synonymous_variant 0.62 rifampicin
rpoB 760858 p.Val351Ala missense_variant 0.62 rifampicin
rpoB 760862 c.1056G>C synonymous_variant 0.62 rifampicin
rpoB 760865 c.1059C>T synonymous_variant 0.64 rifampicin
rpoB 760886 p.Glu360Asp missense_variant 0.71 rifampicin
rpoB 760887 p.Thr361Val missense_variant 0.71 rifampicin
rpoB 760910 c.1104C>T synonymous_variant 0.75 rifampicin
rpoB 760916 c.1110C>T synonymous_variant 0.76 rifampicin
rpoB 760928 c.1122G>C synonymous_variant 0.75 rifampicin
rpoB 760943 c.1137C>T synonymous_variant 0.76 rifampicin
rpoB 760946 c.1140A>G synonymous_variant 0.76 rifampicin
rpoB 760965 p.Met387Leu missense_variant 0.69 rifampicin
rpoB 760970 c.1164G>C synonymous_variant 0.67 rifampicin
rpoB 760973 c.1167G>T synonymous_variant 0.65 rifampicin
rpoB 760982 c.1176G>C synonymous_variant 0.65 rifampicin
rpoB 760985 c.1179G>C synonymous_variant 0.62 rifampicin
rpoB 760988 c.1182C>G synonymous_variant 0.61 rifampicin
rpoB 760991 c.1185G>T synonymous_variant 0.61 rifampicin
rpoB 760997 c.1191G>C synonymous_variant 0.67 rifampicin
rpoB 761006 c.1200C>G synonymous_variant 0.7 rifampicin
rpoB 761015 c.1209G>C synonymous_variant 0.69 rifampicin
rpoB 761027 c.1221A>C synonymous_variant 0.72 rifampicin
rpoB 761036 c.1230G>C synonymous_variant 0.71 rifampicin
rpoB 761037 c.1231T>C synonymous_variant 0.7 rifampicin
rpoB 761051 c.1245G>T synonymous_variant 0.69 rifampicin
rpoB 761054 c.1248G>C synonymous_variant 0.69 rifampicin
rpoB 761057 c.1251G>C synonymous_variant 0.7 rifampicin
rpoB 761060 c.1254C>G synonymous_variant 0.68 rifampicin
rpoB 761063 c.1257C>G synonymous_variant 0.67 rifampicin
rpoB 761084 c.1278C>A synonymous_variant 0.69 rifampicin
rpoB 761097 c.1291_1293delAGCinsTCG synonymous_variant 0.66 rifampicin
rpoB 761102 c.1296A>G synonymous_variant 0.68 rifampicin
rpoB 761132 c.1326G>C synonymous_variant 0.71 rifampicin
rpoB 761133 c.1327T>C synonymous_variant 0.7 rifampicin
rpoB 761147 c.1341C>T synonymous_variant 0.7 rifampicin
rpoB 761150 c.1344A>T synonymous_variant 0.7 rifampicin
rpoB 761165 c.1359G>C synonymous_variant 0.7 rifampicin
rpoB 761171 c.1365C>T synonymous_variant 0.7 rifampicin
rpoB 761178 p.Ser458Thr missense_variant 0.7 rifampicin
rpoB 761186 p.Glu460Asp missense_variant 0.69 rifampicin
rpoB 761189 c.1383T>C synonymous_variant 0.71 rifampicin
rpoB 761195 c.1389G>C synonymous_variant 0.7 rifampicin
rpoB 761198 c.1392G>C synonymous_variant 0.7 rifampicin
rpoB 761219 c.1413G>C synonymous_variant 0.72 rifampicin
rpoB 761234 c.1428G>C synonymous_variant 0.71 rifampicin
rpoB 761249 c.1443A>G synonymous_variant 0.67 rifampicin
rpoB 761255 c.1449T>G synonymous_variant 0.65 rifampicin
rpoB 761258 c.1452G>A synonymous_variant 0.65 rifampicin
rpoB 761261 c.1455G>C synonymous_variant 0.63 rifampicin
rpoB 761264 c.1458C>G synonymous_variant 0.67 rifampicin
rpoB 761273 c.1467T>C synonymous_variant 0.7 rifampicin
rpoB 761318 c.1512G>T synonymous_variant 0.7 rifampicin
rpoB 761327 c.1521A>G synonymous_variant 0.71 rifampicin
rpoB 761333 c.1527G>T synonymous_variant 0.66 rifampicin
rpoB 761339 c.1533C>G synonymous_variant 0.61 rifampicin
rpoB 761345 c.1539G>C synonymous_variant 0.57 rifampicin
rpoB 761346 p.Val514Ser missense_variant 0.56 rifampicin
rpoB 761354 c.1548C>A synonymous_variant 0.56 rifampicin
rpoB 761357 c.1551G>T synonymous_variant 0.54 rifampicin
rpoB 761360 c.1554T>C synonymous_variant 0.56 rifampicin
rpoB 761362 p.Ser519Thr missense_variant 0.56 rifampicin
rpoB 761369 p.Glu521Asp missense_variant 0.52 rifampicin
rpoB 761373 p.Val523His missense_variant 0.5 rifampicin
rpoB 761384 c.1578C>G synonymous_variant 0.5 rifampicin
rpoB 761393 c.1587G>A synonymous_variant 0.58 rifampicin
rpoB 761414 c.1608A>G synonymous_variant 0.48 rifampicin
rpoB 761423 c.1617T>C synonymous_variant 0.34 rifampicin
rpoB 761471 c.1665C>T synonymous_variant 0.19 rifampicin
rpoB 761482 p.Ala559Gly missense_variant 0.27 rifampicin
rpoB 761497 p.Tyr564Phe missense_variant 0.3 rifampicin
rpoB 761502 p.Pro566Ser missense_variant 0.31 rifampicin
rpoB 761505 p.Ser567Ala missense_variant 0.31 rifampicin
rpoB 761508 p.Ser568Thr missense_variant 0.32 rifampicin
rpoB 761516 c.1710G>C synonymous_variant 0.49 rifampicin
rpoB 761528 c.1722C>T synonymous_variant 0.61 rifampicin
rpoB 761537 c.1731C>G synonymous_variant 0.63 rifampicin
rpoB 761555 c.1749G>C synonymous_variant 0.65 rifampicin
rpoB 761558 c.1752C>G synonymous_variant 0.66 rifampicin
rpoB 761564 c.1758G>C synonymous_variant 0.68 rifampicin
rpoB 761570 c.1764T>C synonymous_variant 0.67 rifampicin
rpoB 761573 c.1767C>G synonymous_variant 0.7 rifampicin
rpoB 761579 c.1773G>C synonymous_variant 0.7 rifampicin
rpoB 761612 c.1806G>T synonymous_variant 0.7 rifampicin
rpoB 761615 c.1809A>C synonymous_variant 0.72 rifampicin
rpoB 761636 c.1830G>T synonymous_variant 0.71 rifampicin
rpoB 761645 c.1839C>G synonymous_variant 0.7 rifampicin
rpoB 761657 c.1851C>T synonymous_variant 0.73 rifampicin
rpoB 761666 c.1860G>C synonymous_variant 0.69 rifampicin
rpoB 761669 c.1863C>T synonymous_variant 0.69 rifampicin
rpoB 761675 c.1869G>T synonymous_variant 0.65 rifampicin
rpoB 761681 c.1875G>A synonymous_variant 0.6 rifampicin
rpoB 761682 c.1876C>T synonymous_variant 0.58 rifampicin
rpoB 761687 c.1881C>T synonymous_variant 0.58 rifampicin
rpoB 761690 c.1884G>C synonymous_variant 0.6 rifampicin
rpoB 761693 c.1887G>C synonymous_variant 0.6 rifampicin
rpoB 761705 c.1899C>A synonymous_variant 0.58 rifampicin
rpoB 761723 c.1917A>G synonymous_variant 0.22 rifampicin
rpoB 761724 p.Glu640Lys missense_variant 0.22 rifampicin
rpoB 761727 p.Ser641Gly missense_variant 0.43 rifampicin
rpoB 761728 c.1923dupC frameshift_variant 0.28 rifampicin
rpoB 761732 c.1926C>T synonymous_variant 0.44 rifampicin
rpoB 761741 c.1935G>A synonymous_variant 0.42 rifampicin
rpoB 761750 c.1944G>T synonymous_variant 0.51 rifampicin
rpoB 761760 p.Ile652Val missense_variant 0.52 rifampicin
rpoB 761765 c.1959T>C synonymous_variant 0.45 rifampicin
rpoB 761772 p.His656Ala missense_variant 0.41 rifampicin
rpoB 761778 p.Asn658Asp missense_variant 0.43 rifampicin
rpoB 761791 p.Arg662Gln missense_variant 0.38 rifampicin
rpoB 761794 p.Thr663Ser missense_variant 0.38 rifampicin
rpoB 761802 p.Met666Leu missense_variant 0.41 rifampicin
rpoB 761813 c.2007T>C synonymous_variant 0.41 rifampicin
rpoB 761819 c.2013G>C synonymous_variant 0.45 rifampicin
rpoB 761834 c.2028T>C synonymous_variant 0.5 rifampicin
rpoB 761847 p.Cys681Lys missense_variant 0.39 rifampicin
rpoB 761863 p.Ala686Glu missense_variant 0.45 rifampicin
rpoB 761867 c.2061C>G synonymous_variant 0.45 rifampicin
rpoB 761868 p.Asp688Gln missense_variant 0.43 rifampicin
rpoB 761873 c.2067A>G synonymous_variant 0.43 rifampicin
rpoB 761891 c.2085G>C synonymous_variant 0.48 rifampicin
rpoB 761909 c.2103T>C synonymous_variant 0.5 rifampicin
rpoB 761912 c.2106T>C synonymous_variant 0.5 rifampicin
rpoB 761915 p.Asp703Glu missense_variant 0.49 rifampicin Uncertain significance
rpoB 761916 p.Asp704Asn missense_variant 0.49 rifampicin
rpoB 761924 c.2118G>A synonymous_variant 0.55 rifampicin
rpoB 761930 c.2124G>C synonymous_variant 0.58 rifampicin
rpoB 761933 c.2127G>C synonymous_variant 0.58 rifampicin
rpoB 761936 c.2130C>T synonymous_variant 0.58 rifampicin
rpoB 761948 c.2142G>C synonymous_variant 0.64 rifampicin
rpoB 761954 c.2148C>A synonymous_variant 0.63 rifampicin
rpoB 761955 p.Ile717Val missense_variant 0.65 rifampicin
rpoB 761969 c.2163G>A synonymous_variant 0.69 rifampicin
rpoB 761990 c.2184G>C synonymous_variant 0.76 rifampicin
rpoB 762008 c.2202C>T synonymous_variant 0.73 rifampicin
rpoB 762014 c.2208C>G synonymous_variant 0.73 rifampicin
rpoB 762038 c.2232C>T synonymous_variant 0.78 rifampicin
rpoB 762047 c.2241G>A synonymous_variant 0.8 rifampicin
rpoB 762053 c.2247T>C synonymous_variant 0.82 rifampicin
rpoB 762056 c.2250G>A synonymous_variant 0.82 rifampicin
rpoB 762065 c.2259T>G synonymous_variant 0.84 rifampicin
rpoB 762083 c.2277T>C synonymous_variant 0.83 rifampicin
rpoB 762086 c.2280G>C synonymous_variant 0.83 rifampicin
rpoB 762101 c.2295C>G synonymous_variant 0.84 rifampicin
rpoB 762114 p.Ile770Val missense_variant 0.84 rifampicin
rpoB 762122 c.2316C>T synonymous_variant 0.83 rifampicin
rpoB 762131 c.2325C>G synonymous_variant 0.81 rifampicin
rpoB 762134 c.2328C>A synonymous_variant 0.81 rifampicin
rpoB 762137 c.2331C>T synonymous_variant 0.8 rifampicin
rpoB 762140 c.2334G>C synonymous_variant 0.8 rifampicin
rpoB 762143 c.2337T>C synonymous_variant 0.8 rifampicin
rpoB 762149 c.2343G>T synonymous_variant 0.83 rifampicin
rpoB 762158 c.2352G>C synonymous_variant 0.84 rifampicin
rpoB 762167 c.2361T>C synonymous_variant 0.83 rifampicin
rpoB 762176 c.2370T>C synonymous_variant 0.82 rifampicin
rpoB 762185 c.2379G>C synonymous_variant 0.8 rifampicin
rpoB 762194 c.2388G>C synonymous_variant 0.81 rifampicin
rpoB 762233 c.2427G>C synonymous_variant 0.76 rifampicin
rpoB 762236 c.2430G>C synonymous_variant 0.75 rifampicin
rpoB 762245 c.2439G>C synonymous_variant 0.71 rifampicin
rpoB 762275 c.2469C>T synonymous_variant 0.62 rifampicin
rpoB 762284 c.2478G>C synonymous_variant 0.63 rifampicin
rpoB 762293 c.2487T>C synonymous_variant 0.62 rifampicin
rpoB 762296 c.2490G>C synonymous_variant 0.6 rifampicin
rpoB 762317 c.2511A>G synonymous_variant 0.62 rifampicin
rpoB 762323 c.2517C>A synonymous_variant 0.63 rifampicin
rpoB 762329 c.2523G>C synonymous_variant 0.6 rifampicin
rpoB 762338 c.2532T>C synonymous_variant 0.53 rifampicin
rpoB 762341 c.2535G>C synonymous_variant 0.52 rifampicin
rpoB 762347 c.2541T>C synonymous_variant 0.51 rifampicin
rpoB 762350 c.2544C>G synonymous_variant 0.5 rifampicin
rpoB 762353 c.2547C>T synonymous_variant 0.49 rifampicin
rpoB 762356 p.Glu850Asp missense_variant 0.5 rifampicin
rpoB 762362 p.Glu852Asp missense_variant 0.51 rifampicin
rpoB 762368 p.Glu854Asp missense_variant 0.52 rifampicin
rpoB 762369 c.2563T>C synonymous_variant 0.52 rifampicin
rpoC 762374 c.-996G>T upstream_gene_variant 0.51 rifampicin
rpoC 762380 c.-990T>C upstream_gene_variant 0.54 rifampicin
rpoC 762383 c.-987C>G upstream_gene_variant 0.54 rifampicin
rpoC 762386 c.-984C>T upstream_gene_variant 0.54 rifampicin
rpoC 762392 c.-978G>C upstream_gene_variant 0.52 rifampicin
rpoC 762395 c.-975G>T upstream_gene_variant 0.54 rifampicin
rpoC 762398 c.-972T>C upstream_gene_variant 0.57 rifampicin
rpoC 762404 c.-966T>C upstream_gene_variant 0.6 rifampicin
rpoC 762410 c.-960T>G upstream_gene_variant 0.59 rifampicin
rpoC 762416 c.-954A>G upstream_gene_variant 0.63 rifampicin
rpoC 762449 c.-921C>A upstream_gene_variant 0.66 rifampicin
rpoC 762452 c.-918G>C upstream_gene_variant 0.62 rifampicin
rpoC 762470 c.-900G>C upstream_gene_variant 0.6 rifampicin
rpoC 762488 c.-882G>C upstream_gene_variant 0.57 rifampicin
rpoC 762491 c.-879T>C upstream_gene_variant 0.57 rifampicin
rpoC 762509 c.-861T>G upstream_gene_variant 0.57 rifampicin
rpoB 762510 p.Ala902Pro missense_variant 0.56 rifampicin Uncertain significance
rpoC 762515 c.-855C>T upstream_gene_variant 0.55 rifampicin
rpoC 762533 c.-837T>C upstream_gene_variant 0.56 rifampicin
rpoC 762536 c.-834T>C upstream_gene_variant 0.56 rifampicin
rpoC 762537 c.-833T>C upstream_gene_variant 0.57 rifampicin
rpoC 762551 c.-819C>T upstream_gene_variant 0.5 rifampicin
rpoC 762557 c.-813G>A upstream_gene_variant 0.44 rifampicin
rpoC 762560 c.-810A>C upstream_gene_variant 0.45 rifampicin
rpoC 762563 c.-807G>T upstream_gene_variant 0.41 rifampicin
rpoC 762581 c.-789T>C upstream_gene_variant 0.24 rifampicin
rpoC 762587 c.-783G>A upstream_gene_variant 0.12 rifampicin
rpoC 762827 c.-543G>C upstream_gene_variant 0.55 rifampicin
