TB-Profiler result

Run: 8a1375a0-53e6-4426-ba2f-ab710f67e63c


Run ID: 8a1375a0-53e6-4426-ba2f-ab710f67e63c

Sample name:

Date: 13-03-2024 06:14:38

Number of reads: 861619

Percentage reads mapped: 45.45

Median coverage: 6



Drug-resistance: HR-TB

Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
isoniazid katG p.Ile335Thr Uncertain significance
c.300_301delGC Uncertain significance
c.296_297insTG Uncertain significance
ethambutol embB p.His312Arg Uncertain significance
p.Leu359Ile Uncertain significance
p.Tyr384Asn Uncertain significance
p.Ala388Gly Uncertain significance
p.Asn399Asp Uncertain significance
p.Ala659Thr Uncertain significance
streptomycin rrs n.462C>T Uncertain significance
capreomycin tlyA c.513_514delTT Uncertain significance
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
rrs 1472307 n.462C>T non_coding_transcript_exon_variant 0.97 streptomycin Uncertain significance
tlyA 1918451 c.513_514delTT frameshift_variant 0.4 capreomycin Uncertain significance
katG 2155108 p.Ile335Thr missense_variant 0.73 isoniazid Uncertain significance
katG 2155810 c.300_301delGC frameshift_variant 0.58 isoniazid Uncertain significance
katG 2155815 c.296_297insTG frameshift_variant 0.54 isoniazid Uncertain significance
embB 4247448 p.His312Arg missense_variant 0.96 ethambutol Uncertain significance
embB 4247588 p.Leu359Ile missense_variant 0.95 ethambutol Uncertain significance
embB 4247663 p.Tyr384Asn missense_variant 0.92 ethambutol Uncertain significance
embB 4247676 p.Ala388Gly missense_variant 0.91 ethambutol Uncertain significance
embB 4247708 p.Asn399Asp missense_variant 0.91 ethambutol Uncertain significance
embB 4248488 p.Ala659Thr missense_variant 0.79 ethambutol Uncertain significance
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrB 6100 c.861G>C synonymous_variant 0.75 fluoroquinolones
gyrB 6115 c.876A>G synonymous_variant 0.67 fluoroquinolones
gyrB 6123 p.Ala295Gly missense_variant 0.67 fluoroquinolones
gyrB 6127 c.888G>C synonymous_variant 0.67 fluoroquinolones
gyrB 6130 c.891T>C synonymous_variant 0.71 fluoroquinolones
gyrB 6133 c.894G>C synonymous_variant 0.71 fluoroquinolones
gyrB 6136 c.897G>A synonymous_variant 0.71 fluoroquinolones
gyrB 6169 c.930C>G synonymous_variant 0.87 fluoroquinolones
gyrB 6190 c.951A>G synonymous_variant 0.9 fluoroquinolones
gyrB 6214 c.975G>C synonymous_variant 0.94 fluoroquinolones
gyrB 6217 c.978G>C synonymous_variant 0.94 fluoroquinolones
gyrB 6223 c.984G>C synonymous_variant 0.94 fluoroquinolones
gyrB 6242 p.Arg335Lys missense_variant 0.95 fluoroquinolones
levofloxacin Uncertain significance
gyrB 6250 c.1011A>G synonymous_variant 0.95 fluoroquinolones
gyrB 6253 c.1014G>C synonymous_variant 0.95 fluoroquinolones
gyrB 6274 c.1035C>G synonymous_variant 0.94 fluoroquinolones
gyrB 6280 c.1041T>C synonymous_variant 0.94 fluoroquinolones
gyrB 6286 c.1047T>C synonymous_variant 0.95 fluoroquinolones
gyrB 6292 c.1053G>C synonymous_variant 0.95 fluoroquinolones
gyrB 6295 c.1056A>G synonymous_variant 0.95 fluoroquinolones
gyrB 6298 c.1059C>T synonymous_variant 0.95 fluoroquinolones
gyrB 6299 c.1060C>T synonymous_variant 0.95 fluoroquinolones
gyrA 6307 c.-995T>G upstream_gene_variant 0.96 fluoroquinolones
gyrA 6319 c.-983G>C upstream_gene_variant 0.96 fluoroquinolones
gyrA 6325 c.-977C>G upstream_gene_variant 0.96 fluoroquinolones
gyrA 6361 c.-941G>A upstream_gene_variant 0.94 fluoroquinolones
gyrA 6362 c.-940T>C upstream_gene_variant 0.94 fluoroquinolones
gyrA 6379 c.-923C>G upstream_gene_variant 0.93 fluoroquinolones
gyrA 6382 c.-920A>G upstream_gene_variant 0.93 fluoroquinolones
gyrA 6388 c.-914T>C upstream_gene_variant 0.93 fluoroquinolones
gyrA 6400 c.-902C>G upstream_gene_variant 0.93 fluoroquinolones
gyrA 6403 c.-899T>C upstream_gene_variant 0.92 fluoroquinolones
gyrA 6415 c.-887G>C upstream_gene_variant 0.92 fluoroquinolones
gyrA 6427 c.-875T>C upstream_gene_variant 0.91 fluoroquinolones
gyrB 6440 p.Thr401Ala missense_variant 0.9 fluoroquinolones
levofloxacin Uncertain significance
gyrA 6448 c.-854G>C upstream_gene_variant 0.89 fluoroquinolones
gyrB 6455 p.Val406Ile missense_variant 0.89 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
gyrA 6460 c.-842G>C upstream_gene_variant 0.89 fluoroquinolones
gyrA 6469 c.-833T>G upstream_gene_variant 0.89 fluoroquinolones
gyrA 6472 c.-830G>T upstream_gene_variant 0.85 fluoroquinolones
gyrA 6475 c.-827C>A upstream_gene_variant 0.85 fluoroquinolones
gyrA 6478 c.-824G>A upstream_gene_variant 0.85 fluoroquinolones
gyrA 6484 c.-818A>G upstream_gene_variant 0.85 fluoroquinolones
gyrA 6487 c.-815C>G upstream_gene_variant 0.85 fluoroquinolones
gyrA 6490 c.-812T>C upstream_gene_variant 0.85 fluoroquinolones
gyrA 6496 c.-806G>C upstream_gene_variant 0.89 fluoroquinolones
gyrA 6499 c.-803A>G upstream_gene_variant 0.89 fluoroquinolones
gyrA 6502 c.-800T>C upstream_gene_variant 0.89 fluoroquinolones
gyrA 6508 c.-794A>G upstream_gene_variant 0.9 fluoroquinolones
gyrA 6523 c.-779G>C upstream_gene_variant 0.89 fluoroquinolones
gyrA 6526 c.-776T>C upstream_gene_variant 0.89 fluoroquinolones
gyrA 6535 c.-767C>A upstream_gene_variant 0.88 fluoroquinolones
gyrB 6542 p.Ile435Leu missense_variant 0.88 fluoroquinolones
levofloxacin Uncertain significance
gyrA 6547 c.-755T>C upstream_gene_variant 0.88 fluoroquinolones
gyrA 6550 c.-752A>G upstream_gene_variant 0.88 fluoroquinolones
gyrA 6551 c.-751T>C upstream_gene_variant 0.88 fluoroquinolones
gyrA 6565 c.-737G>C upstream_gene_variant 0.93 fluoroquinolones
gyrA 6571 c.-731T>C upstream_gene_variant 0.92 fluoroquinolones
gyrA 6577 c.-725T>G upstream_gene_variant 0.91 fluoroquinolones
gyrA 6580 c.-722C>G upstream_gene_variant 0.91 fluoroquinolones
gyrA 6583 c.-719G>C upstream_gene_variant 0.91 fluoroquinolones
gyrA 6586 c.-716T>C upstream_gene_variant 0.91 fluoroquinolones
gyrA 6598 c.-704C>G upstream_gene_variant 0.93 fluoroquinolones
gyrA 6602 c.-700C>T upstream_gene_variant 0.93 fluoroquinolones
gyrA 6610 c.-692C>G upstream_gene_variant 0.93 fluoroquinolones
gyrA 6613 c.-689A>C upstream_gene_variant 0.93 fluoroquinolones
gyrA 6616 c.-686A>G upstream_gene_variant 0.94 fluoroquinolones
gyrA 6634 c.-668T>C upstream_gene_variant 0.94 fluoroquinolones
gyrA 6637 c.-665T>G upstream_gene_variant 0.95 fluoroquinolones
gyrA 6640 c.-662A>G upstream_gene_variant 0.95 fluoroquinolones
gyrA 6649 c.-653T>C upstream_gene_variant 0.95 fluoroquinolones
gyrA 6652 c.-650C>G upstream_gene_variant 0.95 fluoroquinolones
gyrA 6655 c.-647T>C upstream_gene_variant 0.95 fluoroquinolones
gyrA 6670 c.-632G>C upstream_gene_variant 0.96 fluoroquinolones
gyrA 6673 c.-629A>C upstream_gene_variant 0.96 fluoroquinolones
gyrA 6700 c.-602T>C upstream_gene_variant 0.98 fluoroquinolones
gyrA 6703 c.-599G>C upstream_gene_variant 1.0 fluoroquinolones
gyrA 6706 c.-596G>A upstream_gene_variant 1.0 fluoroquinolones
gyrA 6709 c.-593A>G upstream_gene_variant 1.0 fluoroquinolones
gyrA 6712 c.-590G>C upstream_gene_variant 1.0 fluoroquinolones
gyrA 6730 c.-572A>G upstream_gene_variant 1.0 fluoroquinolones
gyrA 6742 c.-560A>G upstream_gene_variant 1.0 fluoroquinolones
gyrA 6745 c.-557T>G upstream_gene_variant 1.0 fluoroquinolones
gyrA 6760 c.-542G>C upstream_gene_variant 1.0 fluoroquinolones
gyrA 6778 c.-524C>T upstream_gene_variant 0.98 fluoroquinolones
gyrA 6793 c.-509T>C upstream_gene_variant 0.98 fluoroquinolones
gyrB 6797 p.Gly520Thr missense_variant 0.98 fluoroquinolones
levofloxacin Uncertain significance
gyrA 6824 c.-478C>T upstream_gene_variant 0.99 fluoroquinolones
gyrA 6841 c.-461T>C upstream_gene_variant 0.98 fluoroquinolones
gyrA 6844 c.-458T>G upstream_gene_variant 0.98 fluoroquinolones
gyrA 6853 c.-449A>G upstream_gene_variant 0.98 fluoroquinolones
gyrA 6856 c.-446T>C upstream_gene_variant 0.98 fluoroquinolones
gyrA 6859 c.-443T>C upstream_gene_variant 0.98 fluoroquinolones
gyrA 6862 c.-440C>G upstream_gene_variant 0.98 fluoroquinolones
gyrA 6878 c.-424T>C upstream_gene_variant 0.98 fluoroquinolones
gyrA 6881 c.-421T>C upstream_gene_variant 0.98 fluoroquinolones
gyrA 6904 c.-398C>G upstream_gene_variant 0.98 fluoroquinolones
gyrA 6910 c.-392G>A upstream_gene_variant 0.97 fluoroquinolones
gyrB 6911 p.Asn558His missense_variant 0.97 fluoroquinolones
levofloxacin Uncertain significance
gyrA 6919 c.-383T>C upstream_gene_variant 0.96 fluoroquinolones
gyrA 6925 c.-377T>C upstream_gene_variant 0.96 fluoroquinolones
gyrA 6931 c.-371A>C upstream_gene_variant 0.95 fluoroquinolones
gyrA 6934 c.-368A>G upstream_gene_variant 0.95 fluoroquinolones
gyrA 6937 c.-365G>A upstream_gene_variant 0.95 fluoroquinolones
gyrA 6949 c.-353A>G upstream_gene_variant 0.93 fluoroquinolones
gyrA 6952 c.-350C>G upstream_gene_variant 0.93 fluoroquinolones
gyrA 6955 c.-347G>A upstream_gene_variant 0.93 fluoroquinolones
gyrA 6967 c.-335T>C upstream_gene_variant 0.92 fluoroquinolones