rpoC 762830 c.-540C>G upstream_gene_variant 0.57 rifampicin
rpoC 762857 c.-513C>G upstream_gene_variant 0.62 rifampicin
rpoC 762860 c.-510G>C upstream_gene_variant 0.62 rifampicin
rpoC 762863 c.-507T>C upstream_gene_variant 0.62 rifampicin
rpoC 762866 c.-504C>T upstream_gene_variant 0.62 rifampicin
rpoB 762879 p.Met1025Leu missense_variant 0.68 rifampicin
rpoC 762894 c.-476C>T upstream_gene_variant 0.69 rifampicin
rpoC 762899 c.-471G>C upstream_gene_variant 0.7 rifampicin
rpoC 762917 c.-453C>G upstream_gene_variant 0.71 rifampicin
rpoC 762920 c.-450C>T upstream_gene_variant 0.71 rifampicin
rpoC 762923 c.-447C>G upstream_gene_variant 0.71 rifampicin
rpoC 762929 c.-441G>C upstream_gene_variant 0.76 rifampicin
rpoC 762959 c.-411G>C upstream_gene_variant 0.76 rifampicin
rpoC 762962 c.-408C>T upstream_gene_variant 0.77 rifampicin
rpoC 762995 c.-375G>T upstream_gene_variant 0.78 rifampicin
rpoC 763031 c.-339T>G upstream_gene_variant 1.0 rifampicin
rpoC 763034 c.-336C>G upstream_gene_variant 0.77 rifampicin
rpoC 763040 c.-330C>G upstream_gene_variant 0.77 rifampicin
rpoC 763070 c.-300T>C upstream_gene_variant 0.79 rifampicin
rpoC 763082 c.-288C>T upstream_gene_variant 0.81 rifampicin
rpoC 763088 c.-282C>G upstream_gene_variant 0.8 rifampicin
rpoC 763094 c.-276G>C upstream_gene_variant 0.78 rifampicin
rpoC 763115 c.-255T>C upstream_gene_variant 0.74 rifampicin
rpoC 763127 c.-243G>C upstream_gene_variant 0.68 rifampicin
rpoC 763136 c.-234C>T upstream_gene_variant 0.68 rifampicin
rpoC 763145 c.-225G>A upstream_gene_variant 0.69 rifampicin
rpoC 763157 c.-213G>T upstream_gene_variant 0.7 rifampicin
rpoC 763166 c.-204A>G upstream_gene_variant 0.68 rifampicin
rpoC 763172 c.-198G>C upstream_gene_variant 0.67 rifampicin
rpoC 763193 c.-177C>G upstream_gene_variant 0.56 rifampicin
rpoC 763202 c.-168A>G upstream_gene_variant 0.44 rifampicin
rpoC 763205 c.-165G>C upstream_gene_variant 0.4 rifampicin
rpoB 763207 p.Ser1134Lys missense_variant 0.42 rifampicin
rpoC 763214 c.-156T>C upstream_gene_variant 0.41 rifampicin
rpoC 763217 c.-153G>C upstream_gene_variant 0.41 rifampicin
rpoC 763220 c.-150G>C upstream_gene_variant 0.41 rifampicin
rpoC 763226 c.-144A>G upstream_gene_variant 0.41 rifampicin
rpoB 763227 p.Leu1141Met missense_variant 0.41 rifampicin
rpoB 763235 p.Glu1143Asp missense_variant 0.44 rifampicin
rpoC 763238 c.-132T>C upstream_gene_variant 0.44 rifampicin
rpoB 763241 p.Glu1145Asp missense_variant 0.45 rifampicin
rpoC 763259 c.-111G>C upstream_gene_variant 0.47 rifampicin
rpoC 763262 c.-108C>T upstream_gene_variant 0.45 rifampicin
rpoC 763265 c.-105G>C upstream_gene_variant 0.45 rifampicin
rpoC 763268 c.-102C>G upstream_gene_variant 0.46 rifampicin
rpoC 763283 c.-87T>C upstream_gene_variant 0.4 rifampicin
rpoC 763295 c.-75C>T upstream_gene_variant 0.28 rifampicin
rpoC 763352 c.-18T>A upstream_gene_variant 0.1 rifampicin
rpoC 763365 c.-5_-4insT upstream_gene_variant 0.4 rifampicin
rpoC 763402 c.33C>T synonymous_variant 0.49 rifampicin
rpoC 763408 c.39T>C synonymous_variant 0.51 rifampicin
rpoC 763411 c.42T>C synonymous_variant 0.51 rifampicin
rpoC 763414 c.45T>G synonymous_variant 0.51 rifampicin
rpoC 763415 p.Thr16Ser missense_variant 0.51 rifampicin
rpoC 763423 p.Glu18Asp missense_variant 0.51 rifampicin Uncertain significance
rpoC 763430 c.61_63delAGGinsCGA synonymous_variant 0.52 rifampicin
rpoC 763433 p.Gln22Asn missense_variant 0.52 rifampicin
rpoC 763443 p.Tyr25Phe missense_variant 0.56 rifampicin
rpoC 763450 c.81G>A synonymous_variant 0.61 rifampicin
rpoC 763456 c.87A>G synonymous_variant 0.65 rifampicin
rpoC 763468 c.99G>C synonymous_variant 0.68 rifampicin
rpoC 763486 c.117T>C synonymous_variant 0.72 rifampicin
rpoC 763492 c.123G>C synonymous_variant 0.73 rifampicin
rpoC 763528 c.159G>A synonymous_variant 0.71 rifampicin
rpoC 763531 c.162G>T synonymous_variant 0.71 rifampicin
rpoC 763546 c.177A>G synonymous_variant 0.73 rifampicin
rpoC 763570 c.201G>C synonymous_variant 0.75 rifampicin
rpoC 763594 c.225C>T synonymous_variant 0.76 rifampicin
rpoC 763633 c.264T>C synonymous_variant 0.76 rifampicin
rpoC 763657 c.288G>A synonymous_variant 0.76 rifampicin
rpoC 763660 c.291T>G synonymous_variant 0.77 rifampicin
rpoC 763666 c.297G>C synonymous_variant 0.75 rifampicin
rpoC 763669 c.300C>G synonymous_variant 0.75 rifampicin
rpoC 763675 c.306C>G synonymous_variant 0.76 rifampicin
rpoC 763696 c.327T>C synonymous_variant 0.73 rifampicin
rpoC 763699 c.330G>T synonymous_variant 0.69 rifampicin
rpoC 763702 c.333C>G synonymous_variant 0.69 rifampicin
rpoC 763708 c.339G>C synonymous_variant 0.7 rifampicin
rpoC 763711 c.342G>C synonymous_variant 0.68 rifampicin
rpoC 763714 c.345G>C synonymous_variant 0.68 rifampicin
rpoC 763717 c.348T>C synonymous_variant 0.67 rifampicin
rpoC 763723 c.354G>C synonymous_variant 0.68 rifampicin
rpoC 763732 c.363C>A synonymous_variant 0.68 rifampicin
rpoC 763741 c.372C>T synonymous_variant 0.64 rifampicin
rpoC 763744 c.375G>C synonymous_variant 0.6 rifampicin
rpoC 763747 c.378G>A synonymous_variant 0.6 rifampicin
rpoC 763765 c.396T>C synonymous_variant 0.56 rifampicin
rpoC 763774 c.405G>C synonymous_variant 0.49 rifampicin
rpoC 763781 p.Ser138Ala missense_variant 0.52 rifampicin
rpoC 763792 p.Glu141Asp missense_variant 0.41 rifampicin
rpoC 763796 p.Met143Leu missense_variant 0.38 rifampicin
rpoC 763801 c.432C>T synonymous_variant 0.35 rifampicin
rpoC 763804 c.435C>T synonymous_variant 0.35 rifampicin
rpoC 763807 c.438T>C synonymous_variant 0.36 rifampicin
rpoC 763816 c.447C>G synonymous_variant 0.39 rifampicin
rpoC 763831 c.462A>G synonymous_variant 0.37 rifampicin
rpoC 763836 p.Ala156Glu missense_variant 0.35 rifampicin
rpoC 763840 c.471G>C synonymous_variant 0.34 rifampicin
rpoC 763844 p.Arg159Lys missense_variant 0.33 rifampicin
rpoC 763857 p.Glu163Ala missense_variant 0.34 rifampicin
rpoC 763861 c.492C>T synonymous_variant 0.33 rifampicin
rpoC 763870 c.501C>T synonymous_variant 0.37 rifampicin
rpoC 763872 p.Gly168Ala missense_variant 0.35 rifampicin
rpoC 763876 p.Glu169Asp missense_variant 0.37 rifampicin
rpoC 763879 c.510A>G synonymous_variant 0.38 rifampicin
rpoC 763888 c.519G>T synonymous_variant 0.41 rifampicin
rpoC 763891 c.522G>C synonymous_variant 0.44 rifampicin
rpoC 763894 c.525A>G synonymous_variant 0.46 rifampicin
rpoC 763900 c.531G>C synonymous_variant 0.45 rifampicin
rpoC 763933 c.564C>T synonymous_variant 0.49 rifampicin
rpoC 763940 p.Ala191Ser missense_variant 0.51 rifampicin
rpoC 763945 c.576T>C synonymous_variant 0.51 rifampicin
rpoC 763947 p.Ala193Val missense_variant 0.51 rifampicin
rpoC 763951 c.582G>C synonymous_variant 0.51 rifampicin
rpoC 763960 c.591T>G synonymous_variant 0.5 rifampicin
rpoC 763969 c.600C>T synonymous_variant 0.49 rifampicin
rpoC 763987 c.618C>T synonymous_variant 0.52 rifampicin
rpoC 763991 p.Ile208Leu missense_variant 0.53 rifampicin
rpoC 763996 c.627T>C synonymous_variant 0.53 rifampicin
rpoC 763999 c.630C>T synonymous_variant 0.51 rifampicin
rpoC 764002 c.633C>G synonymous_variant 0.51 rifampicin
rpoC 764003 p.Ala212Ser missense_variant 0.51 rifampicin
rpoC 764024 c.655_657delTTGinsCTC synonymous_variant 0.51 rifampicin
rpoC 764029 p.Glu220Asp missense_variant 0.52 rifampicin
rpoC 764032 p.Asp221Glu missense_variant 0.55 rifampicin
rpoC 764040 p.Ser224Thr missense_variant 0.56 rifampicin
rpoC 764044 c.675T>C synonymous_variant 0.62 rifampicin
rpoC 764054 c.685C>T synonymous_variant 0.62 rifampicin
rpoC 764059 c.690G>T synonymous_variant 0.61 rifampicin
rpoC 764083 c.714A>G synonymous_variant 0.56 rifampicin
rpoC 764084 p.Asn239Val missense_variant 0.58 rifampicin
rpoC 764095 c.726C>T synonymous_variant 0.58 rifampicin
rpoC 764098 c.729A>G synonymous_variant 0.61 rifampicin
rpoC 764143 c.774G>C synonymous_variant 0.6 rifampicin
rpoC 764147 p.Ser260Ala missense_variant 0.6 rifampicin
rpoC 764150 p.Ile261Val missense_variant 0.57 rifampicin
rpoC 764165 p.Glu266Gln missense_variant 0.6 rifampicin
rpoC 764176 c.807C>T synonymous_variant 0.52 rifampicin
rpoC 764177 p.Ile270Leu missense_variant 0.52 rifampicin
rpoC 764182 c.813C>T synonymous_variant 0.5 rifampicin
rpoC 764188 c.819A>G synonymous_variant 0.52 rifampicin
rpoC 764195 p.Ser276Asn missense_variant 0.36 rifampicin
rpoC 764203 c.834G>C synonymous_variant 0.37 rifampicin
rpoC 764206 p.Asp279Glu missense_variant 0.38 rifampicin
rpoC 764207 p.Val280Thr missense_variant 0.38 rifampicin
rpoC 764215 c.846A>C synonymous_variant 0.41 rifampicin
rpoC 764217 p.Asn283Ser missense_variant 0.41 rifampicin
rpoC 764242 c.873C>T synonymous_variant 0.53 rifampicin
rpoC 764254 c.885G>C synonymous_variant 0.5 rifampicin
rpoC 764266 c.897T>G synonymous_variant 0.43 rifampicin
rpoC 764278 c.909A>G synonymous_variant 0.33 rifampicin
rpoC 764279 p.Gln304Asn missense_variant 0.33 rifampicin
rpoC 764284 c.915G>C synonymous_variant 0.33 rifampicin
rpoC 764285 p.Gly306Thr missense_variant 0.33 rifampicin
rpoC 764293 c.924G>A synonymous_variant 0.33 rifampicin
rpoC 764296 c.927G>C synonymous_variant 0.34 rifampicin
rpoC 764297 p.Met310Gly missense_variant 0.34 rifampicin
rpoC 764311 c.942C>G synonymous_variant 0.47 rifampicin
rpoC 764317 c.948C>G synonymous_variant 0.48 rifampicin
rpoC 764320 c.951C>G synonymous_variant 0.5 rifampicin
rpoC 764332 c.963G>A synonymous_variant 0.58 rifampicin
rpoC 764338 c.969G>A synonymous_variant 0.63 rifampicin
rpoC 764353 c.984G>T synonymous_variant 0.7 rifampicin
rpoC 764365 c.996C>T synonymous_variant 0.72 rifampicin
rpoC 764371 c.1002G>C synonymous_variant 0.7 rifampicin
rpoC 764377 c.1008C>G synonymous_variant 0.69 rifampicin
rpoC 764380 c.1011G>C synonymous_variant 0.69 rifampicin
rpoC 764387 c.1018T>C synonymous_variant 0.74 rifampicin
rpoC 764405 c.1036_1038delAGGinsCGC synonymous_variant 0.73 rifampicin
rpoC 764428 c.1059G>C synonymous_variant 0.77 rifampicin
rpoC 764431 c.1062G>C synonymous_variant 0.78 rifampicin
rpoC 764434 c.1065A>G synonymous_variant 0.77 rifampicin
rpoC 764435 c.1066_1068delAGGinsCGA synonymous_variant 0.77 rifampicin
rpoC 764458 c.1089G>C synonymous_variant 0.79 rifampicin
rpoC 764461 c.1092A>G synonymous_variant 0.79 rifampicin
rpoC 764497 c.1128A>G synonymous_variant 0.83 rifampicin
rpoC 764510 c.1141C>T synonymous_variant 0.79 rifampicin
rpoC 764524 c.1155C>G synonymous_variant 0.79 rifampicin
rpoC 764530 c.1161C>G synonymous_variant 0.77 rifampicin
rpoC 764534 c.1165C>A synonymous_variant 0.77 rifampicin
rpoC 764539 c.1170C>T synonymous_variant 0.74 rifampicin
rpoC 764542 c.1173C>T synonymous_variant 0.73 rifampicin
rpoC 764545 c.1176C>A synonymous_variant 0.74 rifampicin
rpoC 764560 c.1191T>C synonymous_variant 0.76 rifampicin
rpoC 764575 c.1206T>G synonymous_variant 0.8 rifampicin
rpoC 764611 c.1242G>T synonymous_variant 0.83 rifampicin
rpoC 764626 c.1257C>T synonymous_variant 0.82 rifampicin
rpoC 764632 c.1263T>C synonymous_variant 0.82 rifampicin
rpoC 764650 c.1281G>T synonymous_variant 0.82 rifampicin
rpoC 764668 c.1299C>T synonymous_variant 0.81 rifampicin
rpoC 764692 c.1323C>T synonymous_variant 0.82 rifampicin
rpoC 764713 c.1344G>T synonymous_variant 0.83 rifampicin
rpoC 764716 c.1347G>C synonymous_variant 0.83 rifampicin
rpoC 764746 c.1377G>T synonymous_variant 0.81 rifampicin
rpoC 764752 c.1383G>C synonymous_variant 0.81 rifampicin
rpoC 764758 c.1389C>G synonymous_variant 0.81 rifampicin
rpoC 764764 c.1395T>C synonymous_variant 0.8 rifampicin
rpoC 764791 c.1422C>G synonymous_variant 0.83 rifampicin
rpoC 764803 c.1434C>T synonymous_variant 0.81 rifampicin
rpoC 764809 c.1440C>T synonymous_variant 0.79 rifampicin
rpoC 764810 p.Pro481Ala missense_variant 0.79 rifampicin
rpoC 764815 c.1446A>G synonymous_variant 0.79 rifampicin
rpoC 764824 c.1455T>C synonymous_variant 0.79 rifampicin
rpoC 764827 c.1458G>C synonymous_variant 0.78 rifampicin
rpoC 764858 c.1489T>C synonymous_variant 0.79 rifampicin
rpoC 764869 c.1500C>T synonymous_variant 0.77 rifampicin
rpoC 764875 c.1506C>A synonymous_variant 0.78 rifampicin
rpoC 764887 c.1518G>C synonymous_variant 0.76 rifampicin
rpoC 764888 c.1519T>C synonymous_variant 0.75 rifampicin
rpoC 764911 c.1542A>G synonymous_variant 0.68 rifampicin
rpoC 764912 p.Met515Gln missense_variant 0.67 rifampicin
rpoC 764932 c.1563C>A synonymous_variant 0.68 rifampicin
rpoC 764948 c.1579_1581delTTGinsCTC synonymous_variant 0.63 rifampicin
rpoC 764968 c.1599T>C synonymous_variant 0.6 rifampicin
rpoC 765004 c.1635G>C synonymous_variant 0.51 rifampicin
rpoC 765007 c.1638T>G synonymous_variant 0.49 rifampicin
rpoC 765008 c.1639T>C synonymous_variant 0.49 rifampicin
rpoC 765011 c.1642_1644delAGCinsTCG synonymous_variant 0.49 rifampicin
rpoC 765016 c.1647C>G synonymous_variant 0.51 rifampicin
rpoC 765019 c.1650A>G synonymous_variant 0.52 rifampicin
rpoC 765040 c.1671T>C synonymous_variant 0.52 rifampicin
rpoC 765041 c.1672T>C synonymous_variant 0.52 rifampicin
rpoC 765047 c.1678T>C synonymous_variant 0.52 rifampicin
rpoC 765055 c.1686C>G synonymous_variant 0.55 rifampicin
rpoC 765073 c.1704G>C synonymous_variant 0.5 rifampicin
rpoC 765076 c.1707A>G synonymous_variant 0.48 rifampicin
rpoC 765079 c.1710T>G synonymous_variant 0.49 rifampicin
rpoC 765082 c.1713G>C synonymous_variant 0.49 rifampicin
rpoC 765085 c.1716T>C synonymous_variant 0.48 rifampicin
rpoC 765089 c.1720T>C synonymous_variant 0.47 rifampicin
rpoC 765100 c.1731G>C synonymous_variant 0.48 rifampicin
rpoC 765103 c.1734G>T synonymous_variant 0.47 rifampicin
rpoC 765121 c.1752G>T synonymous_variant 0.42 rifampicin
rpoC 765129 p.Tyr587Phe missense_variant 0.33 rifampicin
rpoC 765283 c.1914C>G synonymous_variant 0.18 rifampicin
rpoC 765288 p.Leu640Gln missense_variant 0.17 rifampicin
rpoC 765292 c.1923G>T synonymous_variant 0.24 rifampicin
rpoC 765300 p.Val644Ala missense_variant 0.33 rifampicin
rpoC 765305 p.Ile646Val missense_variant 0.33 rifampicin Uncertain significance
rpoC 765319 c.1950A>G synonymous_variant 0.39 rifampicin
rpoC 765323 c.1955_1957delGCC disruptive_inframe_deletion 0.37 rifampicin
rpoC 765328 p.His653Gln missense_variant 0.36 rifampicin Uncertain significance
rpoC 765330 p.Ser654Asn missense_variant 0.36 rifampicin
rpoC 765334 c.1965C>T synonymous_variant 0.42 rifampicin
rpoC 765343 c.1974G>A synonymous_variant 0.46 rifampicin
rpoC 765352 c.1983G>C synonymous_variant 0.5 rifampicin
rpoC 765356 p.Met663Val missense_variant 0.48 rifampicin
rpoC 765370 c.2001G>C synonymous_variant 0.57 rifampicin
rpoC 765379 c.2010G>C synonymous_variant 0.59 rifampicin
rpoC 765382 c.2013G>T synonymous_variant 0.6 rifampicin
rpoC 765383 p.Met672Leu missense_variant 0.61 rifampicin
rpoC 765403 c.2034G>C synonymous_variant 0.71 rifampicin
rpoC 765405 p.Leu679His missense_variant 0.72 rifampicin
rpoC 765409 c.2040T>G synonymous_variant 0.71 rifampicin
rpoC 765421 c.2052C>G synonymous_variant 0.77 rifampicin
rpoC 765449 p.Ala694Ser missense_variant 0.73 rifampicin
rpoC 765454 c.2085C>G synonymous_variant 0.72 rifampicin
rpoC 765469 c.2100G>C synonymous_variant 0.72 rifampicin
rpoC 765478 c.2109T>G synonymous_variant 0.71 rifampicin
rpoC 765480 p.Tyr704Phe missense_variant 0.74 rifampicin
rpoC 765499 c.2130C>G synonymous_variant 0.68 rifampicin
rpoC 765517 c.2148C>G synonymous_variant 0.61 rifampicin
rpoC 765533 p.Tyr722His missense_variant 0.52 rifampicin
rpoC 765544 c.2175C>G synonymous_variant 0.39 rifampicin
rpoC 765547 c.2178C>T synonymous_variant 0.38 rifampicin
rpoC 765548 c.2179_2181delAGCinsTCG synonymous_variant 0.38 rifampicin
rpoC 765553 c.2184C>T synonymous_variant 0.38 rifampicin
rpoC 765556 c.2187G>C synonymous_variant 0.37 rifampicin
rpoC 765562 c.2193G>T synonymous_variant 0.37 rifampicin
rpoC 765591 p.Arg741Gln missense_variant 0.19 rifampicin
rpoC 765596 p.Lys743Ala missense_variant 0.16 rifampicin
rpoC 765607 c.2238C>G synonymous_variant 0.18 rifampicin
rpoC 765612 p.His748Arg missense_variant 0.18 rifampicin
rpoC 765826 c.2457T>C synonymous_variant 0.3 rifampicin
rpoC 765835 c.2466C>T synonymous_variant 0.36 rifampicin
rpoC 765841 c.2472G>T synonymous_variant 0.47 rifampicin
rpoC 765861 p.Phe831Tyr missense_variant 0.59 rifampicin
rpoC 765875 p.Val836Ile missense_variant 0.65 rifampicin
rpoC 765907 c.2538G>T synonymous_variant 0.67 rifampicin
rpoC 765910 c.2541G>C synonymous_variant 0.68 rifampicin
rpoC 765928 c.2559C>G synonymous_variant 0.68 rifampicin
rpoC 765940 c.2571A>T synonymous_variant 0.66 rifampicin
rpoC 765947 c.2578T>C synonymous_variant 0.67 rifampicin
rpoC 765962 c.2593_2595delTTGinsCTT synonymous_variant 0.56 rifampicin
rpoC 765967 c.2598C>T synonymous_variant 0.56 rifampicin
rpoC 765973 c.2604C>G synonymous_variant 0.56 rifampicin
rpoC 765979 c.2610C>G synonymous_variant 0.54 rifampicin
rpoC 765982 c.2613C>T synonymous_variant 0.54 rifampicin
rpoC 765994 c.2625A>T synonymous_variant 0.45 rifampicin
rpoC 766003 c.2634G>C synonymous_variant 0.42 rifampicin
rpoC 766009 c.2640G>C synonymous_variant 0.4 rifampicin
rpoC 766012 c.2643C>G synonymous_variant 0.37 rifampicin
rpoC 766021 c.2652G>C synonymous_variant 0.33 rifampicin
rpoC 766027 c.2658G>C synonymous_variant 0.24 rifampicin
rpoC 766030 c.2661C>T synonymous_variant 0.15 rifampicin
rpoC 766321 c.2952C>G synonymous_variant 0.21 rifampicin
rpoC 766333 c.2964G>T synonymous_variant 0.21 rifampicin
rpoC 766345 c.2976T>C synonymous_variant 0.2 rifampicin
rpoC 766348 c.2979A>G synonymous_variant 0.21 rifampicin
rpoC 766351 c.2982C>G synonymous_variant 0.21 rifampicin
rpoC 766353 p.Val995Ala missense_variant 0.21 rifampicin
rpoC 766369 c.3000C>G synonymous_variant 0.22 rifampicin
rpoC 766375 c.3006C>G synonymous_variant 0.23 rifampicin
rpoC 766381 c.3012C>T synonymous_variant 0.26 rifampicin
rpoC 766384 c.3015A>G synonymous_variant 0.26 rifampicin
rpoC 766390 c.3021C>T synonymous_variant 0.26 rifampicin
rpoC 766393 c.3024C>T synonymous_variant 0.26 rifampicin
rpoC 766408 c.3039C>T synonymous_variant 0.26 rifampicin
rpoC 766435 p.Glu1022Asp missense_variant 0.29 rifampicin
rpoC 766456 c.3087C>G synonymous_variant 0.16 rifampicin
rpoC 766459 c.3090G>T synonymous_variant 0.17 rifampicin
rpoC 766488 p.Pro1040Arg missense_variant 0.92 rifampicin Uncertain significance
rpoC 766501 c.3132G>C synonymous_variant 0.44 rifampicin
rpoC 766507 c.3138C>T synonymous_variant 0.46 rifampicin
rpoC 766513 c.3144C>T synonymous_variant 0.46 rifampicin
rpoC 766522 c.3153C>A synonymous_variant 0.45 rifampicin
rpoC 766528 c.3159T>G synonymous_variant 0.49 rifampicin
rpoC 766531 c.3162G>C synonymous_variant 0.49 rifampicin
rpoC 766534 c.3165C>G synonymous_variant 0.48 rifampicin
rpoC 766537 c.3168G>A synonymous_variant 0.47 rifampicin
rpoC 766540 p.Asp1057Glu missense_variant 0.47 rifampicin
rpoC 766549 c.3180G>C synonymous_variant 0.44 rifampicin
rpoC 766570 c.3201T>C synonymous_variant 0.44 rifampicin
rpoC 766573 c.3204T>G synonymous_variant 0.43 rifampicin
rpoC 766594 c.3225G>T synonymous_variant 0.44 rifampicin
rpoC 766607 p.Ile1080Leu missense_variant 0.47 rifampicin
rpoC 766618 c.3249G>T synonymous_variant 0.45 rifampicin
rpoC 766624 c.3255G>C synonymous_variant 0.41 rifampicin
rpoC 766630 c.3261G>C synonymous_variant 0.41 rifampicin
rpoC 766633 c.3264G>C synonymous_variant 0.42 rifampicin
rpoC 766642 c.3273C>T synonymous_variant 0.41 rifampicin
rpoC 766645 c.3276A>G synonymous_variant 0.36 rifampicin
rpoC 766651 c.3282T>G synonymous_variant 0.24 rifampicin
rpoC 766657 c.3288A>G synonymous_variant 0.19 rifampicin
rpoC 766660 c.3291G>T synonymous_variant 0.12 rifampicin
rpoC 766661 p.Val1098Pro missense_variant 0.12 rifampicin
rpoC 766666 c.3297C>G synonymous_variant 0.12 rifampicin
rpoC 766667 p.Ser1100Ala missense_variant 0.12 rifampicin Uncertain significance
rpoC 766672 c.3303T>C synonymous_variant 0.15 rifampicin
rpoC 766675 c.3306C>T synonymous_variant 0.14 rifampicin
rpoC 766690 c.3321G>C synonymous_variant 0.12 rifampicin
rpoC 766693 c.3324C>A synonymous_variant 0.12 rifampicin
rpoC 766702 c.3333G>C synonymous_variant 0.13 rifampicin
rpoC 766792 c.3423C>G synonymous_variant 0.11 rifampicin
rpoC 766799 p.Ala1144Ser missense_variant 0.12 rifampicin
rpoC 766804 c.3435A>G synonymous_variant 0.2 rifampicin
rpoC 766837 c.3468G>C synonymous_variant 0.52 rifampicin
rpoC 766843 c.3474T>G synonymous_variant 0.54 rifampicin
rpoC 766846 c.3477C>A synonymous_variant 0.55 rifampicin
rpoC 766858 c.3489C>T synonymous_variant 0.59 rifampicin
rpoC 766861 c.3492G>C synonymous_variant 0.6 rifampicin
rpoC 766867 c.3498C>G synonymous_variant 0.63 rifampicin
rpoC 766876 c.3507C>T synonymous_variant 0.62 rifampicin
rpoC 766883 p.Ser1172Ala missense_variant 0.64 rifampicin Uncertain significance
rpoC 766891 c.3522G>A synonymous_variant 0.6 rifampicin
rpoC 766894 c.3525T>C synonymous_variant 0.62 rifampicin
rpoC 766895 c.3526T>C synonymous_variant 0.62 rifampicin
rpoC 766900 c.3531T>C synonymous_variant 0.6 rifampicin
rpoC 766909 c.3540G>C synonymous_variant 0.6 rifampicin
rpoC 766911 p.Ile1181Thr missense_variant 0.6 rifampicin
rpoC 766915 p.Asp1182Glu missense_variant 0.6 rifampicin
rpoC 766918 c.3549C>T synonymous_variant 0.64 rifampicin
rpoC 766921 c.3552G>C synonymous_variant 0.66 rifampicin
rpoC 766931 p.Ala1188Ser missense_variant 0.67 rifampicin Uncertain significance
rpoC 766942 c.3573C>T synonymous_variant 0.75 rifampicin
rpoC 766945 c.3576A>C synonymous_variant 0.76 rifampicin
rpoC 766963 c.3594T>C synonymous_variant 0.77 rifampicin
rpoC 766996 c.3627C>T synonymous_variant 0.84 rifampicin
rpoC 767002 c.3633G>C synonymous_variant 0.84 rifampicin
rpoC 767008 c.3639G>A synonymous_variant 0.84 rifampicin
rpoC 767023 c.3654C>T synonymous_variant 0.83 rifampicin
rpoC 767044 c.3675G>C synonymous_variant 0.83 rifampicin
rpoC 767080 c.3711G>C synonymous_variant 0.82 rifampicin
rpoC 767098 c.3729T>C synonymous_variant 0.85 rifampicin
rpoC 767104 c.3735C>G synonymous_variant 0.85 rifampicin
rpoC 767107 c.3738C>T synonymous_variant 0.85 rifampicin
rpoC 767119 c.3750A>G synonymous_variant 0.84 rifampicin
rpoC 767125 c.3756G>C synonymous_variant 0.83 rifampicin
rpoC 767134 c.3765C>T synonymous_variant 0.83 rifampicin
rpoC 767138 c.3769C>T synonymous_variant 0.82 rifampicin
rpoC 767149 c.3780C>T synonymous_variant 0.83 rifampicin
rpoC 767158 c.3789T>C synonymous_variant 0.81 rifampicin
rpoC 767179 c.3810C>T synonymous_variant 0.82 rifampicin
rpoC 767180 p.Ala1271Ser missense_variant 0.82 rifampicin
rpoC 767191 c.3822C>G synonymous_variant 0.81 rifampicin
rpoC 767197 c.3828G>A synonymous_variant 0.8 rifampicin
rpoC 767203 c.3834C>G synonymous_variant 0.8 rifampicin
rpoC 767206 c.3837C>G synonymous_variant 0.79 rifampicin
rpoC 767209 c.3840T>C synonymous_variant 0.79 rifampicin
rpoC 767212 c.3843G>C synonymous_variant 0.8 rifampicin
rpoC 767221 c.3852C>G synonymous_variant 0.77 rifampicin
rpoC 767230 c.3861G>C synonymous_variant 0.73 rifampicin
rpoC 767233 c.3864T>C synonymous_variant 0.73 rifampicin
rpoC 767254 c.3885G>C synonymous_variant 0.59 rifampicin
rpoC 767264 p.Ala1299Ser missense_variant 0.52 rifampicin
rpoC 767267 p.Ala1300Asn missense_variant 0.52 rifampicin
rpoC 767281 c.3912C>G synonymous_variant 0.51 rifampicin
rpoC 767284 c.3915C>G synonymous_variant 0.51 rifampicin
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Uncertain significance
bedaquiline Uncertain significance
mmpL5 776100 p.Thr794Ile missense_variant 1.0 clofazimine Uncertain significance
bedaquiline Uncertain significance