gyrA 6970 c.-332C>T upstream_gene_variant 0.92 fluoroquinolones
gyrA 6973 c.-329G>C upstream_gene_variant 0.92 fluoroquinolones
gyrA 6976 c.-326A>G upstream_gene_variant 0.92 fluoroquinolones
gyrA 6982 c.-320A>C upstream_gene_variant 0.93 fluoroquinolones
gyrA 7000 c.-302C>G upstream_gene_variant 0.92 fluoroquinolones
gyrA 7006 c.-296T>G upstream_gene_variant 0.92 fluoroquinolones
gyrA 7012 c.-290G>C upstream_gene_variant 0.92 fluoroquinolones
gyrA 7018 c.-284G>C upstream_gene_variant 0.92 fluoroquinolones
gyrA 7021 c.-281G>C upstream_gene_variant 0.91 fluoroquinolones
gyrA 7033 c.-269G>C upstream_gene_variant 0.91 fluoroquinolones
gyrB 7051 p.Glu604Asp missense_variant 0.89 fluoroquinolones
levofloxacin Uncertain significance
gyrA 7060 c.-242T>C upstream_gene_variant 0.88 fluoroquinolones
gyrA 7066 c.-236G>C upstream_gene_variant 0.88 fluoroquinolones
gyrA 7075 c.-227T>G upstream_gene_variant 0.88 fluoroquinolones
gyrA 7078 c.-224A>G upstream_gene_variant 0.88 fluoroquinolones
gyrA 7081 c.-221T>C upstream_gene_variant 0.85 fluoroquinolones
gyrA 7084 c.-218A>G upstream_gene_variant 0.84 fluoroquinolones
gyrA 7093 c.-209T>C upstream_gene_variant 0.84 fluoroquinolones
gyrA 7099 c.-203G>A upstream_gene_variant 0.85 fluoroquinolones
gyrA 7108 c.-194G>A upstream_gene_variant 0.85 fluoroquinolones
gyrA 7114 c.-188C>A upstream_gene_variant 0.84 fluoroquinolones
gyrB 7124 p.Ser629Thr missense_variant 0.83 fluoroquinolones
levofloxacin Uncertain significance
gyrA 7129 c.-173T>G upstream_gene_variant 0.82 fluoroquinolones
gyrA 7132 c.-170T>G upstream_gene_variant 0.82 fluoroquinolones
gyrA 7136 c.-166T>C upstream_gene_variant 0.82 fluoroquinolones
gyrA 7141 c.-161T>C upstream_gene_variant 0.82 fluoroquinolones
gyrA 7144 c.-158A>G upstream_gene_variant 0.82 fluoroquinolones
gyrA 7147 c.-155G>C upstream_gene_variant 0.82 fluoroquinolones
gyrA 7165 c.-137C>G upstream_gene_variant 0.86 fluoroquinolones
gyrA 7178 c.-124T>C upstream_gene_variant 0.87 fluoroquinolones
gyrA 7216 c.-86G>C upstream_gene_variant 0.88 fluoroquinolones
gyrA 7225 c.-77T>C upstream_gene_variant 0.88 fluoroquinolones
gyrA 7237 c.-65C>T upstream_gene_variant 0.87 fluoroquinolones
gyrA 7243 c.-59G>A upstream_gene_variant 0.86 fluoroquinolones
gyrA 7246 c.-56T>C upstream_gene_variant 0.86 fluoroquinolones
gyrA 7252 c.-50G>C upstream_gene_variant 0.86 fluoroquinolones
gyrA 7258 c.-44G>A upstream_gene_variant 0.84 fluoroquinolones
gyrA 7261 c.-41T>C upstream_gene_variant 0.84 fluoroquinolones
gyrA 7264 c.-38C>T upstream_gene_variant 0.84 fluoroquinolones
gyrB 7265 c.2027_*21delAACGCAACCCTGCGTTCGATTGC frameshift_variant&stop_lost&splice_region_variant 0.87 fluoroquinolones
gyrA 7307 c.6A>T synonymous_variant 0.84 fluoroquinolones
gyrA 7313 c.12G>C synonymous_variant 0.84 fluoroquinolones
gyrA 7317 c.16T>C synonymous_variant 0.9 fluoroquinolones
gyrA 7322 c.21G>A synonymous_variant 0.93 fluoroquinolones
gyrA 7324 c.23_24insCGGCGG disruptive_inframe_insertion 0.93 fluoroquinolones
gyrA 7330 p.Asp10Ala missense_variant 0.93 fluoroquinolones
gyrA 7332 p.Ser11Ala missense_variant 0.93 fluoroquinolones
gyrA 7333 c.33_35delGCT disruptive_inframe_deletion 0.96 fluoroquinolones
gyrA 7343 c.42G>C synonymous_variant 0.93 fluoroquinolones
gyrA 7344 p.Ile15Val missense_variant 0.96 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
gyrA 7355 c.54T>C synonymous_variant 0.97 fluoroquinolones
gyrA 7362 p.Glu21Gln missense_variant 1.0 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
gyrA 7391 c.90C>T synonymous_variant 0.97 fluoroquinolones
gyrA 7394 c.93T>C synonymous_variant 0.97 fluoroquinolones
gyrA 7427 c.126G>C synonymous_variant 0.94 fluoroquinolones
gyrA 7442 c.141G>C synonymous_variant 0.95 fluoroquinolones
gyrA 7451 c.150C>G synonymous_variant 0.95 fluoroquinolones
gyrA 7457 c.156T>C synonymous_variant 0.95 fluoroquinolones
gyrA 7472 c.171T>C synonymous_variant 0.94 fluoroquinolones
gyrA 7475 c.174A>C synonymous_variant 0.94 fluoroquinolones
gyrA 7480 p.Phe60Tyr missense_variant 0.94 fluoroquinolones
levofloxacin Uncertain significance
gyrA 7484 c.183T>C synonymous_variant 0.94 fluoroquinolones
gyrA 7487 c.186C>G synonymous_variant 0.94 fluoroquinolones
gyrA 7490 c.189C>T synonymous_variant 0.94 fluoroquinolones
gyrA 7517 c.216G>A synonymous_variant 0.98 fluoroquinolones
gyrA 7523 c.222C>G synonymous_variant 0.98 fluoroquinolones
gyrA 7532 c.231T>C synonymous_variant 0.95 fluoroquinolones
gyrA 7538 c.237G>A synonymous_variant 0.98 fluoroquinolones
gyrA 7541 c.240C>G synonymous_variant 0.98 fluoroquinolones
gyrA 7571 c.270G>C synonymous_variant 0.98 fluoroquinolones
gyrA 7585 p.Ser95Thr missense_variant 1.0 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
gyrA 7595 c.294C>G synonymous_variant 0.98 fluoroquinolones
gyrA 7607 c.306C>G synonymous_variant 0.98 fluoroquinolones
gyrA 7622 c.321C>T synonymous_variant 0.98 fluoroquinolones
gyrA 7626 c.325C>T synonymous_variant 0.98 fluoroquinolones
gyrA 7631 c.330G>C synonymous_variant 0.98 fluoroquinolones
gyrA 7637 c.336C>G synonymous_variant 0.98 fluoroquinolones
gyrA 7646 c.345C>T synonymous_variant 0.98 fluoroquinolones
gyrA 7649 c.348C>T synonymous_variant 0.98 fluoroquinolones
gyrA 7652 c.351C>T synonymous_variant 0.96 fluoroquinolones
gyrA 7658 c.357A>G synonymous_variant 0.96 fluoroquinolones
gyrA 7664 c.363T>C synonymous_variant 0.96 fluoroquinolones
gyrA 7670 c.369A>G synonymous_variant 0.96 fluoroquinolones
gyrA 7676 c.375G>C synonymous_variant 0.97 fluoroquinolones
gyrA 7683 c.382A>C synonymous_variant 0.94 fluoroquinolones
gyrA 7694 c.393A>G synonymous_variant 0.93 fluoroquinolones
gyrA 7697 c.396C>G synonymous_variant 0.93 fluoroquinolones
gyrA 7710 c.409T>C synonymous_variant 0.93 fluoroquinolones
gyrA 7715 c.414G>C synonymous_variant 0.93 fluoroquinolones
gyrA 7728 c.427_429delAGGinsCGC synonymous_variant 0.95 fluoroquinolones
gyrA 7731 p.Glu144Gln missense_variant 0.95 fluoroquinolones
levofloxacin Uncertain significance
gyrA 7760 c.459C>T synonymous_variant 0.93 fluoroquinolones
gyrA 7763 c.462T>C synonymous_variant 0.94 fluoroquinolones
gyrA 7799 c.498A>G synonymous_variant 0.95 fluoroquinolones
gyrA 7835 c.534A>G synonymous_variant 0.95 fluoroquinolones
gyrA 7838 c.537C>G synonymous_variant 0.95 fluoroquinolones
gyrA 7859 c.558A>C synonymous_variant 0.96 fluoroquinolones
gyrA 7865 c.564T>C synonymous_variant 0.95 fluoroquinolones
gyrA 7883 c.582G>C synonymous_variant 0.95 fluoroquinolones
gyrA 7884 p.Arg195Gly missense_variant 0.95 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
gyrA 7892 c.591G>C synonymous_variant 0.95 fluoroquinolones
gyrA 7898 p.Asp199Glu missense_variant 0.95 fluoroquinolones
levofloxacin Uncertain significance
gyrA 7919 p.Glu206Asp missense_variant 0.95 fluoroquinolones
levofloxacin Uncertain significance
gyrA 7923 p.His208Tyr missense_variant 0.95 fluoroquinolones
levofloxacin Uncertain significance
gyrA 7928 p.Asp209Glu missense_variant 0.95 fluoroquinolones
levofloxacin Uncertain significance
gyrA 7942 p.Glu214Ala missense_variant 0.97 fluoroquinolones
levofloxacin Uncertain significance
gyrA 7955 c.654G>C synonymous_variant 0.95 fluoroquinolones
gyrA 7958 c.657C>G synonymous_variant 0.95 fluoroquinolones
gyrA 7963 p.Gly221Glu missense_variant 0.91 fluoroquinolones
levofloxacin Uncertain significance
gyrA 7970 c.669T>G synonymous_variant 0.91 fluoroquinolones
gyrA 7976 c.675C>A synonymous_variant 0.92 fluoroquinolones
gyrA 7979 c.678G>C synonymous_variant 0.92 fluoroquinolones
gyrA 7991 c.690C>T synonymous_variant 0.93 fluoroquinolones
gyrA 7992 p.Ala231Ser missense_variant 0.93 fluoroquinolones
levofloxacin Uncertain significance
gyrA 7997 c.696A>C synonymous_variant 0.93 fluoroquinolones
gyrA 8009 c.708A>C synonymous_variant 0.93 fluoroquinolones
gyrA 8010 p.Ser237Thr missense_variant 0.93 fluoroquinolones
levofloxacin Uncertain significance
gyrA 8020 p.Thr240Ile missense_variant 0.93 fluoroquinolones
levofloxacin Uncertain significance
gyrA 8024 c.723T>C synonymous_variant 0.95 fluoroquinolones
gyrA 8027 c.726T>C synonymous_variant 0.95 fluoroquinolones
gyrA 8036 c.735A>G synonymous_variant 0.95 fluoroquinolones
gyrA 8039 c.738T>C synonymous_variant 0.95 fluoroquinolones
gyrA 8054 c.753T>C synonymous_variant 0.95 fluoroquinolones
gyrA 8057 c.756A>G synonymous_variant 0.95 fluoroquinolones
gyrA 8069 c.768T>C synonymous_variant 0.95 fluoroquinolones
gyrA 8078 c.777A>G synonymous_variant 0.95 fluoroquinolones
gyrA 8090 c.789C>G synonymous_variant 0.95 fluoroquinolones
gyrA 8099 c.798T>C synonymous_variant 0.95 fluoroquinolones
gyrA 8111 c.810G>C synonymous_variant 0.95 fluoroquinolones
gyrA 8156 c.855T>C synonymous_variant 0.94 fluoroquinolones
gyrA 8168 c.867A>G synonymous_variant 0.94 fluoroquinolones
gyrA 8174 c.873C>G synonymous_variant 0.94 fluoroquinolones