mmpL5 776207 c.2274G>A synonymous_variant 0.1 clofazimine
bedaquiline
mmpS5 779615 c.-710C>G upstream_gene_variant 0.96 clofazimine
bedaquiline
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Uncertain significance
rpsL 781545 c.-14delT upstream_gene_variant 0.12 streptomycin
rpsL 781559 c.-1G>C upstream_gene_variant 0.58 streptomycin
rpsL 781572 p.Gln5Asn missense_variant 0.62 streptomycin
rpsL 781586 c.27C>T synonymous_variant 0.65 streptomycin
rpsL 781595 c.36T>C synonymous_variant 0.69 streptomycin
rpsL 781608 p.Ser17Ala missense_variant 0.64 streptomycin
rpsL 781616 c.57C>G synonymous_variant 0.64 streptomycin
rpsL 781628 c.69T>C synonymous_variant 0.63 streptomycin
rpsL 781649 c.90T>C synonymous_variant 0.64 streptomycin
rpsL 781655 c.96T>C synonymous_variant 0.66 streptomycin
rpsL 781658 c.99A>C synonymous_variant 0.66 streptomycin
rpsL 781670 c.111G>C synonymous_variant 0.73 streptomycin
rpsL 781706 c.147T>C synonymous_variant 0.65 streptomycin
rpsL 781715 c.156T>G synonymous_variant 0.62 streptomycin
rpsL 781721 c.162C>T synonymous_variant 0.6 streptomycin
rpsL 781725 p.Lys56Arg missense_variant 0.56 streptomycin
rpsL 781728 c.169T>C synonymous_variant 0.56 streptomycin
rpsL 781733 c.174G>C synonymous_variant 0.56 streptomycin
rpsL 781736 c.177T>C synonymous_variant 0.56 streptomycin
rpsL 781737 p.Gln60Ala missense_variant 0.56 streptomycin
rpsL 781742 c.183C>G synonymous_variant 0.58 streptomycin
rpsL 781751 c.192G>C synonymous_variant 0.59 streptomycin
rpsL 781754 c.195G>T synonymous_variant 0.6 streptomycin
rpsL 781760 c.201T>C synonymous_variant 0.57 streptomycin
rpsL 781763 c.204C>G synonymous_variant 0.55 streptomycin
rpsL 781766 c.207C>T synonymous_variant 0.56 streptomycin
rpsL 781772 c.213C>T synonymous_variant 0.54 streptomycin
rpsL 781802 c.243G>C synonymous_variant 0.67 streptomycin
rpsL 781814 c.255C>T synonymous_variant 0.67 streptomycin
rpsL 781817 c.258G>T synonymous_variant 0.67 streptomycin
rpsL 781829 c.270G>C synonymous_variant 0.69 streptomycin
rpsL 781832 c.273T>C synonymous_variant 0.67 streptomycin
rpsL 781859 c.300T>C synonymous_variant 0.66 streptomycin
rpsL 781868 c.309T>C synonymous_variant 0.67 streptomycin
rpsL 781871 c.312G>C synonymous_variant 0.66 streptomycin
rpsL 781877 c.318T>A synonymous_variant 0.67 streptomycin
rpsL 781892 c.333A>G synonymous_variant 0.64 streptomycin
rpsL 781898 c.339A>T synonymous_variant 0.63 streptomycin
rpsL 781907 c.348T>C synonymous_variant 0.64 streptomycin
rpsL 781916 c.357T>C synonymous_variant 0.64 streptomycin
rpsL 781929 p.Gly124Ser missense_variant 0.62 streptomycin Uncertain significance
rpsL 781933 c.374G>A splice_region_variant&stop_retained_variant 0.61 streptomycin
rplC 800612 c.-197A>G upstream_gene_variant 0.27 linezolid
rplC 800618 c.-191T>G upstream_gene_variant 0.31 linezolid
rplC 800621 c.-188G>A upstream_gene_variant 0.32 linezolid
rplC 800633 c.-176T>C upstream_gene_variant 0.37 linezolid
rplC 800639 c.-170C>T upstream_gene_variant 0.4 linezolid
rplC 800645 c.-164C>G upstream_gene_variant 0.4 linezolid
rplC 800648 c.-161A>G upstream_gene_variant 0.42 linezolid Uncertain significance
rplC 800654 c.-155T>C upstream_gene_variant 0.48 linezolid
rplC 800672 c.-137G>C upstream_gene_variant 0.44 linezolid
rplC 800690 c.-119C>T upstream_gene_variant 0.46 linezolid Uncertain significance
rplC 800693 c.-116A>C upstream_gene_variant 0.46 linezolid
rplC 800703 c.-106_-104delTTGinsCTC upstream_gene_variant 0.46 linezolid
rplC 800715 c.-94A>C upstream_gene_variant 0.52 linezolid
rplC 800720 c.-89T>C upstream_gene_variant 0.53 linezolid
rplC 800723 c.-86C>G upstream_gene_variant 0.53 linezolid
rplC 800735 c.-74C>G upstream_gene_variant 0.54 linezolid
rplC 800762 c.-47T>G upstream_gene_variant 0.52 linezolid
rplC 800780 c.-29C>G upstream_gene_variant 0.46 linezolid
rplC 800796 c.-12_-9delTTGG upstream_gene_variant 0.23 linezolid
rplC 800808 c.-1A>C upstream_gene_variant 0.23 linezolid
rplC 800815 c.7C>A synonymous_variant 0.21 linezolid
rplC 800820 c.12G>A synonymous_variant 0.21 linezolid
rplC 800823 c.15C>A synonymous_variant 0.23 linezolid
rplC 800829 c.21C>G synonymous_variant 0.31 linezolid
rplC 800832 c.24T>C synonymous_variant 0.35 linezolid
rplC 800856 c.48A>G synonymous_variant 0.37 linezolid
rplC 800865 p.Glu19Asp missense_variant 0.3 linezolid
rplC 800867 p.Ser20Asn missense_variant 0.27 linezolid
rplC 800872 c.64_66delAGAinsCGG synonymous_variant 0.27 linezolid
rplC 800877 c.69A>T synonymous_variant 0.28 linezolid
rplC 800880 c.72A>C synonymous_variant 0.25 linezolid
rplC 800886 c.78G>A synonymous_variant 0.24 linezolid
rplC 800892 c.84G>C synonymous_variant 0.25 linezolid
rplC 800904 c.96G>C synonymous_variant 0.26 linezolid
rplC 800910 c.102C>T synonymous_variant 0.26 linezolid
rplC 800916 c.108A>G synonymous_variant 0.24 linezolid
rplC 800928 c.120C>G synonymous_variant 0.2 linezolid
rplC 800931 c.123G>C synonymous_variant 0.2 linezolid
rplC 800932 p.Pro42Thr missense_variant 0.2 linezolid
rplC 800937 c.129A>G synonymous_variant 0.2 linezolid
rplC 800939 p.Arg44Gln missense_variant 0.21 linezolid
rplC 800946 c.138T>C synonymous_variant 0.22 linezolid
rplC 800949 c.141T>C synonymous_variant 0.23 linezolid
rplC 800964 c.156G>C synonymous_variant 0.26 linezolid
rplC 800967 c.159C>G synonymous_variant 0.27 linezolid
rplC 800985 c.177A>C synonymous_variant 0.14 linezolid
fbiC 1303674 c.744C>G synonymous_variant 0.23 delamanid
fbiC 1303677 c.747C>T synonymous_variant 0.22 delamanid
fbiC 1303686 c.756C>G synonymous_variant 0.21 delamanid
fbiC 1303689 c.759T>C synonymous_variant 0.22 delamanid
fbiC 1303695 c.765T>C synonymous_variant 0.21 delamanid
fbiC 1303701 c.771C>G synonymous_variant 0.2 delamanid
fbiC 1303704 c.774T>C synonymous_variant 0.19 delamanid
fbiC 1303713 c.783C>G synonymous_variant 0.18 delamanid
fbiC 1303727 p.Thr266Asn missense_variant 0.16 delamanid
fbiC 1303731 c.801A>G synonymous_variant 0.16 delamanid
fbiC 1303732 p.Ser268Thr missense_variant 0.16 delamanid
fbiC 1303746 p.Asp272Glu missense_variant 0.17 delamanid
fbiC 1303750 p.Leu274Ile missense_variant 0.17 delamanid
fbiC 1303761 c.831T>C synonymous_variant 0.18 delamanid
fbiC 1303768 p.Ser280Val missense_variant 0.13 delamanid
fbiC 1303779 c.849G>A synonymous_variant 0.11 delamanid
fbiC 1303785 c.855G>C synonymous_variant 0.11 delamanid
fbiC 1303788 c.858T>C synonymous_variant 0.11 delamanid
fbiC 1303789 p.Ile287Val missense_variant 0.11 delamanid
fbiC 1303794 c.864A>G synonymous_variant 0.11 delamanid
fbiC 1304598 c.1668C>T synonymous_variant 0.35 delamanid
fbiC 1304613 c.1683T>C synonymous_variant 0.4 delamanid
fbiC 1304634 c.1704C>G synonymous_variant 0.47 delamanid
fbiC 1304640 c.1710A>C synonymous_variant 0.47 delamanid
fbiC 1304658 c.1728C>G synonymous_variant 0.43 delamanid
fbiC 1304660 p.Tyr577Phe missense_variant 0.43 delamanid
fbiC 1304664 c.1734G>A synonymous_variant 0.41 delamanid
fbiC 1304670 c.1740G>C synonymous_variant 0.39 delamanid
fbiC 1304671 c.1742delT frameshift_variant 0.39 delamanid
fbiC 1304676 c.1747dupG frameshift_variant 0.39 delamanid
fbiC 1304682 c.1752C>G synonymous_variant 0.36 delamanid
fbiC 1304684 p.Ala585Gly missense_variant 0.38 delamanid
fbiC 1304691 c.1761G>C synonymous_variant 0.37 delamanid
fbiC 1304694 c.1764A>C synonymous_variant 0.38 delamanid
fbiC 1304703 c.1773C>G synonymous_variant 0.37 delamanid
fbiC 1304704 p.His592Tyr missense_variant 0.37 delamanid
fbiC 1304724 c.1794A>G synonymous_variant 0.37 delamanid
fbiC 1304727 c.1797A>C synonymous_variant 0.36 delamanid
fbiC 1304742 c.1812T>C synonymous_variant 0.24 delamanid
Rv1258c 1406760 c.580_581insC frameshift_variant 0.96 streptomycin Uncertain significance
pyrazinamide Uncertain significance
isoniazid Uncertain significance
atpE 1460885 c.-160G>C upstream_gene_variant 0.1 bedaquiline
atpE 1460894 c.-151A>G upstream_gene_variant 0.11 bedaquiline
atpE 1460895 c.-150_-148delGCAinsTCG upstream_gene_variant 0.11 bedaquiline
atpE 1460900 c.-145T>C upstream_gene_variant 0.11 bedaquiline
atpE 1460915 c.-130C>T upstream_gene_variant 0.12 bedaquiline
atpE 1460916 c.-129_-127delGCAinsCTT upstream_gene_variant 0.12 bedaquiline
atpE 1460933 c.-112T>C upstream_gene_variant 0.11 bedaquiline
atpE 1460936 c.-109T>C upstream_gene_variant 0.11 bedaquiline
atpE 1460940 c.-105C>T upstream_gene_variant 0.11 bedaquiline
atpE 1461080 c.36C>T synonymous_variant 0.39 bedaquiline
atpE 1461086 c.42A>G synonymous_variant 0.42 bedaquiline
atpE 1461087 c.43C>T synonymous_variant 0.42 bedaquiline
atpE 1461101 c.57T>A synonymous_variant 0.67 bedaquiline
atpE 1461113 c.69C>T synonymous_variant 0.68 bedaquiline
atpE 1461132 p.Val30Ile missense_variant 0.77 bedaquiline
atpE 1461146 c.102G>T synonymous_variant 0.81 bedaquiline
atpE 1461149 c.105T>G synonymous_variant 0.81 bedaquiline
atpE 1461161 c.117C>G synonymous_variant 0.75 bedaquiline
atpE 1461164 c.120C>T synonymous_variant 0.75 bedaquiline
atpE 1461167 c.123G>T synonymous_variant 0.74 bedaquiline
atpE 1461170 c.126A>G synonymous_variant 0.76 bedaquiline
atpE 1461179 c.135G>T synonymous_variant 0.74 bedaquiline
atpE 1461182 c.138A>G synonymous_variant 0.74 bedaquiline
atpE 1461185 c.141G>C synonymous_variant 0.71 bedaquiline
atpE 1461197 c.153A>C synonymous_variant 0.72 bedaquiline
atpE 1461219 c.175T>C synonymous_variant 0.68 bedaquiline
atpE 1461230 c.186G>T synonymous_variant 0.6 bedaquiline
atpE 1461233 c.189A>G synonymous_variant 0.59 bedaquiline
atpE 1461251 c.207G>C synonymous_variant 0.5 bedaquiline
atpE 1461254 c.210T>C synonymous_variant 0.46 bedaquiline
atpE 1461261 c.217C>T synonymous_variant 0.4 bedaquiline
atpE 1461275 c.231T>G synonymous_variant 0.14 bedaquiline
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1471922 n.78delT non_coding_transcript_exon_variant 0.62 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1471925 n.80T>C non_coding_transcript_exon_variant 0.62 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1471931 n.87delA non_coding_transcript_exon_variant 0.63 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1471934 n.89A>G non_coding_transcript_exon_variant 0.63 linezolid
kanamycin
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin Uncertain significance
rrs 1471985 n.140T>C non_coding_transcript_exon_variant 0.7 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1471986 n.141C>T non_coding_transcript_exon_variant 0.69 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin Uncertain significance
rrs 1472030 n.185G>A non_coding_transcript_exon_variant 0.64 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472031 n.186G>C non_coding_transcript_exon_variant 0.64 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472032 n.187G>A non_coding_transcript_exon_variant 0.64 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin Uncertain significance
rrs 1472033 n.188A>C non_coding_transcript_exon_variant 0.64 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472035 n.190G>T non_coding_transcript_exon_variant 0.62 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472040 n.195T>G non_coding_transcript_exon_variant 0.6 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472041 n.196C>T non_coding_transcript_exon_variant 0.6 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin Uncertain significance
rrs 1472042 n.197T>G non_coding_transcript_exon_variant 0.6 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472043 n.198T>A non_coding_transcript_exon_variant 0.6 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472050 n.205G>C non_coding_transcript_exon_variant 0.64 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472053 n.211_212delGC non_coding_transcript_exon_variant 0.64 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472061 n.216A>T non_coding_transcript_exon_variant 0.68 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472106 n.261G>A non_coding_transcript_exon_variant 0.78 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472108 n.263C>T non_coding_transcript_exon_variant 0.76 linezolid
kanamycin Uncertain significance
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472113 n.268T>C non_coding_transcript_exon_variant 0.78 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin Uncertain significance
rrs 1472150 n.305T>A non_coding_transcript_exon_variant 0.76 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472251 n.406G>A non_coding_transcript_exon_variant 0.62 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472286 n.441C>G non_coding_transcript_exon_variant 0.33 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472287 n.442C>T non_coding_transcript_exon_variant 0.29 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472289 n.444T>G non_coding_transcript_exon_variant 0.29 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472290 n.445C>G non_coding_transcript_exon_variant 0.29 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472297 n.453_465delGTCCGGGTTCTCT non_coding_transcript_exon_variant 0.29 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472315 n.470T>G non_coding_transcript_exon_variant 0.24 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472324 n.479G>C non_coding_transcript_exon_variant 0.25 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472325 n.480G>C non_coding_transcript_exon_variant 0.25 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472327 n.482G>A non_coding_transcript_exon_variant 0.24 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472328 n.483G>C non_coding_transcript_exon_variant 0.27 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472337 n.492C>G non_coding_transcript_exon_variant 0.35 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472380 n.535G>C non_coding_transcript_exon_variant 0.54 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472446 n.601T>A non_coding_transcript_exon_variant 0.73 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472452 n.607G>A non_coding_transcript_exon_variant 0.72 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472464 n.619A>G non_coding_transcript_exon_variant 0.75 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472612 n.767G>T non_coding_transcript_exon_variant 0.81 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472734 n.889C>T non_coding_transcript_exon_variant 0.8 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472741 n.896G>A non_coding_transcript_exon_variant 0.79 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472846 n.1001C>T non_coding_transcript_exon_variant 0.75 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472847 n.1002G>A non_coding_transcript_exon_variant 0.75 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472848 n.1003T>C non_coding_transcript_exon_variant 0.75 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472860 n.1015C>T non_coding_transcript_exon_variant 0.78 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1472861 n.1016G>A non_coding_transcript_exon_variant 0.77 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472956 n.1111T>C non_coding_transcript_exon_variant 0.83 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472957 n.1112C>T non_coding_transcript_exon_variant 0.83 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin Uncertain significance
rrs 1472969 n.1124A>G non_coding_transcript_exon_variant 0.84 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472970 n.1125C>G non_coding_transcript_exon_variant 0.84 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472977 n.1132G>C non_coding_transcript_exon_variant 0.83 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472978 n.1133T>C non_coding_transcript_exon_variant 0.83 linezolid
kanamycin
capreomycin
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472989 n.1144G>A non_coding_transcript_exon_variant 0.81 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1472990 n.1145A>G non_coding_transcript_exon_variant 0.81 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1473082 n.1237G>A non_coding_transcript_exon_variant 0.8 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1473088 n.1243A>G non_coding_transcript_exon_variant 0.8 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1473099 n.1254T>A non_coding_transcript_exon_variant 0.78 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1473104 n.1259C>T non_coding_transcript_exon_variant 0.78 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1473105 n.1260G>A non_coding_transcript_exon_variant 0.78 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1473110 n.1265T>G non_coding_transcript_exon_variant 0.77 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1473111 n.1266A>G non_coding_transcript_exon_variant 0.77 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1473121 n.1276T>C non_coding_transcript_exon_variant 0.77 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1473123 n.1278A>T non_coding_transcript_exon_variant 0.79 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1473129 n.1284C>T non_coding_transcript_exon_variant 0.8 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1473145 n.1300C>T non_coding_transcript_exon_variant 0.82 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1473166 n.1321G>A non_coding_transcript_exon_variant 0.82 linezolid
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
aminoglycosides
streptomycin
rrs 1473288 n.1443C>T non_coding_transcript_exon_variant 0.81 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1473290 n.1445C>T non_coding_transcript_exon_variant 0.8 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrs 1473291 n.1446G>T non_coding_transcript_exon_variant 0.8 linezolid
kanamycin
capreomycin
amikacin
aminoglycosides
streptomycin
rrl 1473684 n.27G>A non_coding_transcript_exon_variant 0.39 linezolid
rrl 1473699 n.43delG non_coding_transcript_exon_variant 0.37 linezolid
rrl 1473707 n.50T>A non_coding_transcript_exon_variant 0.47 linezolid
rrl 1473717 n.60G>A non_coding_transcript_exon_variant 0.5 linezolid Uncertain significance
rrl 1473731 n.74T>A non_coding_transcript_exon_variant 0.58 linezolid
rrl 1473746 n.89T>C non_coding_transcript_exon_variant 0.62 linezolid
rrl 1473756 n.99G>T non_coding_transcript_exon_variant 0.64 linezolid
rrl 1473758 n.101G>T non_coding_transcript_exon_variant 0.64 linezolid
rrl 1473770 n.113T>C non_coding_transcript_exon_variant 0.69 linezolid
rrl 1473806 n.149C>T non_coding_transcript_exon_variant 0.72 linezolid
rrl 1473812 n.155G>A non_coding_transcript_exon_variant 0.69 linezolid
rrl 1473814 n.157A>T non_coding_transcript_exon_variant 0.7 linezolid
rrl 1473815 n.158T>G non_coding_transcript_exon_variant 0.7 linezolid
rrl 1473829 n.172G>C non_coding_transcript_exon_variant 0.73 linezolid
rrl 1473831 n.174G>T non_coding_transcript_exon_variant 0.71 linezolid
rrl 1473832 n.175C>T non_coding_transcript_exon_variant 0.72 linezolid
rrl 1473839 n.182G>A non_coding_transcript_exon_variant 0.74 linezolid
rrl 1473876 n.219G>A non_coding_transcript_exon_variant 0.73 linezolid
rrl 1473887 n.230T>C non_coding_transcript_exon_variant 0.72 linezolid
rrl 1473888 n.231T>C non_coding_transcript_exon_variant 0.71 linezolid
rrl 1473898 n.241C>T non_coding_transcript_exon_variant 0.67 linezolid Uncertain significance
rrl 1473899 n.242A>G non_coding_transcript_exon_variant 0.67 linezolid
rrl 1473916 n.259C>A non_coding_transcript_exon_variant 0.65 linezolid
rrl 1473923 n.266C>G non_coding_transcript_exon_variant 0.61 linezolid
rrl 1473924 n.267_268insT non_coding_transcript_exon_variant 0.63 linezolid
rrl 1473937 n.280C>T non_coding_transcript_exon_variant 0.63 linezolid
rrl 1473943 n.286G>T non_coding_transcript_exon_variant 0.57 linezolid
rrl 1473945 n.288T>A non_coding_transcript_exon_variant 0.57 linezolid
rrl 1473946 n.289A>T non_coding_transcript_exon_variant 0.57 linezolid
rrl 1473950 n.293G>T non_coding_transcript_exon_variant 0.59 linezolid
rrl 1474030 n.373G>A non_coding_transcript_exon_variant 0.32 linezolid
rrl 1474044 n.387C>T non_coding_transcript_exon_variant 0.43 linezolid
rrl 1474051 n.394T>C non_coding_transcript_exon_variant 0.42 linezolid
rrl 1474054 n.397T>C non_coding_transcript_exon_variant 0.42 linezolid Uncertain significance
rrl 1474056 n.399T>C non_coding_transcript_exon_variant 0.39 linezolid
rrl 1474061 n.404T>C non_coding_transcript_exon_variant 0.38 linezolid
rrl 1474074 n.417C>T non_coding_transcript_exon_variant 0.49 linezolid
rrl 1474089 n.432C>T non_coding_transcript_exon_variant 0.51 linezolid
rrl 1474093 n.436G>A non_coding_transcript_exon_variant 0.51 linezolid
rrl 1474100 n.443C>T non_coding_transcript_exon_variant 0.52 linezolid
rrl 1474103 n.446A>C non_coding_transcript_exon_variant 0.53 linezolid
rrl 1474106 n.449_450insCT non_coding_transcript_exon_variant 0.46 linezolid
rrl 1474109 n.453_454delAT non_coding_transcript_exon_variant 0.47 linezolid
rrl 1474130 n.473C>T non_coding_transcript_exon_variant 0.6 linezolid
rrl 1474140 n.483C>T non_coding_transcript_exon_variant 0.61 linezolid
rrl 1474151 n.494C>T non_coding_transcript_exon_variant 0.66 linezolid
rrl 1474181 n.524_525insT non_coding_transcript_exon_variant 0.55 linezolid
rrl 1474184 n.527C>A non_coding_transcript_exon_variant 0.54 linezolid
rrl 1474185 n.529delA non_coding_transcript_exon_variant 0.55 linezolid
rrl 1474249 n.592G>T non_coding_transcript_exon_variant 0.73 linezolid
rrl 1474263 n.606G>A non_coding_transcript_exon_variant 0.71 linezolid
rrl 1474282 n.625G>A non_coding_transcript_exon_variant 0.68 linezolid
rrl 1474308 n.651G>T non_coding_transcript_exon_variant 0.66 linezolid
rrl 1474310 n.653T>G non_coding_transcript_exon_variant 0.68 linezolid
rrl 1474356 n.699T>C non_coding_transcript_exon_variant 0.71 linezolid
rrl 1474362 n.705A>G non_coding_transcript_exon_variant 0.7 linezolid
rrl 1474387 n.730C>T non_coding_transcript_exon_variant 0.68 linezolid
rrl 1474413 n.756A>C non_coding_transcript_exon_variant 0.63 linezolid
rrl 1474415 n.759_781delCACACGCGCATACGCGCGTGTGA non_coding_transcript_exon_variant 0.68 linezolid
rrl 1474496 n.839C>G non_coding_transcript_exon_variant 0.71 linezolid
rrl 1474497 n.840G>C non_coding_transcript_exon_variant 0.71 linezolid
rrl 1474506 n.849C>G non_coding_transcript_exon_variant 0.71 linezolid
rrl 1474507 n.850G>C non_coding_transcript_exon_variant 0.71 linezolid
rrl 1474626 n.969T>C non_coding_transcript_exon_variant 0.73 linezolid
rrl 1474632 n.975G>T non_coding_transcript_exon_variant 0.7 linezolid
rrl 1474636 n.979A>T non_coding_transcript_exon_variant 0.7 linezolid
rrl 1474637 n.980C>T non_coding_transcript_exon_variant 0.69 linezolid
rrl 1474638 n.981C>G non_coding_transcript_exon_variant 0.69 linezolid
rrl 1474639 n.982G>T non_coding_transcript_exon_variant 0.69 linezolid
rrl 1474640 n.983C>T non_coding_transcript_exon_variant 0.69 linezolid
rrl 1474717 n.1060A>G non_coding_transcript_exon_variant 0.69 linezolid
rrl 1474722 n.1065T>C non_coding_transcript_exon_variant 0.69 linezolid
rrl 1474743 n.1086T>G non_coding_transcript_exon_variant 0.73 linezolid
rrl 1474760 n.1103A>G non_coding_transcript_exon_variant 0.75 linezolid
rrl 1474794 n.1137C>T non_coding_transcript_exon_variant 0.76 linezolid
rrl 1474803 n.1146G>A non_coding_transcript_exon_variant 0.77 linezolid
rrl 1474812 n.1155G>A non_coding_transcript_exon_variant 0.78 linezolid