gyrA 8177 c.876A>C synonymous_variant 0.94 fluoroquinolones
gyrA 8198 c.897T>C synonymous_variant 0.96 fluoroquinolones
gyrA 8207 c.906T>C synonymous_variant 0.96 fluoroquinolones
gyrA 8219 c.918T>C synonymous_variant 0.96 fluoroquinolones
gyrA 8225 c.924T>C synonymous_variant 0.95 fluoroquinolones
gyrA 8234 c.933T>G synonymous_variant 0.95 fluoroquinolones
gyrA 8235 c.934_936delTTAinsCTG synonymous_variant 0.95 fluoroquinolones
gyrA 8253 p.Ile318Leu missense_variant 0.95 fluoroquinolones
levofloxacin Uncertain significance
gyrA 8264 c.963T>C synonymous_variant 0.95 fluoroquinolones
gyrA 8267 c.966G>C synonymous_variant 0.95 fluoroquinolones
gyrA 8270 c.969G>C synonymous_variant 0.95 fluoroquinolones
gyrA 8283 p.Ile328Leu missense_variant 0.95 fluoroquinolones
levofloxacin Uncertain significance
gyrA 8288 c.987T>C synonymous_variant 0.95 fluoroquinolones
gyrA 8294 c.993T>C synonymous_variant 0.95 fluoroquinolones
gyrA 8324 c.1023T>C synonymous_variant 0.96 fluoroquinolones
gyrA 8339 c.1038A>G synonymous_variant 0.94 fluoroquinolones
gyrA 8342 c.1041G>C synonymous_variant 0.96 fluoroquinolones
gyrA 8351 c.1050C>T synonymous_variant 0.94 fluoroquinolones
gyrA 8366 c.1065G>C synonymous_variant 0.93 fluoroquinolones
gyrA 8375 c.1074G>C synonymous_variant 0.93 fluoroquinolones
gyrA 8391 p.Tyr364His missense_variant 0.94 fluoroquinolones
levofloxacin Uncertain significance
gyrA 8399 c.1098T>C synonymous_variant 0.94 fluoroquinolones
gyrA 8420 c.1119T>C synonymous_variant 0.94 fluoroquinolones
gyrA 8423 c.1122G>C synonymous_variant 0.94 fluoroquinolones
gyrA 8442 c.1141C>T synonymous_variant 0.91 fluoroquinolones
gyrA 8453 c.1152A>C synonymous_variant 0.92 fluoroquinolones
gyrA 8462 c.1161A>G synonymous_variant 0.92 fluoroquinolones
gyrA 8471 c.1170T>C synonymous_variant 0.92 fluoroquinolones
gyrA 8480 c.1179C>T synonymous_variant 0.93 fluoroquinolones
gyrA 8486 c.1185T>C synonymous_variant 0.93 fluoroquinolones
gyrA 8489 c.1188A>G synonymous_variant 0.93 fluoroquinolones
gyrA 8498 c.1197C>T synonymous_variant 0.93 fluoroquinolones
gyrA 8504 c.1203G>C synonymous_variant 0.93 fluoroquinolones
gyrA 8516 c.1215T>C synonymous_variant 0.93 fluoroquinolones
gyrA 8519 c.1218A>C synonymous_variant 0.93 fluoroquinolones
gyrA 8537 c.1236G>A synonymous_variant 0.93 fluoroquinolones
gyrA 8546 c.1245T>C synonymous_variant 0.91 fluoroquinolones
gyrA 8552 c.1251C>G synonymous_variant 0.91 fluoroquinolones
gyrA 8556 p.Ala419Gln missense_variant 0.91 fluoroquinolones
levofloxacin Uncertain significance
gyrA 8561 c.1260A>C synonymous_variant 0.91 fluoroquinolones
gyrA 8562 c.1261C>T synonymous_variant 0.91 fluoroquinolones
gyrA 8603 c.1302A>G synonymous_variant 0.88 fluoroquinolones
gyrA 8619 c.1318T>C synonymous_variant 0.87 fluoroquinolones
gyrA 8624 c.1323G>C synonymous_variant 0.86 fluoroquinolones
gyrA 8627 c.1326C>G synonymous_variant 0.88 fluoroquinolones
gyrA 8636 c.1335A>C synonymous_variant 0.89 fluoroquinolones
gyrA 8642 c.1341A>G synonymous_variant 0.88 fluoroquinolones
gyrA 8645 c.1344C>G synonymous_variant 0.87 fluoroquinolones
gyrA 8672 c.1371A>G synonymous_variant 0.92 fluoroquinolones
gyrA 8693 c.1392T>C synonymous_variant 0.91 fluoroquinolones
gyrA 8699 c.1398A>G synonymous_variant 0.91 fluoroquinolones
gyrA 8711 c.1410A>C synonymous_variant 0.91 fluoroquinolones
gyrA 8714 c.1413A>G synonymous_variant 0.9 fluoroquinolones
gyrA 8717 c.1416C>G synonymous_variant 0.89 fluoroquinolones
gyrA 8720 c.1419G>A synonymous_variant 0.89 fluoroquinolones
gyrA 8726 c.1425G>A synonymous_variant 0.89 fluoroquinolones
gyrA 8729 c.1428T>C synonymous_variant 0.89 fluoroquinolones
gyrA 8732 c.1431G>C synonymous_variant 0.88 fluoroquinolones
gyrA 8735 c.1434C>T synonymous_variant 0.88 fluoroquinolones
gyrA 8747 c.1446A>G synonymous_variant 0.88 fluoroquinolones
gyrA 8756 c.1455A>G synonymous_variant 0.89 fluoroquinolones
gyrA 8762 c.1461G>C synonymous_variant 0.88 fluoroquinolones
gyrA 8765 p.Asp488Glu missense_variant 0.88 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
gyrA 8767 p.Arg489Lys missense_variant 0.89 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
gyrA 8779 p.Asp493Ala missense_variant 0.87 fluoroquinolones
gyrA 8786 c.1485T>C synonymous_variant 0.86 fluoroquinolones
gyrA 8796 p.Ile499Val missense_variant 0.89 fluoroquinolones
gyrA 8801 c.1500G>C synonymous_variant 0.89 fluoroquinolones
gyrA 8810 c.1509A>C synonymous_variant 0.92 fluoroquinolones
gyrA 8829 c.1528T>C synonymous_variant 0.92 fluoroquinolones
gyrA 8852 c.1551T>C synonymous_variant 0.95 fluoroquinolones
gyrA 8858 c.1557T>C synonymous_variant 0.95 fluoroquinolones
gyrA 8867 c.1566A>G synonymous_variant 0.94 fluoroquinolones
gyrA 8870 c.1569G>C synonymous_variant 0.94 fluoroquinolones
gyrA 8873 c.1572A>C synonymous_variant 0.96 fluoroquinolones
gyrA 8897 c.1596T>C synonymous_variant 0.95 fluoroquinolones
gyrA 8903 c.1602T>C synonymous_variant 0.93 fluoroquinolones
gyrA 8915 c.1614A>G synonymous_variant 0.91 fluoroquinolones
gyrA 8918 c.1617C>G synonymous_variant 0.91 fluoroquinolones
gyrA 8939 c.1638T>C synonymous_variant 0.91 fluoroquinolones
gyrA 8942 c.1641G>C synonymous_variant 0.91 fluoroquinolones
gyrA 8945 c.1644G>C synonymous_variant 0.91 fluoroquinolones
gyrA 8946 c.1645_1647delTTGinsCTC synonymous_variant 0.91 fluoroquinolones
gyrA 8951 c.1650G>A synonymous_variant 0.91 fluoroquinolones
gyrA 8966 c.1665C>G synonymous_variant 0.93 fluoroquinolones
gyrA 8967 p.Ala556Arg missense_variant 0.93 fluoroquinolones
gyrA 8987 c.1686C>G synonymous_variant 0.88 fluoroquinolones
gyrA 8990 c.1689C>G synonymous_variant 0.88 fluoroquinolones
gyrA 8996 c.1695T>C synonymous_variant 0.88 fluoroquinolones
gyrA 8998 p.Leu566Trp missense_variant 0.88 fluoroquinolones
gyrA 9023 c.1722A>C synonymous_variant 0.89 fluoroquinolones
gyrA 9029 c.1728T>C synonymous_variant 0.89 fluoroquinolones
gyrA 9032 c.1731T>C synonymous_variant 0.88 fluoroquinolones
gyrA 9035 c.1734G>C synonymous_variant 0.88 fluoroquinolones
gyrA 9050 p.Asp583Glu missense_variant 0.88 fluoroquinolones
levofloxacin Uncertain significance
gyrA 9051 c.1750T>C synonymous_variant 0.88 fluoroquinolones
gyrA 9062 c.1761C>G synonymous_variant 0.87 fluoroquinolones
gyrA 9065 c.1764C>T synonymous_variant 0.87 fluoroquinolones
gyrA 9068 c.1767G>C synonymous_variant 0.87 fluoroquinolones
gyrA 9071 c.1770G>C synonymous_variant 0.87 fluoroquinolones
gyrA 9074 c.1773G>C synonymous_variant 0.88 fluoroquinolones
gyrA 9080 c.1779G>T synonymous_variant 0.89 fluoroquinolones
gyrA 9099 c.1798_1800delTTAinsCTG synonymous_variant 0.88 fluoroquinolones
gyrA 9104 c.1803C>G synonymous_variant 0.88 fluoroquinolones
gyrA 9119 c.1818A>G synonymous_variant 0.87 fluoroquinolones
gyrA 9122 c.1821C>G synonymous_variant 0.87 fluoroquinolones
gyrA 9134 c.1833C>G synonymous_variant 0.88 fluoroquinolones
gyrA 9143 c.1842T>C synonymous_variant 0.88 fluoroquinolones
gyrA 9147 p.Gly616Ser missense_variant 0.89 fluoroquinolones
gyrA 9152 c.1851C>T synonymous_variant 0.95 fluoroquinolones
gyrA 9153 p.Thr618Glu missense_variant 0.95 fluoroquinolones
gyrA 9164 c.1863G>C synonymous_variant 0.98 fluoroquinolones
gyrA 9182 c.1881T>C synonymous_variant 0.98 fluoroquinolones
gyrA 9191 c.1890G>C synonymous_variant 0.98 fluoroquinolones
gyrA 9200 c.1899A>G synonymous_variant 0.98 fluoroquinolones
gyrA 9204 p.Ser635Thr missense_variant 0.98 fluoroquinolones
gyrA 9227 c.1926C>G synonymous_variant 0.98 fluoroquinolones
gyrA 9230 c.1929T>C synonymous_variant 0.98 fluoroquinolones
gyrA 9233 c.1932C>T synonymous_variant 0.98 fluoroquinolones
gyrA 9242 c.1941A>C synonymous_variant 0.98 fluoroquinolones
gyrA 9252 p.Val651Ile missense_variant 0.98 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
gyrA 9275 c.1974G>A synonymous_variant 0.98 fluoroquinolones
gyrA 9278 c.1977G>C synonymous_variant 0.98 fluoroquinolones
gyrA 9281 c.1980C>G synonymous_variant 0.98 fluoroquinolones
gyrA 9284 c.1983T>C synonymous_variant 0.98 fluoroquinolones
gyrA 9291 c.1990C>T synonymous_variant 0.98 fluoroquinolones
gyrA 9296 c.1995T>C synonymous_variant 0.98 fluoroquinolones
gyrA 9304 p.Gly668Glu missense_variant 1.0 fluoroquinolones
gyrA 9311 c.2010C>T synonymous_variant 0.98 fluoroquinolones
gyrA 9323 c.2022C>G synonymous_variant 0.98 fluoroquinolones
gyrA 9335 c.2034G>C synonymous_variant 0.98 fluoroquinolones
gyrA 9345 c.2044A>C synonymous_variant 0.98 fluoroquinolones
gyrA 9374 c.2073G>C synonymous_variant 1.0 fluoroquinolones
gyrA 9377 c.2076A>G synonymous_variant 1.0 fluoroquinolones
gyrA 9383 c.2082T>C synonymous_variant 1.0 fluoroquinolones
gyrA 9386 c.2085T>C synonymous_variant 1.0 fluoroquinolones
gyrA 9395 c.2094G>C synonymous_variant 1.0 fluoroquinolones
gyrA 9413 c.2112G>C synonymous_variant 1.0 fluoroquinolones
gyrA 9419 c.2118T>C synonymous_variant 1.0 fluoroquinolones
gyrA 9420 p.Ile707Ala missense_variant 1.0 fluoroquinolones