rrl 1474830 n.1173A>G non_coding_transcript_exon_variant 0.77 linezolid
rrl 1474913 n.1256T>C non_coding_transcript_exon_variant 0.59 linezolid
rrl 1474932 n.1275C>T non_coding_transcript_exon_variant 0.58 linezolid
rrl 1475031 n.1374G>C non_coding_transcript_exon_variant 0.39 linezolid
rrl 1475061 n.1406delA non_coding_transcript_exon_variant 0.53 linezolid
rrl 1475076 n.1419C>A non_coding_transcript_exon_variant 0.62 linezolid
rrl 1475090 n.1433A>T non_coding_transcript_exon_variant 0.67 linezolid
rrl 1475114 n.1457C>T non_coding_transcript_exon_variant 0.72 linezolid Uncertain significance
rrl 1475120 n.1463G>T non_coding_transcript_exon_variant 0.71 linezolid
rrl 1475129 n.1472G>A non_coding_transcript_exon_variant 0.71 linezolid
rrl 1475202 n.1545G>C non_coding_transcript_exon_variant 0.52 linezolid
rrl 1475209 n.1552G>A non_coding_transcript_exon_variant 0.45 linezolid
rrl 1475213 n.1556C>T non_coding_transcript_exon_variant 0.43 linezolid
rrl 1475220 n.1563G>T non_coding_transcript_exon_variant 0.34 linezolid
rrl 1475429 n.1772G>A non_coding_transcript_exon_variant 0.39 linezolid
rrl 1475443 n.1786G>A non_coding_transcript_exon_variant 0.47 linezolid
rrl 1475452 n.1795C>A non_coding_transcript_exon_variant 0.52 linezolid
rrl 1475475 n.1818C>T non_coding_transcript_exon_variant 0.59 linezolid
rrl 1475479 n.1822C>T non_coding_transcript_exon_variant 0.61 linezolid Uncertain significance
rrl 1475480 n.1823A>T non_coding_transcript_exon_variant 0.61 linezolid
rrl 1475505 n.1848G>A non_coding_transcript_exon_variant 0.64 linezolid
rrl 1475526 n.1869C>A non_coding_transcript_exon_variant 0.63 linezolid
rrl 1475531 n.1874C>T non_coding_transcript_exon_variant 0.65 linezolid
rrl 1475573 n.1916G>A non_coding_transcript_exon_variant 0.51 linezolid
rrl 1475649 n.1992A>G non_coding_transcript_exon_variant 0.19 linezolid
rrl 1475659 n.2002G>A non_coding_transcript_exon_variant 0.38 linezolid
rrl 1475760 n.2105_2106delGC non_coding_transcript_exon_variant 0.81 linezolid
rrl 1475764 n.2107A>T non_coding_transcript_exon_variant 0.8 linezolid
rrl 1475765 n.2108A>T non_coding_transcript_exon_variant 0.8 linezolid
rrl 1475975 n.2318C>T non_coding_transcript_exon_variant 0.54 linezolid
rrl 1475977 n.2320A>G non_coding_transcript_exon_variant 0.53 linezolid
rrl 1475988 n.2331A>G non_coding_transcript_exon_variant 0.42 linezolid Uncertain significance
rrl 1475989 n.2332T>C non_coding_transcript_exon_variant 0.42 linezolid
rrl 1475993 n.2336C>T non_coding_transcript_exon_variant 0.46 linezolid Uncertain significance
rrl 1475997 n.2340A>T non_coding_transcript_exon_variant 0.46 linezolid
rrl 1476030 n.2373A>G non_coding_transcript_exon_variant 0.12 linezolid
rrl 1476032 n.2375C>A non_coding_transcript_exon_variant 0.12 linezolid
rrl 1476033 n.2376T>G non_coding_transcript_exon_variant 0.12 linezolid
rrl 1476034 n.2377C>G non_coding_transcript_exon_variant 0.12 linezolid
rrl 1476035 n.2378G>C non_coding_transcript_exon_variant 0.12 linezolid
rrl 1476044 n.2387T>G non_coding_transcript_exon_variant 0.12 linezolid
rrl 1476045 n.2388G>T non_coding_transcript_exon_variant 0.12 linezolid
rrl 1476046 n.2389G>T non_coding_transcript_exon_variant 0.12 linezolid
rrl 1476047 n.2390G>T non_coding_transcript_exon_variant 0.12 linezolid
rrl 1476049 n.2392C>T non_coding_transcript_exon_variant 0.12 linezolid
rrl 1476056 n.2399G>A non_coding_transcript_exon_variant 0.23 linezolid Uncertain significance
rrl 1476058 n.2401T>C non_coding_transcript_exon_variant 0.26 linezolid
rrl 1476085 n.2428G>A non_coding_transcript_exon_variant 0.43 linezolid
rrl 1476086 n.2429G>A non_coding_transcript_exon_variant 0.43 linezolid
rrl 1476088 n.2431A>C non_coding_transcript_exon_variant 0.42 linezolid
rrl 1476099 n.2442A>G non_coding_transcript_exon_variant 0.42 linezolid
rrl 1476103 n.2446C>G non_coding_transcript_exon_variant 0.42 linezolid
rrl 1476105 n.2448G>A non_coding_transcript_exon_variant 0.42 linezolid
rrl 1476106 n.2449A>T non_coding_transcript_exon_variant 0.42 linezolid
rrl 1476110 n.2453G>C non_coding_transcript_exon_variant 0.42 linezolid
rrl 1476114 n.2457T>C non_coding_transcript_exon_variant 0.41 linezolid Uncertain significance
rrl 1476115 n.2458T>C non_coding_transcript_exon_variant 0.42 linezolid
rrl 1476131 n.2474C>T non_coding_transcript_exon_variant 0.55 linezolid
rrl 1476160 n.2503T>C non_coding_transcript_exon_variant 0.63 linezolid
rrl 1476214 n.2557G>T non_coding_transcript_exon_variant 0.67 linezolid
rrl 1476215 n.2558C>T non_coding_transcript_exon_variant 0.67 linezolid
rrl 1476221 n.2564T>C non_coding_transcript_exon_variant 0.67 linezolid
rrl 1476224 n.2567A>G non_coding_transcript_exon_variant 0.71 linezolid
rrl 1476251 n.2594T>C non_coding_transcript_exon_variant 0.75 linezolid
rrl 1476281 n.2624T>C non_coding_transcript_exon_variant 0.73 linezolid
rrl 1476297 n.2640C>T non_coding_transcript_exon_variant 0.74 linezolid
rrl 1476299 n.2642C>T non_coding_transcript_exon_variant 0.73 linezolid Uncertain significance
rrl 1476584 n.2927C>T non_coding_transcript_exon_variant 0.77 linezolid
rrl 1476594 n.2937C>T non_coding_transcript_exon_variant 0.73 linezolid
rrl 1476597 n.2940G>A non_coding_transcript_exon_variant 0.71 linezolid
rrl 1476603 n.2946G>A non_coding_transcript_exon_variant 0.71 linezolid
rrl 1476608 n.2951C>G non_coding_transcript_exon_variant 0.69 linezolid
rrl 1476619 n.2962C>T non_coding_transcript_exon_variant 0.63 linezolid
rrl 1476628 n.2971T>A non_coding_transcript_exon_variant 0.6 linezolid
rrl 1476665 n.3008T>A non_coding_transcript_exon_variant 0.38 linezolid
rrl 1476666 n.3009C>T non_coding_transcript_exon_variant 0.38 linezolid
rrl 1476674 n.3017T>C non_coding_transcript_exon_variant 0.31 linezolid Uncertain significance
rrl 1476684 n.3027C>T non_coding_transcript_exon_variant 0.18 linezolid
rrl 1476689 n.3032A>T non_coding_transcript_exon_variant 0.11 linezolid
rrl 1476690 n.3033C>T non_coding_transcript_exon_variant 0.11 linezolid
rrl 1476693 n.3036G>A non_coding_transcript_exon_variant 0.12 linezolid
rrl 1476695 n.3038T>A non_coding_transcript_exon_variant 0.12 linezolid
inhA 1674855 c.654C>G synonymous_variant 0.2 ethionamide
isoniazid
inhA 1674858 c.657G>A synonymous_variant 0.19 ethionamide
isoniazid
inhA 1674876 c.675C>T synonymous_variant 0.22 ethionamide
isoniazid
inhA 1674879 c.678T>C synonymous_variant 0.22 ethionamide
isoniazid
inhA 1674892 p.Asn231Asp missense_variant 0.21 ethionamide
isoniazid
inhA 1674903 c.702T>C synonymous_variant 0.19 ethionamide
isoniazid
inhA 1674904 p.Ala235Pro missense_variant 0.19 ethionamide
isoniazid
inhA 1674909 c.708G>A synonymous_variant 0.19 ethionamide
isoniazid
inhA 1674912 c.711G>C synonymous_variant 0.19 ethionamide
isoniazid
inhA 1674915 c.714C>G synonymous_variant 0.19 ethionamide
isoniazid
inhA 1674942 c.741T>C synonymous_variant 0.18 ethionamide
isoniazid
inhA 1674949 c.748C>T synonymous_variant 0.16 ethionamide
isoniazid
inhA 1674954 c.753G>C synonymous_variant 0.15 ethionamide
isoniazid
inhA 1674957 c.756G>C synonymous_variant 0.15 ethionamide
isoniazid
inhA 1674963 c.762G>C synonymous_variant 0.15 ethionamide
isoniazid
inhA 1674966 c.765T>C synonymous_variant 0.16 ethionamide
isoniazid
inhA 1674975 c.774C>T synonymous_variant 0.13 ethionamide
isoniazid
inhA 1674977 p.Tyr259Phe missense_variant 0.13 ethionamide
isoniazid
inhA 1674993 c.792G>T synonymous_variant 0.1 ethionamide
isoniazid
rpsA 1833511 c.-31G>T upstream_gene_variant 0.21 pyrazinamide
rpsA 1833514 c.-28C>A upstream_gene_variant 0.21 pyrazinamide
rpsA 1833517 c.-24delC upstream_gene_variant 0.24 pyrazinamide
rpsA 1833536 c.-6A>C upstream_gene_variant 0.4 pyrazinamide
rpsA 1833547 c.6G>A synonymous_variant 0.46 pyrazinamide
rpsA 1833589 c.48A>C synonymous_variant 0.55 pyrazinamide
rpsA 1833595 c.54T>G synonymous_variant 0.54 pyrazinamide
rpsA 1833596 p.Ser19Ala missense_variant 0.55 pyrazinamide
rpsA 1833604 c.63C>T synonymous_variant 0.54 pyrazinamide
rpsA 1833616 c.75A>T synonymous_variant 0.53 pyrazinamide
rpsA 1833619 c.78A>C synonymous_variant 0.54 pyrazinamide
rpsA 1833625 c.84A>G synonymous_variant 0.59 pyrazinamide
rpsA 1833664 c.123C>G synonymous_variant 0.68 pyrazinamide
rpsA 1833676 c.135A>G synonymous_variant 0.69 pyrazinamide
rpsA 1833679 c.138G>T synonymous_variant 0.69 pyrazinamide
rpsA 1833685 c.144G>C synonymous_variant 0.68 pyrazinamide
rpsA 1833691 c.150G>A synonymous_variant 0.68 pyrazinamide
rpsA 1833694 c.153G>T synonymous_variant 0.67 pyrazinamide
rpsA 1833697 c.156C>T synonymous_variant 0.67 pyrazinamide
rpsA 1833700 c.159C>T synonymous_variant 0.7 pyrazinamide
rpsA 1833709 c.168C>T synonymous_variant 0.74 pyrazinamide
rpsA 1833724 c.183C>T synonymous_variant 0.73 pyrazinamide
rpsA 1833727 c.186G>C synonymous_variant 0.74 pyrazinamide
rpsA 1833733 c.192C>G synonymous_variant 0.72 pyrazinamide
rpsA 1833734 p.Ala65Ser missense_variant 0.73 pyrazinamide
rpsA 1833742 c.201A>G synonymous_variant 0.7 pyrazinamide
rpsA 1833745 c.204G>C synonymous_variant 0.71 pyrazinamide
rpsA 1833748 c.207C>G synonymous_variant 0.69 pyrazinamide
rpsA 1833760 c.219C>T synonymous_variant 0.72 pyrazinamide
rpsA 1833787 c.246C>G synonymous_variant 0.68 pyrazinamide
rpsA 1833790 c.249T>C synonymous_variant 0.68 pyrazinamide
rpsA 1833802 c.261A>G synonymous_variant 0.7 pyrazinamide
rpsA 1833811 c.270G>T synonymous_variant 0.71 pyrazinamide
rpsA 1833823 c.282G>A synonymous_variant 0.73 pyrazinamide
rpsA 1833832 c.291G>A synonymous_variant 0.74 pyrazinamide
rpsA 1833838 c.297G>C synonymous_variant 0.75 pyrazinamide
rpsA 1833841 c.300C>G synonymous_variant 0.76 pyrazinamide
rpsA 1833847 c.306C>G synonymous_variant 0.76 pyrazinamide
rpsA 1833856 c.315A>G synonymous_variant 0.73 pyrazinamide
rpsA 1833862 c.321G>T synonymous_variant 0.76 pyrazinamide
rpsA 1833874 c.333T>G synonymous_variant 0.76 pyrazinamide
rpsA 1833886 c.345C>G synonymous_variant 0.73 pyrazinamide
rpsA 1833894 p.Ala118Glu missense_variant 0.75 pyrazinamide
rpsA 1833928 c.387G>C synonymous_variant 0.75 pyrazinamide
rpsA 1833949 c.408T>C synonymous_variant 0.76 pyrazinamide
rpsA 1833961 c.420C>G synonymous_variant 0.78 pyrazinamide
rpsA 1833970 c.429G>T synonymous_variant 0.78 pyrazinamide
rpsA 1833979 c.438T>C synonymous_variant 0.78 pyrazinamide
rpsA 1833991 c.450C>G synonymous_variant 0.78 pyrazinamide
rpsA 1834000 c.459G>C synonymous_variant 0.76 pyrazinamide
rpsA 1834009 c.468C>T synonymous_variant 0.76 pyrazinamide
rpsA 1834012 c.471G>C synonymous_variant 0.76 pyrazinamide
rpsA 1834015 c.474G>C synonymous_variant 0.76 pyrazinamide
rpsA 1834021 c.480C>T synonymous_variant 0.76 pyrazinamide
rpsA 1834030 c.489C>G synonymous_variant 0.76 pyrazinamide
rpsA 1834033 c.492C>T synonymous_variant 0.75 pyrazinamide
rpsA 1834073 p.Lys178Arg missense_variant 0.59 pyrazinamide
rpsA 1834096 c.555G>C synonymous_variant 0.47 pyrazinamide
rpsA 1834099 c.558C>G synonymous_variant 0.44 pyrazinamide
rpsA 1834108 c.567C>G synonymous_variant 0.37 pyrazinamide
rpsA 1834114 c.573G>C synonymous_variant 0.33 pyrazinamide
rpsA 1834177 c.636A>C synonymous_variant 0.93 pyrazinamide
rpsA 1834228 c.687C>A synonymous_variant 0.61 pyrazinamide
rpsA 1834231 c.690T>G synonymous_variant 0.61 pyrazinamide
rpsA 1834234 c.693G>T synonymous_variant 0.61 pyrazinamide
rpsA 1834240 c.699T>C synonymous_variant 0.62 pyrazinamide
rpsA 1834246 c.705G>T synonymous_variant 0.61 pyrazinamide
rpsA 1834249 c.708T>C synonymous_variant 0.6 pyrazinamide
rpsA 1834252 c.711C>G synonymous_variant 0.61 pyrazinamide
rpsA 1834261 c.720A>G synonymous_variant 0.61 pyrazinamide
rpsA 1834264 c.723G>C synonymous_variant 0.59 pyrazinamide