gyrA 9429 p.Arg710Tyr missense_variant 1.0 fluoroquinolones
gyrA 9443 c.2142G>C synonymous_variant 1.0 fluoroquinolones
gyrA 9449 c.2148C>G synonymous_variant 0.98 fluoroquinolones
gyrA 9452 c.2151G>C synonymous_variant 0.98 fluoroquinolones
gyrA 9455 c.2154T>C synonymous_variant 0.98 fluoroquinolones
gyrA 9458 c.2157A>G synonymous_variant 0.98 fluoroquinolones
gyrA 9467 c.2166T>C synonymous_variant 0.98 fluoroquinolones
gyrA 9485 c.2184A>C synonymous_variant 0.98 fluoroquinolones
gyrA 9488 c.2187G>C synonymous_variant 0.97 fluoroquinolones
gyrA 9491 c.2190C>G synonymous_variant 0.97 fluoroquinolones
gyrA 9494 c.2193T>C synonymous_variant 0.97 fluoroquinolones
gyrA 9497 c.2196G>C synonymous_variant 0.95 fluoroquinolones
gyrA 9500 c.2199A>G synonymous_variant 0.95 fluoroquinolones
gyrA 9503 c.2202T>C synonymous_variant 0.95 fluoroquinolones
gyrA 9518 c.2217A>G synonymous_variant 0.95 fluoroquinolones
gyrA 9521 c.2220C>T synonymous_variant 0.95 fluoroquinolones
gyrA 9527 c.2226A>G synonymous_variant 0.95 fluoroquinolones
gyrA 9542 c.2241T>C synonymous_variant 0.95 fluoroquinolones
gyrA 9545 c.2244A>G synonymous_variant 0.95 fluoroquinolones
gyrA 9548 c.2247T>C synonymous_variant 0.95 fluoroquinolones
gyrA 9557 c.2256G>C synonymous_variant 0.94 fluoroquinolones
gyrA 9560 c.2259C>G synonymous_variant 0.94 fluoroquinolones
gyrA 9566 c.2265C>T synonymous_variant 0.94 fluoroquinolones
gyrA 9575 c.2274G>C synonymous_variant 0.94 fluoroquinolones
gyrA 9578 c.2277C>T synonymous_variant 0.94 fluoroquinolones
gyrA 9585 c.2284T>C synonymous_variant 0.94 fluoroquinolones
gyrA 9590 c.2289T>G synonymous_variant 0.94 fluoroquinolones
gyrA 9593 c.2292G>T synonymous_variant 0.94 fluoroquinolones
gyrA 9597 c.2296T>C synonymous_variant 0.91 fluoroquinolones
gyrA 9605 c.2304C>G synonymous_variant 0.91 fluoroquinolones
gyrA 9611 p.Asp770Glu missense_variant 0.91 fluoroquinolones
gyrA 9626 c.2325T>C synonymous_variant 0.9 fluoroquinolones
gyrA 9629 c.2328C>G synonymous_variant 0.9 fluoroquinolones
gyrA 9630 p.Val777Ile missense_variant 0.9 fluoroquinolones
gyrA 9635 c.2334T>C synonymous_variant 0.9 fluoroquinolones
gyrA 9644 c.2343T>C synonymous_variant 0.87 fluoroquinolones
gyrA 9647 c.2346C>T synonymous_variant 0.86 fluoroquinolones
gyrA 9650 c.2349G>C synonymous_variant 0.86 fluoroquinolones
gyrA 9665 c.2364A>G synonymous_variant 0.85 fluoroquinolones
gyrA 9666 p.Arg789Gly missense_variant 0.85 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
gyrA 9674 c.2373T>C synonymous_variant 0.81 fluoroquinolones
gyrA 9677 c.2376C>T synonymous_variant 0.8 fluoroquinolones
gyrA 9701 c.2400T>C synonymous_variant 0.68 fluoroquinolones
gyrA 9704 c.2403T>C synonymous_variant 0.68 fluoroquinolones
gyrA 9708 c.2407T>C synonymous_variant 0.68 fluoroquinolones
gyrA 9722 c.2421C>T synonymous_variant 0.68 fluoroquinolones
gyrA 9734 c.2433A>G synonymous_variant 0.62 fluoroquinolones
gyrA 9738 c.2437T>C synonymous_variant 0.62 fluoroquinolones
gyrA 9749 c.2448G>C synonymous_variant 0.5 fluoroquinolones
fgd1 490815 c.33G>C synonymous_variant 0.91 delamanid
fgd1 490827 c.45C>T synonymous_variant 0.92 delamanid
fgd1 490833 c.51G>C synonymous_variant 1.0 delamanid
fgd1 490842 c.60C>G synonymous_variant 1.0 delamanid
fgd1 490851 c.69A>C synonymous_variant 1.0 delamanid
fgd1 490887 c.105G>C synonymous_variant 1.0 delamanid
fgd1 490902 c.120T>C synonymous_variant 1.0 delamanid
fgd1 490905 c.123T>C synonymous_variant 1.0 delamanid
fgd1 490911 c.129T>G synonymous_variant 1.0 delamanid
fgd1 490917 c.135C>A synonymous_variant 1.0 delamanid
fgd1 490921 p.Gln47Glu missense_variant 1.0 delamanid
fgd1 490932 c.150T>C synonymous_variant 1.0 delamanid
fgd1 490948 p.Ser56Ala missense_variant 1.0 delamanid
fgd1 490962 c.180T>C synonymous_variant 1.0 delamanid
fgd1 490968 c.186C>G synonymous_variant 1.0 delamanid
fgd1 490974 c.192T>C synonymous_variant 1.0 delamanid
fgd1 490979 p.Asn66Thr missense_variant 1.0 delamanid
fgd1 490984 p.Leu68Ile missense_variant 1.0 delamanid
fgd1 490987 p.Leu69Thr missense_variant 1.0 delamanid
fgd1 490998 c.216T>C synonymous_variant 1.0 delamanid
fgd1 491007 c.225G>C synonymous_variant 1.0 delamanid
fgd1 491010 c.228C>G synonymous_variant 1.0 delamanid
fgd1 491013 c.231C>G synonymous_variant 1.0 delamanid
fgd1 491031 c.249C>G synonymous_variant 1.0 delamanid
fgd1 491038 p.Ile86Val missense_variant 0.98 delamanid
fgd1 491043 c.261T>G synonymous_variant 0.98 delamanid
fgd1 491049 c.267T>C synonymous_variant 0.98 delamanid
fgd1 491063 p.Gly94Ala missense_variant 0.95 delamanid
fgd1 491077 p.Asn99Gly missense_variant 0.95 delamanid
fgd1 491082 c.300T>G synonymous_variant 0.95 delamanid
fgd1 491083 p.Val101Ile missense_variant 0.95 delamanid
fgd1 491091 c.309T>C synonymous_variant 0.95 delamanid
fgd1 491094 c.312C>G synonymous_variant 0.95 delamanid
fgd1 491106 c.324T>C synonymous_variant 0.96 delamanid
fgd1 491121 c.339A>G synonymous_variant 0.96 delamanid
fgd1 491137 p.Glu119Gln missense_variant 0.96 delamanid
fgd1 491144 p.Ala121Glu missense_variant 0.96 delamanid
fgd1 491166 c.384G>C synonymous_variant 0.91 delamanid
fgd1 491181 c.399T>C synonymous_variant 0.91 delamanid
fgd1 491191 p.Gly137Arg missense_variant 0.91 delamanid
fgd1 491196 c.414A>G synonymous_variant 0.91 delamanid
fgd1 491202 c.420G>C synonymous_variant 0.9 delamanid
fgd1 491203 p.Gln141Glu missense_variant 0.9 delamanid
fgd1 491212 p.Ser144Arg missense_variant 0.9 delamanid
fgd1 491217 c.435T>C synonymous_variant 0.9 delamanid
fgd1 491232 c.450T>C synonymous_variant 0.89 delamanid
fgd1 491241 p.Asp153Glu missense_variant 0.84 delamanid
fgd1 491244 c.462T>C synonymous_variant 0.84 delamanid
fgd1 491250 c.468G>A synonymous_variant 0.85 delamanid
fgd1 491259 c.477T>C synonymous_variant 0.85 delamanid
fgd1 491286 c.504G>C synonymous_variant 0.78 delamanid
fgd1 491292 c.510G>C synonymous_variant 0.74 delamanid
fgd1 491295 c.513C>G synonymous_variant 0.73 delamanid
fgd1 491296 p.Val172Ile missense_variant 0.73 delamanid
fgd1 491319 c.537G>C synonymous_variant 0.75 delamanid
fgd1 491331 c.549G>A synonymous_variant 0.73 delamanid
fgd1 491343 c.561C>G synonymous_variant 0.74 delamanid
fgd1 491349 c.567T>C synonymous_variant 0.74 delamanid
fgd1 491359 p.Ile193Val missense_variant 0.76 delamanid
fgd1 491364 c.582T>C synonymous_variant 0.74 delamanid
fgd1 491367 c.585G>C synonymous_variant 0.72 delamanid
fgd1 491388 c.606C>G synonymous_variant 0.65 delamanid
fgd1 491393 p.Thr204Lys missense_variant 0.63 delamanid
fgd1 491397 p.Glu205Asp missense_variant 0.6 delamanid
fgd1 491406 p.Met208Ile missense_variant 0.6 delamanid
fgd1 491409 c.627G>C synonymous_variant 0.6 delamanid
fgd1 491415 c.633A>C synonymous_variant 0.58 delamanid
fgd1 491416 p.Arg212Met missense_variant 0.58 delamanid
fgd1 491421 c.639A>G synonymous_variant 0.58 delamanid
fgd1 491426 c.645_648delCGCT frameshift_variant 0.58 delamanid
fgd1 491432 p.Ala217Gly missense_variant 0.58 delamanid
fgd1 491435 p.Ala218Asp missense_variant 0.61 delamanid
fgd1 491436 c.654_655insCAAC frameshift_variant 0.61 delamanid
fgd1 491453 p.Gly224Asp missense_variant 0.61 delamanid
fgd1 491472 c.690A>G synonymous_variant 0.63 delamanid
fgd1 491502 c.720G>A synonymous_variant 0.68 delamanid
fgd1 491508 c.726A>G synonymous_variant 0.65 delamanid
fgd1 491509 c.727T>C synonymous_variant 0.65 delamanid
fgd1 491512 p.Asn244Glu missense_variant 0.65 delamanid
fgd1 491526 c.744T>C synonymous_variant 0.65 delamanid
fgd1 491542 c.760T>C synonymous_variant 0.65 delamanid
fgd1 491547 c.765A>C synonymous_variant 0.62 delamanid
fgd1 491550 c.768T>C synonymous_variant 0.6 delamanid
fgd1 491583 c.801G>A synonymous_variant 0.57 delamanid
fgd1 491595 c.813C>G synonymous_variant 0.57 delamanid
fgd1 491601 c.819T>C synonymous_variant 0.57 delamanid
fgd1 491610 c.828A>C synonymous_variant 0.5 delamanid
fgd1 491616 c.834A>G synonymous_variant 0.5 delamanid
fgd1 491620 p.Ile280Val missense_variant 0.46 delamanid
fgd1 491643 c.861G>C synonymous_variant 0.45 delamanid
fgd1 491712 c.930T>C synonymous_variant 0.3 delamanid
fgd1 491721 c.939A>C synonymous_variant 0.3 delamanid
fgd1 491724 c.942A>C synonymous_variant 0.3 delamanid
fgd1 491727 c.945T>C synonymous_variant 0.3 delamanid
fgd1 491742 c.960T>C synonymous_variant 1.0 delamanid
mshA 575476 p.Asp43Glu missense_variant 0.29 ethionamide
mshA 575488 c.141T>G synonymous_variant 0.52 ethionamide
mshA 575491 c.144G>C synonymous_variant 0.52 ethionamide
mshA 575492 p.Leu49Val missense_variant 0.5 ethionamide
mshA 575503 c.156G>C synonymous_variant 0.6 ethionamide
mshA 575512 c.165A>G synonymous_variant 0.63 ethionamide
mshA 575515 c.168G>A synonymous_variant 0.66 ethionamide
mshA 575521 c.174A>C synonymous_variant 0.68 ethionamide
mshA 575527 c.180G>C synonymous_variant 0.7 ethionamide
mshA 575536 c.189T>C synonymous_variant 0.73 ethionamide
mshA 575542 c.195C>G synonymous_variant 0.78 ethionamide
mshA 575554 c.207C>T synonymous_variant 0.79 ethionamide
mshA 575561 p.Met72Val missense_variant 0.77 ethionamide
mshA 575569 c.222A>G synonymous_variant 0.77 ethionamide
mshA 575571 p.Ser75Thr missense_variant 0.77 ethionamide
mshA 575575 c.228G>C synonymous_variant 0.76 ethionamide
mshA 575587 c.240C>A synonymous_variant 0.79 ethionamide
mshA 575590 c.243T>C synonymous_variant 0.8 ethionamide
mshA 575593 c.246G>C synonymous_variant 0.81 ethionamide
mshA 575623 c.276C>G synonymous_variant 0.83 ethionamide
mshA 575629 c.282A>C synonymous_variant 0.83 ethionamide
mshA 575635 c.288A>C synonymous_variant 0.83 ethionamide
mshA 575638 c.291T>C synonymous_variant 0.83 ethionamide
mshA 575641 c.294A>G synonymous_variant 0.83 ethionamide
mshA 575648 p.Val101Gln missense_variant 0.84 ethionamide
mshA 575659 c.312A>G synonymous_variant 0.85 ethionamide
mshA 575665 c.318G>C synonymous_variant 0.85 ethionamide
mshA 575689 c.342G>C synonymous_variant 0.92 ethionamide
mshA 575695 c.348C>G synonymous_variant 0.92 ethionamide
mshA 575704 c.357T>C synonymous_variant 0.9 ethionamide
mshA 575705 c.358T>C synonymous_variant 0.9 ethionamide
mshA 575713 c.366G>A synonymous_variant 0.9 ethionamide
mshA 575719 c.372C>T synonymous_variant 0.9 ethionamide
mshA 575734 c.387T>G synonymous_variant 0.9 ethionamide
mshA 575737 c.390T>C synonymous_variant 0.9 ethionamide
mshA 575746 c.399C>G synonymous_variant 0.9 ethionamide
mshA 575752 c.405G>A synonymous_variant 0.91 ethionamide
mshA 575767 c.420G>A synonymous_variant 0.9 ethionamide
mshA 575771 p.Val142Ser missense_variant 0.89 ethionamide
mshA 575779 c.432A>G synonymous_variant 0.9 ethionamide
mshA 575821 c.474G>C synonymous_variant 0.82 ethionamide
mshA 575824 c.477T>G synonymous_variant 0.87 ethionamide
mshA 575864 c.517T>C synonymous_variant 0.86 ethionamide
mshA 575878 c.531A>G synonymous_variant 0.81 ethionamide
mshA 575884 c.537G>C synonymous_variant 0.75 ethionamide
mshA 575893 c.546C>G synonymous_variant 0.75 ethionamide
mshA 575902 c.555C>T synonymous_variant 0.71 ethionamide
mshA 575905 c.558G>C synonymous_variant 0.71 ethionamide
mshA 575908 c.561A>G synonymous_variant 0.74 ethionamide
mshA 575914 c.567C>G synonymous_variant 0.74 ethionamide
mshA 575915 p.Asp190Gln missense_variant 0.74 ethionamide
mshA 575920 c.573C>G synonymous_variant 0.74 ethionamide
mshA 575929 c.582C>A synonymous_variant 0.7 ethionamide
mshA 575944 c.597T>C synonymous_variant 0.7 ethionamide
mshA 575950 c.603C>G synonymous_variant 0.74 ethionamide
mshA 575953 c.606G>C synonymous_variant 0.74 ethionamide
mshA 575965 c.618C>G synonymous_variant 0.78 ethionamide
mshA 575977 c.630G>C synonymous_variant 0.76 ethionamide
mshA 575980 c.633T>C synonymous_variant 0.76 ethionamide
mshA 575984 c.637T>C synonymous_variant 0.76 ethionamide
mshA 576004 c.657T>C synonymous_variant 0.73 ethionamide
ccsA 619697 c.-194A>C upstream_gene_variant 0.82 capreomycin
ccsA 620198 p.Gln103Leu missense_variant 0.85 capreomycin
ccsA 620245 c.355T>C synonymous_variant 0.85 capreomycin
ccsA 620249 p.Ser120Cys missense_variant 0.89 capreomycin
amikacin Uncertain significance
ccsA 620254 c.364_366delCTCinsTTG synonymous_variant 0.89 capreomycin
ccsA 620257 p.Ile123Val missense_variant 0.89 capreomycin
amikacin Uncertain significance
ccsA 620265 c.375C>G synonymous_variant 0.9 capreomycin
ccsA 620269 p.Val127Ile missense_variant 0.91 capreomycin
amikacin Uncertain significance
ccsA 620283 c.393T>C synonymous_variant 0.9 capreomycin
ccsA 620284 p.Ala132Pro missense_variant 0.9 capreomycin
amikacin Uncertain significance
ccsA 620288 p.Arg133Gln missense_variant 0.9 capreomycin
amikacin Uncertain significance
ccsA 620295 c.405G>C synonymous_variant 0.91 capreomycin
ccsA 620307 c.417C>G synonymous_variant 0.92 capreomycin
ccsA 620317 p.Val143Leu missense_variant 0.92 capreomycin
amikacin Uncertain significance
ccsA 620322 c.432G>C synonymous_variant 0.93 capreomycin
ccsA 620340 c.450C>G synonymous_variant 0.9 capreomycin
ccsA 620349 c.459A>G synonymous_variant 0.9 capreomycin
ccsA 620362 p.Ala158Thr missense_variant 0.89 capreomycin
amikacin Uncertain significance
ccsA 620367 c.477T>C synonymous_variant 0.89 capreomycin
ccsA 620373 c.483C>G synonymous_variant 0.89 capreomycin
ccsA 620385 c.495G>C synonymous_variant 0.89 capreomycin
ccsA 620388 c.498A>G synonymous_variant 0.89 capreomycin
ccsA 620412 c.522T>C synonymous_variant 0.89 capreomycin
ccsA 620415 c.525T>C synonymous_variant 0.89 capreomycin
ccsA 620433 c.543C>G synonymous_variant 0.82 capreomycin
ccsA 620436 c.546T>C synonymous_variant 0.82 capreomycin
ccsA 620439 c.549T>C synonymous_variant 0.82 capreomycin
ccsA 620445 c.555A>G synonymous_variant 0.81 capreomycin
ccsA 620460 c.570T>C synonymous_variant 0.8 capreomycin
ccsA 620461 p.Val191Ile missense_variant 0.79 capreomycin
amikacin Uncertain significance
ccsA 620481 c.591T>G synonymous_variant 0.76 capreomycin
ccsA 620482 p.Val198Leu missense_variant 0.75 capreomycin
amikacin Uncertain significance
ccsA 620490 c.600A>C synonymous_variant 0.75 capreomycin
ccsA 620495 p.Arg202Pro missense_variant 0.69 capreomycin
amikacin Uncertain significance
ccsA 620571 c.681A>C synonymous_variant 0.75 capreomycin
ccsA 620589 c.699G>C synonymous_variant 0.76 capreomycin
ccsA 620598 c.708C>G synonymous_variant 0.79 capreomycin
ccsA 620604 c.714C>T synonymous_variant 0.8 capreomycin
ccsA 620607 c.717T>G synonymous_variant 0.81 capreomycin
ccsA 620619 c.729G>C synonymous_variant 0.83 capreomycin
ccsA 620622 c.732G>C synonymous_variant 0.83 capreomycin
ccsA 620625 c.735A>C synonymous_variant 0.85 capreomycin
ccsA 620631 c.741T>C synonymous_variant 0.86 capreomycin
ccsA 620646 c.756G>A synonymous_variant 0.86 capreomycin
ccsA 620661 c.771C>G synonymous_variant 0.92 capreomycin
ccsA 620703 c.813G>C synonymous_variant 0.88 capreomycin
ccsA 620710 p.Val274Ile missense_variant 0.88 capreomycin
amikacin Uncertain significance
ccsA 620718 c.828G>C synonymous_variant 0.87 capreomycin
ccsA 620721 c.831G>C synonymous_variant 0.87 capreomycin
ccsA 620730 c.840C>T synonymous_variant 0.86 capreomycin
ccsA 620733 c.843G>C synonymous_variant 0.86 capreomycin
ccsA 620734 c.844C>A synonymous_variant 0.86 capreomycin
ccsA 620739 c.849A>G synonymous_variant 0.86 capreomycin
ccsA 620745 c.855G>C synonymous_variant 0.86 capreomycin
ccsA 620748 c.858T>A synonymous_variant 0.86 capreomycin
ccsA 620778 c.888T>C synonymous_variant 0.89 capreomycin
ccsA 620784 c.894C>G synonymous_variant 0.89 capreomycin
ccsA 620787 c.897C>G synonymous_variant 0.89 capreomycin
ccsA 620809 c.919C>T synonymous_variant 0.85 capreomycin
rpoB 760059 p.Tyr85Asp missense_variant 0.64 rifampicin
rpoB 760070 c.264T>G synonymous_variant 0.73 rifampicin
rpoB 760088 c.282C>G synonymous_variant 0.78 rifampicin
rpoB 760091 c.285G>C synonymous_variant 0.82 rifampicin
rpoB 760101 c.295T>C synonymous_variant 0.87 rifampicin
rpoB 760106 c.300G>T synonymous_variant 0.89 rifampicin
rpoB 760112 c.306T>C synonymous_variant 0.89 rifampicin
rpoB 760118 c.312T>C synonymous_variant 0.9 rifampicin
rpoB 760121 c.315T>C synonymous_variant 0.9 rifampicin
rpoB 760130 p.Asp108Glu missense_variant 0.91 rifampicin Uncertain significance
rpoB 760139 c.333A>G synonymous_variant 0.91 rifampicin
rpoB 760142 c.336C>G synonymous_variant 0.91 rifampicin
rpoB 760181 c.375T>C synonymous_variant 0.9 rifampicin
rpoB 760184 c.378A>G synonymous_variant 0.9 rifampicin
rpoB 760196 c.390C>G synonymous_variant 0.93 rifampicin
rpoB 760223 c.417T>C synonymous_variant 0.94 rifampicin
rpoB 760235 c.429T>C synonymous_variant 0.94 rifampicin
rpoB 760253 c.447T>C synonymous_variant 0.94 rifampicin
rpoB 760283 c.477G>C synonymous_variant 0.95 rifampicin
rpoB 760307 c.501T>C synonymous_variant 0.93 rifampicin
rpoB 760328 c.522G>C synonymous_variant 0.93 rifampicin
rpoB 760331 c.525G>C synonymous_variant 0.93 rifampicin
rpoB 760337 c.531C>G synonymous_variant 0.93 rifampicin
rpoB 760340 c.534G>C synonymous_variant 0.93 rifampicin
rpoB 760361 c.555T>C synonymous_variant 0.94 rifampicin
rpoB 760376 p.Asp190Glu missense_variant 0.93 rifampicin
rpoB 760406 c.600G>C synonymous_variant 0.93 rifampicin
rpoB 760418 c.612G>C synonymous_variant 0.93 rifampicin
rpoB 760424 c.618C>G synonymous_variant 0.93 rifampicin
rpoB 760430 c.624T>C synonymous_variant 0.93 rifampicin
rpoB 760475 c.669A>G synonymous_variant 0.9 rifampicin
rpoB 760481 c.675G>C synonymous_variant 0.92 rifampicin
rpoB 760484 c.678A>G synonymous_variant 0.92 rifampicin
rpoB 760514 c.708C>T synonymous_variant 0.91 rifampicin
rpoB 760522 p.Ser239Asn missense_variant 0.91 rifampicin
rpoB 760532 c.726T>C synonymous_variant 0.92 rifampicin
rpoB 760533 p.Val243Thr missense_variant 0.92 rifampicin
rpoB 760547 c.741G>C synonymous_variant 0.93 rifampicin