rpsA 1834279 c.738C>T synonymous_variant 0.64 pyrazinamide
rpsA 1834294 c.753G>T synonymous_variant 0.67 pyrazinamide
rpsA 1834297 c.756C>T synonymous_variant 0.68 pyrazinamide
rpsA 1834303 c.762T>G synonymous_variant 0.69 pyrazinamide
rpsA 1834306 c.765T>C synonymous_variant 0.71 pyrazinamide
rpsA 1834327 c.786G>T synonymous_variant 0.71 pyrazinamide
rpsA 1834357 c.816T>C synonymous_variant 0.72 pyrazinamide
rpsA 1834366 c.825A>G synonymous_variant 0.73 pyrazinamide
rpsA 1834375 c.834G>C synonymous_variant 0.74 pyrazinamide
rpsA 1834396 c.855G>C synonymous_variant 0.71 pyrazinamide
rpsA 1834411 c.870T>G synonymous_variant 0.69 pyrazinamide
rpsA 1834414 c.873C>T synonymous_variant 0.69 pyrazinamide
rpsA 1834417 c.876G>C synonymous_variant 0.69 pyrazinamide
rpsA 1834423 c.882G>C synonymous_variant 0.68 pyrazinamide
rpsA 1834429 c.888C>T synonymous_variant 0.66 pyrazinamide
rpsA 1834438 c.897C>T synonymous_variant 0.68 pyrazinamide
rpsA 1834451 c.910T>C synonymous_variant 0.68 pyrazinamide
rpsA 1834456 c.915T>G synonymous_variant 0.68 pyrazinamide
rpsA 1834468 c.927A>G synonymous_variant 0.69 pyrazinamide
rpsA 1834477 c.936C>T synonymous_variant 0.7 pyrazinamide
rpsA 1834489 c.948T>C synonymous_variant 0.68 pyrazinamide
rpsA 1834519 c.978G>C synonymous_variant 0.65 pyrazinamide
rpsA 1834520 p.Ala327Ser missense_variant 0.65 pyrazinamide
rpsA 1834528 c.987T>C synonymous_variant 0.66 pyrazinamide
rpsA 1834534 c.993C>T synonymous_variant 0.66 pyrazinamide
rpsA 1834543 c.1002C>G synonymous_variant 0.65 pyrazinamide
rpsA 1834546 c.1005T>C synonymous_variant 0.66 pyrazinamide
rpsA 1834552 c.1011G>T synonymous_variant 0.64 pyrazinamide
rpsA 1834555 c.1014T>G synonymous_variant 0.64 pyrazinamide
rpsA 1834557 p.Ala339Gly missense_variant 0.63 pyrazinamide
rpsA 1834606 c.1065C>T synonymous_variant 0.6 pyrazinamide
rpsA 1834609 c.1068T>C synonymous_variant 0.57 pyrazinamide
rpsA 1834619 c.1078T>C synonymous_variant 0.48 pyrazinamide
rpsA 1834622 c.1081_1083delTCGinsAGC synonymous_variant 0.47 pyrazinamide
rpsA 1834633 c.1092A>G synonymous_variant 0.52 pyrazinamide
rpsA 1834639 c.1098T>C synonymous_variant 0.53 pyrazinamide
rpsA 1834645 c.1104C>T synonymous_variant 0.53 pyrazinamide
rpsA 1834666 c.1125G>C synonymous_variant 0.49 pyrazinamide
rpsA 1834667 p.Ala376Ser missense_variant 0.49 pyrazinamide
rpsA 1834690 c.1149T>C synonymous_variant 0.54 pyrazinamide
rpsA 1834698 c.1157_1158insC frameshift_variant 0.54 pyrazinamide
rpsA 1834701 p.Gln387Pro missense_variant 0.54 pyrazinamide
rpsA 1834704 c.1164delC frameshift_variant 0.53 pyrazinamide
rpsA 1834720 c.1179C>G synonymous_variant 0.5 pyrazinamide
rpsA 1834732 c.1191T>C synonymous_variant 0.46 pyrazinamide
rpsA 1834738 c.1197A>G synonymous_variant 0.43 pyrazinamide
rpsA 1834753 c.1212T>C synonymous_variant 0.39 pyrazinamide
rpsA 1834759 c.1218A>C synonymous_variant 0.37 pyrazinamide
rpsA 1834765 p.Glu408Asp missense_variant 0.34 pyrazinamide
rpsA 1834774 c.1233C>T synonymous_variant 0.31 pyrazinamide
rpsA 1834776 p.Ala412Glu missense_variant 0.3 pyrazinamide
rpsA 1834780 c.1239A>G synonymous_variant 0.28 pyrazinamide
rpsA 1834789 c.1248T>C synonymous_variant 0.28 pyrazinamide
rpsA 1834813 c.1272G>T synonymous_variant 0.26 pyrazinamide
rpsA 1834830 p.Ala430Val missense_variant 0.11 pyrazinamide
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin
katG 2154724 p.Arg463Leu missense_variant 1.0 isoniazid Uncertain significance
PPE35 2167926 p.Leu896Ser missense_variant 1.0 pyrazinamide Uncertain significance
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Uncertain significance
bedaquiline Uncertain significance
pncA 2289365 c.-125delC upstream_gene_variant 0.14 pyrazinamide
kasA 2517917 c.-198G>C upstream_gene_variant 0.63 isoniazid
kasA 2517941 c.-174C>G upstream_gene_variant 0.66 isoniazid
kasA 2517953 c.-162C>T upstream_gene_variant 0.63 isoniazid
kasA 2517962 c.-153C>G upstream_gene_variant 0.55 isoniazid
kasA 2517968 c.-147T>A upstream_gene_variant 0.51 isoniazid
kasA 2517974 c.-141T>C upstream_gene_variant 0.48 isoniazid
kasA 2517989 c.-126T>C upstream_gene_variant 0.36 isoniazid
kasA 2517992 c.-123C>G upstream_gene_variant 0.33 isoniazid
kasA 2517993 c.-122_-121delGCinsAA upstream_gene_variant 0.33 isoniazid
kasA 2518002 c.-113C>G upstream_gene_variant 0.35 isoniazid
kasA 2518014 c.-101_-99delGAAinsCAG upstream_gene_variant 0.18 isoniazid
kasA 2518019 c.-96A>G upstream_gene_variant 0.11 isoniazid
kasA 2518025 c.-90G>C upstream_gene_variant 0.12 isoniazid
kasA 2518726 c.612G>C synonymous_variant 0.17 isoniazid
kasA 2518738 c.624G>C synonymous_variant 0.33 isoniazid
kasA 2518756 c.642G>C synonymous_variant 0.38 isoniazid
kasA 2518768 c.654C>G synonymous_variant 0.33 isoniazid
kasA 2518771 c.657C>G synonymous_variant 0.33 isoniazid
kasA 2518774 c.660C>T synonymous_variant 0.35 isoniazid
kasA 2518783 c.669T>G synonymous_variant 0.33 isoniazid
kasA 2518787 p.Arg225Lys missense_variant 0.33 isoniazid
kasA 2518792 c.678C>T synonymous_variant 0.32 isoniazid
kasA 2518795 c.681C>T synonymous_variant 0.32 isoniazid
kasA 2518798 c.684G>C synonymous_variant 0.31 isoniazid
kasA 2518822 c.708C>A synonymous_variant 0.29 isoniazid
kasA 2518825 c.711T>C synonymous_variant 0.29 isoniazid
kasA 2518846 c.732G>T synonymous_variant 0.26 isoniazid
kasA 2518849 c.735G>C synonymous_variant 0.26 isoniazid
kasA 2518853 p.Leu247Val missense_variant 0.26 isoniazid
kasA 2518864 c.750G>C synonymous_variant 0.24 isoniazid
kasA 2518879 c.765A>G synonymous_variant 0.11 isoniazid
ahpC 2726576 c.384C>T synonymous_variant 0.14 isoniazid
ahpC 2726593 p.Val134Ala missense_variant 0.2 isoniazid
ahpC 2726600 c.408T>C synonymous_variant 0.21 isoniazid
ahpC 2726613 p.Asn141Asp missense_variant 0.23 isoniazid
ahpC 2726619 p.Glu143Ile missense_variant 0.2 isoniazid
ahpC 2726624 c.432C>T synonymous_variant 0.19 isoniazid
ahpC 2726636 c.444G>C synonymous_variant 0.2 isoniazid
ahpC 2726638 p.Ala149Val missense_variant 0.2 isoniazid
ahpC 2726642 c.450C>G synonymous_variant 0.19 isoniazid
ahpC 2726645 c.453C>A synonymous_variant 0.2 isoniazid
ahpC 2726651 c.459G>C synonymous_variant 0.24 isoniazid
ahpC 2726657 c.465A>C synonymous_variant 0.23 isoniazid
ahpC 2726666 c.474C>G synonymous_variant 0.22 isoniazid
ahpC 2726669 c.477T>C synonymous_variant 0.22 isoniazid
ahpC 2726675 c.483A>G synonymous_variant 0.22 isoniazid
ahpC 2726678 c.486G>C synonymous_variant 0.22 isoniazid
ahpC 2726681 c.489A>C synonymous_variant 0.22 isoniazid
ahpC 2726687 c.495C>T synonymous_variant 0.22 isoniazid
ahpC 2726693 c.501C>G synonymous_variant 0.26 isoniazid
ahpC 2726696 c.504C>G synonymous_variant 0.23 isoniazid
ahpC 2726717 c.525A>C synonymous_variant 0.21 isoniazid
thyX 3067367 c.579G>A synonymous_variant 0.12 para-aminosalicylic_acid
thyX 3067391 c.555G>C synonymous_variant 0.13 para-aminosalicylic_acid
thyX 3067394 c.552G>C synonymous_variant 0.12 para-aminosalicylic_acid
thyX 3067400 c.544_546delCGCinsAGG synonymous_variant 0.12 para-aminosalicylic_acid
thyX 3067406 c.540A>G synonymous_variant 0.13 para-aminosalicylic_acid
thyX 3067409 c.537C>G synonymous_variant 0.14 para-aminosalicylic_acid
thyX 3067412 c.534C>T synonymous_variant 0.14 para-aminosalicylic_acid
thyX 3067427 p.Ala173Ser missense_variant 0.12 para-aminosalicylic_acid
thyX 3067430 c.516C>G synonymous_variant 0.13 para-aminosalicylic_acid
thyX 3067439 c.507A>G synonymous_variant 0.13 para-aminosalicylic_acid
thyX 3067445 c.501C>A synonymous_variant 0.12 para-aminosalicylic_acid
thyX 3067457 c.489C>G synonymous_variant 0.11 para-aminosalicylic_acid
thyX 3067463 p.Ile161Val missense_variant 0.12 para-aminosalicylic_acid
thyA 3073902 c.570C>A synonymous_variant 0.24 para-aminosalicylic_acid
thyA 3073905 c.567C>G synonymous_variant 0.28 para-aminosalicylic_acid
thyA 3073925 c.547T>C synonymous_variant 0.5 para-aminosalicylic_acid
thyA 3073926 c.546G>A synonymous_variant 0.5 para-aminosalicylic_acid
thyA 3073929 c.543T>C synonymous_variant 0.5 para-aminosalicylic_acid
thyA 3073950 c.522G>C synonymous_variant 0.53 para-aminosalicylic_acid
thyA 3073953 c.519T>G synonymous_variant 0.53 para-aminosalicylic_acid
thyA 3073956 c.516G>C synonymous_variant 0.53 para-aminosalicylic_acid
thyA 3073959 c.513T>C synonymous_variant 0.54 para-aminosalicylic_acid
thyA 3073962 c.510G>A synonymous_variant 0.54 para-aminosalicylic_acid
thyA 3073965 c.507C>T synonymous_variant 0.56 para-aminosalicylic_acid
thyA 3073980 c.492C>T synonymous_variant 0.54 para-aminosalicylic_acid
thyA 3073983 c.489C>G synonymous_variant 0.54 para-aminosalicylic_acid
thyA 3073989 c.483T>C synonymous_variant 0.54 para-aminosalicylic_acid
thyA 3073992 c.480C>T synonymous_variant 0.51 para-aminosalicylic_acid
thyA 3073999 p.Arg158Lys missense_variant 0.51 para-aminosalicylic_acid
thyA 3074004 c.468T>C synonymous_variant 0.49 para-aminosalicylic_acid
thyA 3074010 c.462C>G synonymous_variant 0.51 para-aminosalicylic_acid
thyA 3074013 c.459C>T synonymous_variant 0.52 para-aminosalicylic_acid
thyA 3074028 c.444G>C synonymous_variant 0.55 para-aminosalicylic_acid
thyA 3074031 c.441T>C synonymous_variant 0.54 para-aminosalicylic_acid
thyA 3074034 c.438T>C synonymous_variant 0.54 para-aminosalicylic_acid
thyA 3074053 p.Arg140Gln missense_variant 0.44 para-aminosalicylic_acid
thyA 3074056 p.Glu139Pro missense_variant 0.43 para-aminosalicylic_acid
thyA 3074070 c.402C>T synonymous_variant 0.44 para-aminosalicylic_acid
thyA 3074076 c.396C>A synonymous_variant 0.39 para-aminosalicylic_acid
thyA 3074082 c.390G>T synonymous_variant 0.34 para-aminosalicylic_acid
thyA 3074089 p.Ile128Asn missense_variant 0.36 para-aminosalicylic_acid
thyA 3074091 c.381C>G synonymous_variant 0.36 para-aminosalicylic_acid
thyA 3074094 c.378G>C synonymous_variant 0.36 para-aminosalicylic_acid
thyA 3074097 c.375C>G synonymous_variant 0.36 para-aminosalicylic_acid
thyA 3074103 c.369C>G synonymous_variant 0.36 para-aminosalicylic_acid
thyA 3074108 p.Asp122Asn missense_variant 0.36 para-aminosalicylic_acid
thyA 3074112 c.360C>T synonymous_variant 0.34 para-aminosalicylic_acid
thyA 3074120 c.352T>C synonymous_variant 0.33 para-aminosalicylic_acid
thyA 3074127 c.345G>A synonymous_variant 0.36 para-aminosalicylic_acid
thyA 3074130 c.342G>C synonymous_variant 0.38 para-aminosalicylic_acid
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0 capreomycin
amikacin
whiB7 3568555 p.Leu42Pro missense_variant 0.92 streptomycin Uncertain significance
kanamycin Uncertain significance
amikacin Uncertain significance
whiB7 3568854 c.-176delG upstream_gene_variant 0.96 streptomycin
kanamycin Uncertain significance
amikacin Uncertain significance
Rv3236c 3612813 p.Thr102Ala missense_variant 1.0 pyrazinamide Uncertain significance
rpoA 3877542 c.966C>A synonymous_variant 0.57 rifampicin
rpoA 3877545 c.963G>T synonymous_variant 0.58 rifampicin
rpoA 3877554 c.954G>A synonymous_variant 0.58 rifampicin
rpoA 3877560 c.948C>T synonymous_variant 0.58 rifampicin
rpoA 3877563 c.945C>T synonymous_variant 0.59 rifampicin
rpoA 3877569 p.Pro313Thr missense_variant 0.6 rifampicin
rpoA 3877587 c.921A>G synonymous_variant 0.66 rifampicin
rpoA 3877593 c.915C>T synonymous_variant 0.67 rifampicin
rpoA 3877614 c.894G>A synonymous_variant 0.71 rifampicin
rpoA 3877620 c.888G>A synonymous_variant 0.7 rifampicin
rpoA 3877638 c.870T>C synonymous_variant 0.7 rifampicin
rpoA 3877656 c.852T>G synonymous_variant 0.74 rifampicin
rpoA 3877665 c.843C>G synonymous_variant 0.75 rifampicin
rpoA 3877677 c.831G>C synonymous_variant 0.71 rifampicin
rpoA 3877680 c.828G>C synonymous_variant 0.7 rifampicin
rpoA 3877686 c.822A>G synonymous_variant 0.72 rifampicin
rpoA 3877692 c.816G>C synonymous_variant 0.71 rifampicin