rpoB 760563 p.Arg253Met missense_variant 0.92 rifampicin
rpoB 760591 p.Val262Ala missense_variant 0.92 rifampicin Uncertain significance
rpoB 760611 c.805T>C synonymous_variant 0.91 rifampicin
rpoB 760634 c.828T>C synonymous_variant 0.92 rifampicin
rpoB 760646 c.840C>G synonymous_variant 0.92 rifampicin
rpoB 760655 c.849A>G synonymous_variant 0.92 rifampicin
rpoB 760661 c.855A>C synonymous_variant 0.92 rifampicin
rpoB 760670 c.864G>C synonymous_variant 0.92 rifampicin
rpoB 760674 c.868T>C synonymous_variant 0.92 rifampicin
rpoB 760679 c.873A>G synonymous_variant 0.92 rifampicin
rpoB 760683 c.877T>C synonymous_variant 0.93 rifampicin
rpoB 760718 c.912C>G synonymous_variant 0.96 rifampicin
rpoB 760721 c.915C>G synonymous_variant 0.96 rifampicin
rpoB 760724 c.918T>C synonymous_variant 0.96 rifampicin
rpoB 760730 c.924T>C synonymous_variant 0.96 rifampicin
rpoB 760751 c.945G>C synonymous_variant 0.94 rifampicin
rpoB 760757 c.951T>C synonymous_variant 0.97 rifampicin
rpoB 760759 p.Val318Ala missense_variant 0.97 rifampicin
rpoB 760763 c.957C>T synonymous_variant 0.97 rifampicin
rpoB 760769 c.963C>G synonymous_variant 0.97 rifampicin
rpoB 760775 c.969G>C synonymous_variant 0.97 rifampicin
rpoB 760776 c.970_972delTCGinsAGC synonymous_variant 0.97 rifampicin
rpoB 760793 c.987A>G synonymous_variant 0.99 rifampicin
rpoB 760805 c.999G>C synonymous_variant 0.99 rifampicin
rpoB 760817 c.1011A>G synonymous_variant 0.99 rifampicin
rpoB 760820 c.1014T>C synonymous_variant 1.0 rifampicin
rpoB 760826 c.1020C>G synonymous_variant 1.0 rifampicin
rpoB 760830 c.1024T>C synonymous_variant 1.0 rifampicin
rpoB 760845 p.Thr347Pro missense_variant 1.0 rifampicin
rpoB 760859 c.1053T>C synonymous_variant 1.0 rifampicin
rpoB 760862 c.1056G>C synonymous_variant 1.0 rifampicin
rpoB 760869 p.Val355Ile missense_variant 1.0 rifampicin Uncertain significance
rpoB 760886 c.1080A>G synonymous_variant 1.0 rifampicin
rpoB 760919 c.1113C>G synonymous_variant 1.0 rifampicin
rpoB 760925 c.1119T>C synonymous_variant 1.0 rifampicin
rpoB 760928 c.1122G>C synonymous_variant 1.0 rifampicin
rpoB 760934 c.1128C>T synonymous_variant 1.0 rifampicin
rpoB 760946 c.1140A>G synonymous_variant 0.99 rifampicin
rpoB 760970 c.1164G>C synonymous_variant 0.97 rifampicin
rpoB 760982 c.1176G>C synonymous_variant 0.97 rifampicin
rpoB 760985 c.1179G>C synonymous_variant 0.97 rifampicin
rpoB 760991 c.1185G>C synonymous_variant 0.97 rifampicin
rpoB 761015 c.1209G>C synonymous_variant 0.97 rifampicin
rpoB 761021 c.1215G>C synonymous_variant 0.97 rifampicin
rpoB 761027 c.1221A>G synonymous_variant 0.96 rifampicin
rpoB 761036 c.1230G>C synonymous_variant 0.97 rifampicin
rpoB 761037 c.1231T>C synonymous_variant 0.97 rifampicin
rpoB 761051 c.1245G>T synonymous_variant 0.97 rifampicin
rpoB 761054 c.1248G>C synonymous_variant 0.97 rifampicin
rpoB 761057 c.1251G>C synonymous_variant 0.97 rifampicin
rpoB 761060 c.1254C>G synonymous_variant 0.97 rifampicin
rpoB 761063 c.1257C>G synonymous_variant 0.97 rifampicin
rpoB 761097 c.1291_1292delAGinsTC synonymous_variant 0.99 rifampicin
rpoB 761102 c.1296A>G synonymous_variant 0.99 rifampicin
rpoB 761133 c.1327_1329delTTGinsCTC synonymous_variant 0.99 rifampicin
rpoB 761150 c.1344A>C synonymous_variant 0.99 rifampicin
rpoB 761165 c.1359G>C synonymous_variant 0.96 rifampicin
rpoB 761168 c.1362C>G synonymous_variant 0.97 rifampicin
rpoB 761171 c.1365C>T synonymous_variant 0.99 rifampicin
rpoB 761180 c.1374A>C synonymous_variant 0.99 rifampicin
rpoB 761183 c.1377T>G synonymous_variant 0.99 rifampicin
rpoB 761189 c.1383T>G synonymous_variant 0.99 rifampicin
rpoB 761222 c.1416G>C synonymous_variant 0.99 rifampicin
rpoB 761249 c.1443A>G synonymous_variant 1.0 rifampicin
rpoB 761255 c.1449T>G synonymous_variant 1.0 rifampicin
rpoB 761261 c.1455G>T synonymous_variant 0.99 rifampicin
rpoB 761327 c.1521A>G synonymous_variant 0.99 rifampicin
rpoB 761360 c.1554T>C synonymous_variant 0.99 rifampicin
rpoB 761362 p.Ser519Thr missense_variant 0.99 rifampicin
rpoB 761373 p.Val523His missense_variant 0.99 rifampicin
rpoB 761414 c.1608A>G synonymous_variant 0.95 rifampicin
rpoB 761423 c.1617T>C synonymous_variant 0.93 rifampicin
rpoB 761434 c.1629_1630delTG frameshift_variant 0.93 rifampicin
rpoB 761444 c.1638T>C synonymous_variant 0.93 rifampicin
rpoB 761447 c.1641C>G synonymous_variant 0.93 rifampicin
rpoB 761452 p.Val549Ala missense_variant 0.91 rifampicin
rpoB 761457 p.Pro551Ala missense_variant 0.91 rifampicin
rpoB 761462 c.1656C>G synonymous_variant 0.89 rifampicin
rpoB 761492 c.1686G>C synonymous_variant 0.85 rifampicin
rpoB 761510 c.1704T>C synonymous_variant 0.83 rifampicin
rpoB 761531 c.1725C>G synonymous_variant 0.79 rifampicin
rpoB 761537 c.1731C>G synonymous_variant 0.8 rifampicin
rpoB 761570 c.1764T>C synonymous_variant 0.81 rifampicin
rpoB 761573 c.1767C>G synonymous_variant 0.81 rifampicin
rpoB 761579 c.1773G>C synonymous_variant 0.84 rifampicin
rpoB 761606 c.1800C>G synonymous_variant 0.85 rifampicin
rpoB 761612 c.1806G>C synonymous_variant 0.86 rifampicin
rpoB 761615 c.1809A>C synonymous_variant 0.86 rifampicin
rpoB 761636 c.1830G>T synonymous_variant 0.86 rifampicin
rpoB 761645 c.1839C>G synonymous_variant 0.87 rifampicin
rpoB 761648 c.1842T>C synonymous_variant 0.87 rifampicin
rpoB 761657 c.1851C>G synonymous_variant 0.85 rifampicin
rpoB 761675 c.1869G>C synonymous_variant 0.84 rifampicin
rpoB 761690 c.1884G>C synonymous_variant 0.83 rifampicin
rpoB 761732 c.1926C>G synonymous_variant 0.86 rifampicin
rpoB 761735 c.1929C>G synonymous_variant 0.87 rifampicin
rpoB 761747 c.1941G>C synonymous_variant 0.9 rifampicin
rpoB 761750 c.1944G>C synonymous_variant 0.9 rifampicin
rpoB 761765 c.1959T>C synonymous_variant 0.9 rifampicin
rpoB 761772 p.His656Ala missense_variant 0.9 rifampicin
rpoB 761778 p.Asn658Asp missense_variant 0.9 rifampicin
rpoB 761791 p.Arg662His missense_variant 0.89 rifampicin
rpoB 761813 c.2007T>C synonymous_variant 0.88 rifampicin
rpoB 761815 p.Ala670Glu missense_variant 0.88 rifampicin
rpoB 761834 c.2028T>C synonymous_variant 0.88 rifampicin
rpoB 761847 p.Cys681Ser missense_variant 0.88 rifampicin
rpoB 761852 c.2046C>G synonymous_variant 0.88 rifampicin
rpoB 761858 c.2052G>C synonymous_variant 0.89 rifampicin
rpoB 761864 c.2058G>C synonymous_variant 0.89 rifampicin
rpoB 761873 c.2067A>G synonymous_variant 0.9 rifampicin
rpoB 761885 c.2079T>C synonymous_variant 0.91 rifampicin
rpoB 761891 c.2085G>C synonymous_variant 0.91 rifampicin
rpoB 761906 c.2100C>G synonymous_variant 0.9 rifampicin
rpoB 761909 c.2103T>C synonymous_variant 0.9 rifampicin
rpoB 761912 c.2106T>C synonymous_variant 0.9 rifampicin
rpoB 761915 p.Asp703Glu missense_variant 0.9 rifampicin Uncertain significance
rpoB 761916 p.Asp704Asn missense_variant 0.9 rifampicin
rpoB 761931 c.2125C>T synonymous_variant 0.92 rifampicin
rpoB 761948 c.2142G>C synonymous_variant 0.92 rifampicin
rpoB 761954 c.2148C>G synonymous_variant 0.91 rifampicin
rpoB 761999 c.2193G>C synonymous_variant 0.94 rifampicin
rpoB 762008 c.2202C>G synonymous_variant 0.94 rifampicin
rpoB 762014 c.2208C>T synonymous_variant 0.94 rifampicin
rpoB 762017 c.2211A>G synonymous_variant 0.94 rifampicin
rpoB 762027 c.2221_2223delCTCinsTTG synonymous_variant 0.94 rifampicin
rpoB 762032 c.2226C>G synonymous_variant 0.94 rifampicin
rpoB 762035 c.2229G>C synonymous_variant 0.94 rifampicin
rpoB 762053 c.2247T>C synonymous_variant 0.95 rifampicin
rpoB 762062 c.2256T>C synonymous_variant 0.95 rifampicin
rpoB 762065 c.2259T>C synonymous_variant 0.94 rifampicin
rpoB 762083 c.2277T>C synonymous_variant 0.97 rifampicin
rpoB 762086 c.2280G>C synonymous_variant 0.97 rifampicin
rpoB 762101 c.2295C>G synonymous_variant 0.97 rifampicin
rpoB 762114 p.Ile770Val missense_variant 0.97 rifampicin
rpoB 762131 c.2325C>G synonymous_variant 0.94 rifampicin
rpoB 762140 c.2334G>C synonymous_variant 0.94 rifampicin
rpoB 762143 c.2337T>C synonymous_variant 0.94 rifampicin
rpoB 762149 c.2343G>C synonymous_variant 0.95 rifampicin
rpoB 762167 c.2361T>C synonymous_variant 0.94 rifampicin
rpoB 762176 c.2370T>C synonymous_variant 0.95 rifampicin
rpoB 762185 c.2379G>C synonymous_variant 0.95 rifampicin
rpoB 762218 c.2412T>G synonymous_variant 0.97 rifampicin
rpoB 762254 c.2448T>C synonymous_variant 0.95 rifampicin
rpoB 762266 c.2460T>C synonymous_variant 0.95 rifampicin
rpoB 762284 c.2478G>C synonymous_variant 0.95 rifampicin
rpoB 762293 c.2487T>C synonymous_variant 0.94 rifampicin
rpoB 762317 c.2511A>G synonymous_variant 0.94 rifampicin
rpoB 762329 c.2523G>C synonymous_variant 0.93 rifampicin
rpoB 762338 c.2532T>C synonymous_variant 0.92 rifampicin
rpoB 762347 c.2541T>C synonymous_variant 0.92 rifampicin
rpoB 762362 p.Glu852Asp missense_variant 0.92 rifampicin
rpoB 762369 c.2563T>C synonymous_variant 0.92 rifampicin
rpoC 762374 c.-996G>C upstream_gene_variant 0.93 rifampicin
rpoC 762380 c.-990T>G upstream_gene_variant 0.94 rifampicin
rpoC 762395 c.-975G>C upstream_gene_variant 0.92 rifampicin
rpoC 762398 c.-972T>C upstream_gene_variant 0.93 rifampicin
rpoC 762401 c.-969G>C upstream_gene_variant 0.92 rifampicin
rpoC 762404 c.-966T>C upstream_gene_variant 0.92 rifampicin
rpoC 762410 c.-960T>C upstream_gene_variant 0.92 rifampicin
rpoC 762416 c.-954A>G upstream_gene_variant 0.92 rifampicin
rpoC 762443 c.-927G>C upstream_gene_variant 0.92 rifampicin
rpoC 762470 c.-900G>C upstream_gene_variant 0.92 rifampicin
rpoB 762489 p.Val895Gln missense_variant 0.91 rifampicin
rpoC 762509 c.-861T>G upstream_gene_variant 0.84 rifampicin
rpoB 762510 p.Ala902Pro missense_variant 0.86 rifampicin Uncertain significance
rpoC 762521 c.-849C>G upstream_gene_variant 0.86 rifampicin
rpoC 762533 c.-837T>C upstream_gene_variant 0.84 rifampicin
rpoC 762536 c.-834T>C upstream_gene_variant 0.84 rifampicin
rpoC 762537 c.-833T>C upstream_gene_variant 0.84 rifampicin
rpoC 762551 c.-819C>T upstream_gene_variant 0.84 rifampicin
rpoC 762581 c.-789T>C upstream_gene_variant 0.81 rifampicin
rpoC 762582 c.-788T>C upstream_gene_variant 0.81 rifampicin
rpoB 762729 p.Gln975Lys missense_variant 0.73 rifampicin
rpoC 762734 c.-636G>A upstream_gene_variant 0.73 rifampicin
rpoB 762736 p.Ala977Glu missense_variant 0.73 rifampicin
rpoB 762744 p.Gln980Ala missense_variant 0.73 rifampicin
rpoB 762750 p.Leu982Met missense_variant 0.75 rifampicin
rpoC 762753 c.-617T>C upstream_gene_variant 0.76 rifampicin
rpoC 762782 c.-588T>C upstream_gene_variant 0.86 rifampicin
rpoB 762785 p.Asp993Glu missense_variant 0.86 rifampicin
rpoC 762788 c.-582G>C upstream_gene_variant 0.86 rifampicin
rpoB 762789 p.Leu995Met missense_variant 0.86 rifampicin
rpoC 762794 c.-576C>G upstream_gene_variant 0.86 rifampicin
rpoB 762799 p.Ala998Gly missense_variant 0.86 rifampicin
rpoC 762812 c.-558C>G upstream_gene_variant 0.86 rifampicin
rpoB 762813 p.Met1003Val missense_variant 0.86 rifampicin
rpoC 762818 c.-552C>G upstream_gene_variant 0.86 rifampicin
rpoC 762827 c.-543G>C upstream_gene_variant 0.86 rifampicin
rpoC 762830 c.-540C>G upstream_gene_variant 0.86 rifampicin
rpoC 762831 c.-539_-538delAGinsTC upstream_gene_variant 0.86 rifampicin
rpoC 762836 c.-534C>G upstream_gene_variant 0.87 rifampicin
rpoC 762857 c.-513C>G upstream_gene_variant 0.92 rifampicin
rpoC 762860 c.-510G>C upstream_gene_variant 0.92 rifampicin
rpoC 762863 c.-507T>C upstream_gene_variant 0.93 rifampicin
rpoC 762929 c.-441G>C upstream_gene_variant 0.96 rifampicin
rpoC 762989 c.-381G>C upstream_gene_variant 0.98 rifampicin
rpoC 762995 c.-375G>T upstream_gene_variant 0.98 rifampicin
rpoC 763028 c.-342T>C upstream_gene_variant 0.97 rifampicin
rpoC 763031 c.-339T>G upstream_gene_variant 1.0 rifampicin
rpoC 763034 c.-336C>G upstream_gene_variant 0.97 rifampicin
rpoC 763040 c.-330C>G upstream_gene_variant 0.97 rifampicin
rpoC 763070 c.-300T>C upstream_gene_variant 0.97 rifampicin
rpoC 763076 c.-294C>G upstream_gene_variant 0.97 rifampicin
rpoC 763085 c.-285C>G upstream_gene_variant 0.98 rifampicin
rpoC 763115 c.-255T>C upstream_gene_variant 0.98 rifampicin
rpoC 763136 c.-234C>T upstream_gene_variant 0.98 rifampicin
rpoC 763148 c.-222G>C upstream_gene_variant 0.98 rifampicin
rpoC 763158 c.-212C>T upstream_gene_variant 0.96 rifampicin
rpoC 763166 c.-204A>G upstream_gene_variant 0.96 rifampicin
rpoC 763169 c.-201A>G upstream_gene_variant 0.96 rifampicin
rpoC 763202 c.-168A>C upstream_gene_variant 0.95 rifampicin
rpoC 763205 c.-165G>C upstream_gene_variant 0.95 rifampicin
rpoC 763206 c.-164_-162delAGTinsTCC upstream_gene_variant 0.95 rifampicin
rpoC 763214 c.-156T>C upstream_gene_variant 0.97 rifampicin
rpoC 763226 c.-144A>G upstream_gene_variant 0.97 rifampicin
rpoC 763238 c.-132T>C upstream_gene_variant 0.95 rifampicin
rpoC 763268 c.-102C>G upstream_gene_variant 0.92 rifampicin
rpoC 763283 c.-87T>C upstream_gene_variant 0.92 rifampicin
rpoC 763284 c.-86C>T upstream_gene_variant 0.92 rifampicin
rpoC 763316 c.-54T>C upstream_gene_variant 0.89 rifampicin
rpoC 763319 c.-51T>G upstream_gene_variant 0.89 rifampicin
rpoC 763322 c.-48G>T upstream_gene_variant 0.89 rifampicin
rpoC 763325 c.-44_-37delAGCTGTCG upstream_gene_variant 0.92 rifampicin
rpoC 763335 c.-35A>C upstream_gene_variant 0.89 rifampicin
rpoC 763338 c.-32A>C upstream_gene_variant 0.89 rifampicin
rpoC 763340 c.-30_-29insTTTCACTA upstream_gene_variant 0.89 rifampicin
rpoC 763343 c.-27T>C upstream_gene_variant 0.9 rifampicin
rpoC 763351 c.-19T>C upstream_gene_variant 0.9 rifampicin
rpoC 763352 c.-18T>A upstream_gene_variant 0.9 rifampicin
rpoC 763402 c.33C>G synonymous_variant 0.95 rifampicin
rpoC 763411 c.42T>G synonymous_variant 0.95 rifampicin
rpoC 763414 c.45T>C synonymous_variant 0.95 rifampicin
rpoC 763441 c.72C>G synonymous_variant 0.94 rifampicin
rpoC 763444 c.75T>C synonymous_variant 0.94 rifampicin
rpoC 763456 c.87A>G synonymous_variant 0.94 rifampicin
rpoC 763468 c.99G>C synonymous_variant 0.94 rifampicin
rpoC 763486 c.117T>C synonymous_variant 0.94 rifampicin
rpoC 763528 c.159G>A synonymous_variant 0.95 rifampicin
rpoC 763546 c.177A>G synonymous_variant 0.96 rifampicin
rpoC 763570 c.201G>C synonymous_variant 0.96 rifampicin
rpoC 763594 c.225C>T synonymous_variant 0.99 rifampicin
rpoC 763633 c.264T>C synonymous_variant 0.99 rifampicin
rpoC 763636 c.267T>C synonymous_variant 0.99 rifampicin
rpoC 763642 c.273G>C synonymous_variant 0.99 rifampicin
rpoC 763658 c.289_291delCTTinsTTG synonymous_variant 0.99 rifampicin
rpoC 763675 c.306C>G synonymous_variant 0.98 rifampicin
rpoC 763696 c.327T>C synonymous_variant 0.96 rifampicin
rpoC 763702 c.333C>G synonymous_variant 0.94 rifampicin
rpoC 763708 c.339G>A synonymous_variant 0.94 rifampicin
rpoC 763709 c.340C>T synonymous_variant 0.94 rifampicin
rpoC 763714 c.345G>C synonymous_variant 0.94 rifampicin
rpoC 763717 c.348T>C synonymous_variant 0.94 rifampicin
rpoC 763723 c.354G>C synonymous_variant 0.94 rifampicin
rpoC 763732 c.363C>G synonymous_variant 0.93 rifampicin
rpoC 763735 c.366G>C synonymous_variant 0.93 rifampicin
rpoC 763744 c.375G>C synonymous_variant 0.93 rifampicin
rpoC 763765 c.396T>C synonymous_variant 0.94 rifampicin
rpoC 763768 c.399C>G synonymous_variant 0.94 rifampicin
rpoC 763780 c.411C>G synonymous_variant 0.94 rifampicin
rpoC 763783 c.414G>C synonymous_variant 0.93 rifampicin
rpoC 763801 c.432C>G synonymous_variant 0.92 rifampicin
rpoC 763807 c.438T>C synonymous_variant 0.92 rifampicin
rpoC 763819 c.450G>C synonymous_variant 0.92 rifampicin
rpoC 763831 c.462A>G synonymous_variant 0.9 rifampicin
rpoC 763835 p.Ala156Met missense_variant 0.9 rifampicin
rpoC 763858 c.489A>G synonymous_variant 0.88 rifampicin
rpoC 763872 p.Gly168Ala missense_variant 0.87 rifampicin
rpoC 763876 p.Glu169Asp missense_variant 0.83 rifampicin
rpoC 763879 c.510A>G synonymous_variant 0.84 rifampicin
rpoC 763885 c.516C>G synonymous_variant 0.84 rifampicin
rpoC 763888 c.519G>C synonymous_variant 0.86 rifampicin
rpoC 763891 c.522G>C synonymous_variant 0.85 rifampicin
rpoC 763894 c.525A>G synonymous_variant 0.85 rifampicin
rpoC 763945 c.576T>C synonymous_variant 0.85 rifampicin
rpoC 763960 c.591T>C synonymous_variant 0.87 rifampicin
rpoC 763967 p.Gly200Ser missense_variant 0.88 rifampicin
rpoC 763978 c.609C>G synonymous_variant 0.88 rifampicin
rpoC 763996 c.627T>C synonymous_variant 0.89 rifampicin
rpoC 764005 c.636G>C synonymous_variant 0.89 rifampicin
rpoC 764011 c.642T>C synonymous_variant 0.89 rifampicin
rpoC 764024 c.655T>C synonymous_variant 0.89 rifampicin
rpoC 764040 p.Ser224Asn missense_variant 0.9 rifampicin
rpoC 764044 c.675T>C synonymous_variant 0.93 rifampicin
rpoC 764059 c.690G>C synonymous_variant 0.93 rifampicin
rpoC 764083 c.714A>G synonymous_variant 0.91 rifampicin
rpoC 764098 c.729A>G synonymous_variant 0.9 rifampicin
rpoC 764101 c.732C>G synonymous_variant 0.91 rifampicin
rpoC 764110 c.741C>T synonymous_variant 0.91 rifampicin
rpoC 764131 c.762T>C synonymous_variant 0.93 rifampicin
rpoC 764161 c.792G>C synonymous_variant 0.91 rifampicin
rpoC 764188 c.819A>G synonymous_variant 0.93 rifampicin
rpoC 764195 p.Ser276Gln missense_variant 0.92 rifampicin
rpoC 764203 c.834G>T synonymous_variant 0.93 rifampicin
rpoC 764206 c.837T>C synonymous_variant 0.93 rifampicin
rpoC 764257 c.888G>C synonymous_variant 0.91 rifampicin
rpoC 764266 c.897T>C synonymous_variant 0.92 rifampicin
rpoC 764269 c.900G>C synonymous_variant 0.92 rifampicin
rpoC 764282 c.913_915delTCGinsAGC synonymous_variant 0.93 rifampicin
rpoC 764365 c.996C>T synonymous_variant 0.96 rifampicin
rpoC 764380 c.1011G>C synonymous_variant 0.96 rifampicin
rpoC 764381 c.1012_1013delTCinsAG synonymous_variant 0.96 rifampicin
rpoC 764387 c.1018_1020delTTGinsCTC synonymous_variant 0.96 rifampicin
rpoC 764405 c.1036A>C synonymous_variant 0.98 rifampicin
rpoC 764431 c.1062G>C synonymous_variant 0.97 rifampicin