rpoA 3877704 c.804G>T synonymous_variant 0.73 rifampicin
rpoA 3877728 c.780C>G synonymous_variant 0.71 rifampicin
rpoA 3877731 c.777G>C synonymous_variant 0.71 rifampicin
rpoA 3877734 c.774G>C synonymous_variant 0.7 rifampicin
rpoA 3877737 c.771G>C synonymous_variant 0.7 rifampicin
rpoA 3877743 c.765T>C synonymous_variant 0.7 rifampicin
rpoA 3877749 c.759C>T synonymous_variant 0.69 rifampicin
rpoA 3877752 p.Asp252Glu missense_variant 0.69 rifampicin
rpoA 3877755 c.753C>T synonymous_variant 0.69 rifampicin
rpoA 3877758 c.750G>C synonymous_variant 0.71 rifampicin
rpoA 3877764 c.744C>A synonymous_variant 0.71 rifampicin
rpoA 3877770 c.738A>G synonymous_variant 0.72 rifampicin
rpoA 3877773 c.735G>C synonymous_variant 0.73 rifampicin
rpoA 3877776 c.732T>C synonymous_variant 0.72 rifampicin
rpoA 3877782 c.726T>C synonymous_variant 0.73 rifampicin
rpoA 3877797 c.711G>A synonymous_variant 0.74 rifampicin
rpoA 3877815 c.693C>T synonymous_variant 0.74 rifampicin
rpoA 3877818 c.690A>G synonymous_variant 0.74 rifampicin
rpoA 3877836 c.672A>G synonymous_variant 0.72 rifampicin
rpoA 3877839 c.669G>A synonymous_variant 0.73 rifampicin
rpoA 3877848 c.660C>T synonymous_variant 0.72 rifampicin
rpoA 3877856 c.652T>C synonymous_variant 0.71 rifampicin
rpoA 3877875 c.633T>C synonymous_variant 0.74 rifampicin
rpoA 3877896 c.612G>A synonymous_variant 0.73 rifampicin
rpoA 3877905 c.603A>G synonymous_variant 0.72 rifampicin
rpoA 3877908 c.600T>C synonymous_variant 0.71 rifampicin
rpoA 3877920 c.588G>C synonymous_variant 0.69 rifampicin
rpoA 3877923 c.585C>T synonymous_variant 0.66 rifampicin
rpoA 3877929 p.Ile193Val missense_variant 0.66 rifampicin
rpoA 3877962 c.546G>T synonymous_variant 0.61 rifampicin
rpoA 3877971 p.Asp179Glu missense_variant 0.61 rifampicin
rpoA 3877974 c.534G>T synonymous_variant 0.59 rifampicin
rpoA 3877977 p.Lys177Asn missense_variant 0.6 rifampicin
rpoA 3877989 c.519A>G synonymous_variant 0.57 rifampicin
rpoA 3878001 c.507A>G synonymous_variant 0.54 rifampicin
rpoA 3878019 c.489A>C synonymous_variant 0.43 rifampicin
rpoA 3878022 c.486T>C synonymous_variant 0.42 rifampicin
rpoA 3878025 c.483C>T synonymous_variant 0.43 rifampicin
rpoA 3878028 c.480G>T synonymous_variant 0.43 rifampicin
rpoA 3878031 c.477T>C synonymous_variant 0.43 rifampicin
rpoA 3878034 c.474A>G synonymous_variant 0.42 rifampicin
rpoA 3878046 c.462T>C synonymous_variant 0.44 rifampicin
rpoA 3878050 p.Arg153Lys missense_variant 0.46 rifampicin
rpoA 3878055 c.453A>G synonymous_variant 0.45 rifampicin
rpoA 3878061 c.447G>C synonymous_variant 0.46 rifampicin
rpoA 3878070 c.438T>C synonymous_variant 0.49 rifampicin
rpoA 3878073 c.435C>T synonymous_variant 0.51 rifampicin
rpoA 3878079 c.429C>T synonymous_variant 0.54 rifampicin
rpoA 3878091 c.417C>T synonymous_variant 0.6 rifampicin
rpoA 3878102 p.Val136Ile missense_variant 0.56 rifampicin
rpoA 3878103 c.405A>G synonymous_variant 0.56 rifampicin
rpoA 3878118 c.390T>C synonymous_variant 0.67 rifampicin
rpoA 3878130 c.378C>G synonymous_variant 0.68 rifampicin
rpoA 3878142 p.Gly122Asp missense_variant 0.68 rifampicin Uncertain significance
rpoA 3878160 c.348C>G synonymous_variant 0.74 rifampicin
rpoA 3878163 c.345C>T synonymous_variant 0.75 rifampicin
rpoA 3878169 c.339G>C synonymous_variant 0.75 rifampicin
rpoA 3878184 c.324C>T synonymous_variant 0.76 rifampicin
rpoA 3878193 c.315T>C synonymous_variant 0.79 rifampicin
rpoA 3878196 p.Glu104Ala missense_variant 0.79 rifampicin
rpoA 3878205 c.303T>C synonymous_variant 0.83 rifampicin
rpoA 3878217 c.291A>G synonymous_variant 0.84 rifampicin
rpoA 3878259 c.249G>C synonymous_variant 0.8 rifampicin
rpoA 3878271 c.237T>C synonymous_variant 0.75 rifampicin
rpoA 3878283 p.Glu75Asp missense_variant 0.73 rifampicin Uncertain significance
rpoA 3878292 c.216T>C synonymous_variant 0.76 rifampicin
rpoA 3878298 c.210A>G synonymous_variant 0.73 rifampicin
rpoA 3878301 c.207C>G synonymous_variant 0.72 rifampicin
rpoA 3878310 c.198G>T synonymous_variant 0.69 rifampicin
rpoA 3878313 c.195G>C synonymous_variant 0.69 rifampicin
rpoA 3878322 c.186A>G synonymous_variant 0.68 rifampicin
rpoA 3878331 c.177A>G synonymous_variant 0.64 rifampicin
rpoA 3878337 c.171T>C synonymous_variant 0.64 rifampicin
rpoA 3878343 c.165C>T synonymous_variant 0.62 rifampicin
rpoA 3878346 c.162T>C synonymous_variant 0.62 rifampicin
rpoA 3878364 c.144A>C synonymous_variant 0.51 rifampicin
rpoA 3878367 c.141C>G synonymous_variant 0.5 rifampicin
rpoA 3878370 c.138T>C synonymous_variant 0.5 rifampicin
rpoA 3878373 c.135G>C synonymous_variant 0.49 rifampicin
rpoA 3878381 c.127C>T synonymous_variant 0.49 rifampicin
rpoA 3878391 c.117T>G synonymous_variant 0.44 rifampicin
rpoA 3878400 c.108T>C synonymous_variant 0.42 rifampicin
rpoA 3878433 c.75G>C synonymous_variant 0.14 rifampicin
rpoA 3878436 c.72A>G synonymous_variant 0.14 rifampicin
rpoA 3878665 c.-158A>G upstream_gene_variant 0.17 rifampicin Uncertain significance
rpoA 3878672 c.-165A>T upstream_gene_variant 0.2 rifampicin
rpoA 3878694 c.-187A>G upstream_gene_variant 0.22 rifampicin
rpoA 3878695 c.-188C>G upstream_gene_variant 0.22 rifampicin
rpoA 3878698 c.-191A>G upstream_gene_variant 0.21 rifampicin
rpoA 3878701 c.-194C>G upstream_gene_variant 0.21 rifampicin
clpC1 4038530 c.2175G>A synonymous_variant 0.11 pyrazinamide
clpC1 4038545 p.His720Glu missense_variant 0.1 pyrazinamide
clpC1 4038563 c.2142C>T synonymous_variant 0.14 pyrazinamide
clpC1 4038584 c.2121G>T synonymous_variant 0.14 pyrazinamide
clpC1 4038587 c.2118C>T synonymous_variant 0.13 pyrazinamide
clpC1 4038596 c.2109A>G synonymous_variant 0.11 pyrazinamide
clpC1 4038602 c.2103G>C synonymous_variant 0.11 pyrazinamide
clpC1 4038737 c.1968C>T synonymous_variant 0.26 pyrazinamide
clpC1 4038740 c.1965G>C synonymous_variant 0.29 pyrazinamide
clpC1 4038749 c.1956C>A synonymous_variant 0.37 pyrazinamide
clpC1 4038755 c.1950G>C synonymous_variant 0.42 pyrazinamide
clpC1 4038767 c.1938G>C synonymous_variant 0.44 pyrazinamide
clpC1 4038770 c.1935C>T synonymous_variant 0.43 pyrazinamide
clpC1 4038773 c.1932T>C synonymous_variant 0.44 pyrazinamide
clpC1 4038782 c.1923G>T synonymous_variant 0.42 pyrazinamide
clpC1 4038790 c.1915C>T synonymous_variant 0.46 pyrazinamide
clpC1 4038795 p.Ser637Thr missense_variant 0.47 pyrazinamide
clpC1 4038812 c.1893T>C synonymous_variant 0.54 pyrazinamide
clpC1 4038815 c.1890G>T synonymous_variant 0.56 pyrazinamide
clpC1 4038838 c.1867C>T synonymous_variant 0.58 pyrazinamide
clpC1 4038845 c.1858_1860delTCGinsAGC synonymous_variant 0.53 pyrazinamide
clpC1 4038857 c.1848C>G synonymous_variant 0.57 pyrazinamide
clpC1 4038860 c.1845G>C synonymous_variant 0.56 pyrazinamide
clpC1 4038878 c.1827A>G synonymous_variant 0.6 pyrazinamide
clpC1 4038908 c.1797C>G synonymous_variant 0.6 pyrazinamide
clpC1 4038911 c.1794G>C synonymous_variant 0.6 pyrazinamide
clpC1 4038914 c.1791G>T synonymous_variant 0.6 pyrazinamide
clpC1 4038923 c.1782A>T synonymous_variant 0.63 pyrazinamide
clpC1 4038928 c.1777C>A synonymous_variant 0.62 pyrazinamide
clpC1 4038929 c.1776G>A synonymous_variant 0.62 pyrazinamide
clpC1 4038932 c.1773G>C synonymous_variant 0.6 pyrazinamide
clpC1 4038941 c.1764G>C synonymous_variant 0.61 pyrazinamide
clpC1 4038953 c.1752A>G synonymous_variant 0.6 pyrazinamide
clpC1 4038956 c.1749T>C synonymous_variant 0.59 pyrazinamide
clpC1 4038965 c.1740T>C synonymous_variant 0.57 pyrazinamide
clpC1 4038971 c.1734T>C synonymous_variant 0.58 pyrazinamide
clpC1 4038974 c.1731T>C synonymous_variant 0.55 pyrazinamide
clpC1 4038989 c.1716T>C synonymous_variant 0.59 pyrazinamide
clpC1 4038997 c.1708T>C synonymous_variant 0.6 pyrazinamide
clpC1 4039022 c.1683A>G synonymous_variant 0.57 pyrazinamide
clpC1 4039046 c.1659C>G synonymous_variant 0.57 pyrazinamide
clpC1 4039070 c.1635G>C synonymous_variant 0.56 pyrazinamide
clpC1 4039077 p.Lys543Arg missense_variant 0.54 pyrazinamide
clpC1 4039079 c.1626C>G synonymous_variant 0.54 pyrazinamide
clpC1 4039085 c.1620A>G synonymous_variant 0.59 pyrazinamide
clpC1 4039091 c.1614G>T synonymous_variant 0.6 pyrazinamide
clpC1 4039097 c.1608G>T synonymous_variant 0.62 pyrazinamide
clpC1 4039103 c.1602T>C synonymous_variant 0.62 pyrazinamide
clpC1 4039106 c.1599G>C synonymous_variant 0.62 pyrazinamide
clpC1 4039121 c.1584T>C synonymous_variant 0.64 pyrazinamide
clpC1 4039142 c.1563A>G synonymous_variant 0.62 pyrazinamide
clpC1 4039145 c.1560G>C synonymous_variant 0.61 pyrazinamide
clpC1 4039169 p.Glu512Asp missense_variant 0.57 pyrazinamide
clpC1 4039172 c.1533A>G synonymous_variant 0.56 pyrazinamide
clpC1 4039178 c.1527G>C synonymous_variant 0.58 pyrazinamide
clpC1 4039183 c.1522T>C synonymous_variant 0.58 pyrazinamide
clpC1 4039190 c.1515C>T synonymous_variant 0.58 pyrazinamide
clpC1 4039196 c.1509G>A synonymous_variant 0.55 pyrazinamide
clpC1 4039199 p.Ala502Glu missense_variant 0.55 pyrazinamide
clpC1 4039208 c.1497C>G synonymous_variant 0.56 pyrazinamide
clpC1 4039220 c.1485G>C synonymous_variant 0.56 pyrazinamide
clpC1 4039262 c.1443C>T synonymous_variant 0.53 pyrazinamide
clpC1 4039265 c.1440C>T synonymous_variant 0.5 pyrazinamide
clpC1 4039271 c.1434G>A synonymous_variant 0.47 pyrazinamide
clpC1 4039283 c.1422C>T synonymous_variant 0.43 pyrazinamide
clpC1 4039286 c.1417_1419delCTTinsTTA synonymous_variant 0.42 pyrazinamide
clpC1 4039289 c.1416T>C synonymous_variant 0.42 pyrazinamide
clpC1 4039292 c.1413C>T synonymous_variant 0.43 pyrazinamide
clpC1 4039304 c.1401G>A synonymous_variant 0.47 pyrazinamide
clpC1 4039316 p.Glu463Asp missense_variant 0.46 pyrazinamide
clpC1 4039319 c.1386T>C synonymous_variant 0.44 pyrazinamide
clpC1 4039328 c.1377A>C synonymous_variant 0.42 pyrazinamide
clpC1 4039331 c.1374C>G synonymous_variant 0.38 pyrazinamide
clpC1 4039337 p.Thr456Gln missense_variant 0.35 pyrazinamide
clpC1 4039346 p.Arg453Ser missense_variant 0.34 pyrazinamide
clpC1 4039360 p.Ser449Arg missense_variant 0.4 pyrazinamide
clpC1 4039361 c.1344C>G synonymous_variant 0.4 pyrazinamide
clpC1 4039382 c.1323C>G synonymous_variant 0.47 pyrazinamide
clpC1 4039391 c.1314T>C synonymous_variant 0.5 pyrazinamide
clpC1 4039409 c.1296T>C synonymous_variant 0.52 pyrazinamide
clpC1 4039412 c.1293T>G synonymous_variant 0.53 pyrazinamide
clpC1 4039415 p.Glu430Asp missense_variant 0.52 pyrazinamide Uncertain significance
clpC1 4039430 c.1275T>C synonymous_variant 0.55 pyrazinamide
clpC1 4039442 c.1263A>G synonymous_variant 0.57 pyrazinamide
clpC1 4039454 c.1251A>G synonymous_variant 0.59 pyrazinamide
clpC1 4039466 c.1239T>C synonymous_variant 0.62 pyrazinamide
clpC1 4039469 c.1236T>C synonymous_variant 0.62 pyrazinamide
clpC1 4039472 c.1233G>C synonymous_variant 0.62 pyrazinamide
clpC1 4039478 c.1227G>C synonymous_variant 0.65 pyrazinamide
clpC1 4039481 c.1224T>C synonymous_variant 0.64 pyrazinamide
clpC1 4039487 c.1218G>C synonymous_variant 0.68 pyrazinamide
clpC1 4039522 c.1183C>T synonymous_variant 0.7 pyrazinamide
clpC1 4039528 c.1177C>A synonymous_variant 0.7 pyrazinamide
clpC1 4039541 c.1164C>G synonymous_variant 0.7 pyrazinamide
clpC1 4039544 c.1161C>T synonymous_variant 0.7 pyrazinamide
clpC1 4039559 c.1146C>G synonymous_variant 0.65 pyrazinamide
clpC1 4039565 c.1140G>T synonymous_variant 0.64 pyrazinamide
clpC1 4039570 p.Met379Leu missense_variant 0.62 pyrazinamide
clpC1 4039571 c.1134G>A synonymous_variant 0.61 pyrazinamide
clpC1 4039574 p.Ala377Gly missense_variant 0.62 pyrazinamide
clpC1 4039586 c.1119G>C synonymous_variant 0.62 pyrazinamide
clpC1 4039601 c.1104G>A synonymous_variant 0.66 pyrazinamide
clpC1 4039610 c.1095G>C synonymous_variant 0.67 pyrazinamide
clpC1 4039616 c.1089G>C synonymous_variant 0