rpoC 764434 c.1065A>G synonymous_variant 0.97 rifampicin
rpoC 764446 c.1077T>C synonymous_variant 0.97 rifampicin
rpoC 764449 c.1080G>C synonymous_variant 0.97 rifampicin
rpoC 764452 c.1083T>C synonymous_variant 0.97 rifampicin
rpoC 764458 c.1089G>C synonymous_variant 0.97 rifampicin
rpoC 764461 c.1092A>G synonymous_variant 0.97 rifampicin
rpoC 764497 c.1128A>G synonymous_variant 0.97 rifampicin
rpoC 764503 c.1134G>C synonymous_variant 0.97 rifampicin
rpoC 764521 c.1152T>C synonymous_variant 0.97 rifampicin
rpoC 764536 c.1167G>C synonymous_variant 0.97 rifampicin
rpoC 764539 c.1170C>G synonymous_variant 0.97 rifampicin
rpoC 764560 c.1191T>C synonymous_variant 0.97 rifampicin
rpoC 764566 c.1197C>G synonymous_variant 0.97 rifampicin
rpoC 764573 c.1204_1206delCTTinsTTG synonymous_variant 0.97 rifampicin
rpoC 764576 c.1207_1208delTCinsAG synonymous_variant 0.97 rifampicin
rpoC 764581 c.1212T>C synonymous_variant 0.97 rifampicin
rpoC 764626 c.1257C>T synonymous_variant 0.99 rifampicin
rpoC 764632 c.1263T>C synonymous_variant 0.99 rifampicin
rpoC 764650 c.1281G>T synonymous_variant 0.98 rifampicin
rpoC 764695 c.1326T>C synonymous_variant 0.97 rifampicin
rpoC 764716 c.1347G>C synonymous_variant 0.97 rifampicin
rpoC 764752 c.1383G>C synonymous_variant 0.96 rifampicin
rpoC 764764 c.1395T>C synonymous_variant 0.96 rifampicin
rpoC 764791 c.1422C>G synonymous_variant 0.95 rifampicin
rpoC 764809 c.1440C>T synonymous_variant 0.94 rifampicin
rpoC 764812 c.1443C>G synonymous_variant 0.93 rifampicin
rpoC 764815 c.1446A>G synonymous_variant 0.94 rifampicin
rpoC 764824 c.1455T>C synonymous_variant 0.93 rifampicin
rpoC 764830 c.1461C>G synonymous_variant 0.92 rifampicin
rpoC 764858 c.1489T>C synonymous_variant 0.9 rifampicin
rpoC 764872 c.1503A>G synonymous_variant 0.87 rifampicin
rpoC 764878 c.1509C>G synonymous_variant 0.87 rifampicin
rpoC 764893 c.1524T>C synonymous_variant 0.89 rifampicin
rpoC 764911 c.1542A>G synonymous_variant 0.88 rifampicin
rpoC 764923 c.1554A>G synonymous_variant 0.87 rifampicin
rpoC 764932 c.1563C>A synonymous_variant 0.89 rifampicin
rpoC 764968 c.1599T>C synonymous_variant 0.87 rifampicin
rpoC 764995 c.1626C>G synonymous_variant 0.9 rifampicin
rpoC 765007 c.1638T>G synonymous_variant 0.92 rifampicin
rpoC 765019 c.1650A>G synonymous_variant 0.91 rifampicin
rpoC 765034 c.1665T>C synonymous_variant 0.87 rifampicin
rpoC 765040 c.1671T>C synonymous_variant 0.85 rifampicin
rpoC 765041 c.1672T>C synonymous_variant 0.85 rifampicin
rpoC 765047 c.1678T>C synonymous_variant 0.86 rifampicin
rpoC 765052 c.1683C>G synonymous_variant 0.83 rifampicin
rpoC 765073 c.1704G>C synonymous_variant 0.8 rifampicin
rpoC 765076 c.1707A>G synonymous_variant 0.82 rifampicin
rpoC 765079 c.1710T>G synonymous_variant 0.81 rifampicin
rpoC 765082 c.1713G>C synonymous_variant 0.81 rifampicin
rpoC 765085 c.1716T>C synonymous_variant 0.81 rifampicin
rpoC 765089 c.1720T>C synonymous_variant 0.82 rifampicin
rpoC 765103 c.1734G>A synonymous_variant 0.81 rifampicin
rpoC 765220 c.1851A>G synonymous_variant 0.82 rifampicin
rpoC 765223 c.1854G>C synonymous_variant 0.82 rifampicin
rpoC 765232 c.1863G>C synonymous_variant 0.82 rifampicin
rpoC 765244 c.1875T>G synonymous_variant 0.82 rifampicin
rpoC 765245 c.1877_1878insGCT disruptive_inframe_insertion 0.82 rifampicin
rpoC 765249 p.Leu627Ser missense_variant 0.82 rifampicin
rpoC 765250 c.1882_1884delAGC conservative_inframe_deletion 0.82 rifampicin
rpoC 765287 c.1918C>T synonymous_variant 0.88 rifampicin
rpoC 765292 c.1923G>T synonymous_variant 0.88 rifampicin
rpoC 765298 c.1929G>T synonymous_variant 0.89 rifampicin
rpoC 765300 p.Val644Ala missense_variant 0.9 rifampicin
rpoC 765319 c.1950A>G synonymous_variant 0.91 rifampicin
rpoC 765325 c.1956C>T synonymous_variant 0.91 rifampicin
rpoC 765326 p.His653Ala missense_variant 0.91 rifampicin
rpoC 765330 p.Ser654Asn missense_variant 0.91 rifampicin
rpoC 765349 c.1980T>C synonymous_variant 0.95 rifampicin
rpoC 765352 c.1983G>C synonymous_variant 0.95 rifampicin
rpoC 765383 p.Met672Leu missense_variant 0.94 rifampicin
rpoC 765404 p.Leu679Val missense_variant 0.94 rifampicin
rpoC 765409 c.2040T>C synonymous_variant 0.94 rifampicin
rpoC 765412 c.2043T>C synonymous_variant 0.94 rifampicin
rpoC 765421 c.2052C>G synonymous_variant 0.95 rifampicin
rpoC 765451 c.2082C>G synonymous_variant 0.95 rifampicin
rpoC 765452 p.Ala695Ser missense_variant 0.95 rifampicin
rpoC 765478 c.2109T>C synonymous_variant 0.97 rifampicin
rpoC 765493 c.2124G>C synonymous_variant 0.95 rifampicin
rpoC 765499 c.2130C>G synonymous_variant 0.94 rifampicin
rpoC 765508 c.2139C>G synonymous_variant 0.94 rifampicin
rpoC 765541 c.2172C>G synonymous_variant 0.94 rifampicin
rpoC 765553 c.2184C>T synonymous_variant 0.93 rifampicin
rpoC 765556 c.2187G>C synonymous_variant 0.94 rifampicin
rpoC 765559 c.2190G>C synonymous_variant 0.93 rifampicin
rpoC 765573 p.Asp735Gly missense_variant 0.93 rifampicin
rpoC 765577 c.2208G>C synonymous_variant 0.93 rifampicin
rpoC 765578 c.2209C>T synonymous_variant 0.93 rifampicin
rpoC 765583 c.2214G>T synonymous_variant 0.93 rifampicin
rpoC 765613 p.His748Gln missense_variant 0.93 rifampicin
rpoC 765625 c.2256C>G synonymous_variant 0.92 rifampicin
rpoC 765628 c.2259G>C synonymous_variant 0.92 rifampicin
rpoC 765631 p.Asp754Glu missense_variant 0.92 rifampicin
rpoC 765658 c.2289C>T synonymous_variant 0.92 rifampicin
rpoC 765700 c.2331T>C synonymous_variant 0.91 rifampicin
rpoC 765734 c.2365T>C synonymous_variant 0.92 rifampicin
rpoC 765739 c.2370G>C synonymous_variant 0.93 rifampicin
rpoC 765751 c.2382C>G synonymous_variant 0.93 rifampicin
rpoC 765753 p.Asp795Ala missense_variant 0.93 rifampicin
rpoC 765772 c.2403C>G synonymous_variant 0.92 rifampicin
rpoC 765784 c.2415C>G synonymous_variant 0.92 rifampicin
rpoC 765796 c.2427C>T synonymous_variant 0.94 rifampicin
rpoC 765811 c.2442T>C synonymous_variant 0.95 rifampicin
rpoC 765814 c.2445A>G synonymous_variant 0.95 rifampicin
rpoC 765826 c.2457T>C synonymous_variant 0.96 rifampicin
rpoC 765835 c.2466C>T synonymous_variant 0.96 rifampicin
rpoC 765883 c.2514C>G synonymous_variant 0.94 rifampicin
rpoC 765886 c.2517C>G synonymous_variant 0.94 rifampicin
rpoC 765892 c.2523T>C synonymous_variant 0.94 rifampicin
rpoC 765928 c.2559C>G synonymous_variant 0.93 rifampicin
rpoC 765967 c.2598C>T synonymous_variant 0.91 rifampicin
rpoC 765979 c.2610C>G synonymous_variant 0.89 rifampicin
rpoC 765982 c.2613C>T synonymous_variant 0.88 rifampicin
rpoC 765985 c.2616C>T synonymous_variant 0.91 rifampicin
rpoC 765994 c.2625A>T synonymous_variant 0.91 rifampicin
rpoC 766009 c.2640G>C synonymous_variant 0.89 rifampicin
rpoC 766010 c.2641_2642delTCinsAG synonymous_variant 0.89 rifampicin
rpoC 766015 c.2646G>A synonymous_variant 0.89 rifampicin
rpoC 766021 c.2652G>C synonymous_variant 0.91 rifampicin
rpoC 766043 p.Gln892Glu missense_variant 0.9 rifampicin
rpoC 766054 c.2685C>G synonymous_variant 0.9 rifampicin
rpoC 766069 c.2700G>A synonymous_variant 0.88 rifampicin
rpoC 766082 p.Ala905Gln missense_variant 0.88 rifampicin
rpoC 766096 c.2727G>C synonymous_variant 0.91 rifampicin
rpoC 766105 c.2736C>T synonymous_variant 0.9 rifampicin
rpoC 766129 c.2760C>G synonymous_variant 0.88 rifampicin
rpoC 766135 c.2766G>A synonymous_variant 0.84 rifampicin
rpoC 766141 c.2772C>T synonymous_variant 0.85 rifampicin
rpoC 766142 c.2773C>T synonymous_variant 0.85 rifampicin
rpoC 766185 p.Glu939Ala missense_variant 0.79 rifampicin
rpoC 766189 c.2820T>C synonymous_variant 0.79 rifampicin
rpoC 766192 c.2823T>C synonymous_variant 0.79 rifampicin
rpoC 766193 p.Gln942Glu missense_variant 0.79 rifampicin
rpoC 766201 c.2832G>C synonymous_variant 0.79 rifampicin
rpoC 766204 c.2835C>T synonymous_variant 0.82 rifampicin
rpoC 766207 c.2838T>C synonymous_variant 0.85 rifampicin
rpoC 766216 c.2847T>C synonymous_variant 0.88 rifampicin
rpoC 766222 c.2853T>C synonymous_variant 0.92 rifampicin
rpoC 766226 c.2857T>C synonymous_variant 0.92 rifampicin
rpoC 766231 c.2862T>G synonymous_variant 0.92 rifampicin
rpoC 766234 c.2865T>C synonymous_variant 0.92 rifampicin
rpoC 766237 c.2868T>C synonymous_variant 0.92 rifampicin
rpoC 766240 c.2871T>C synonymous_variant 0.92 rifampicin
rpoC 766243 c.2874C>G synonymous_variant 0.88 rifampicin
rpoC 766244 p.Gln959Ser missense_variant 0.88 rifampicin
rpoC 766258 c.2889T>C synonymous_variant 0.89 rifampicin
rpoC 766270 c.2901G>C synonymous_variant 0.89 rifampicin
rpoC 766273 c.2904T>C synonymous_variant 0.89 rifampicin
rpoC 766274 p.Ala969Thr missense_variant 0.88 rifampicin
rpoC 766279 c.2910C>G synonymous_variant 0.89 rifampicin
rpoC 766280 p.Ser971Gly missense_variant 0.9 rifampicin
rpoC 766299 p.Thr977Ile missense_variant 0.88 rifampicin
rpoC 766309 c.2940G>C synonymous_variant 0.88 rifampicin
rpoC 766312 c.2943T>G synonymous_variant 0.88 rifampicin
rpoC 766315 c.2946C>G synonymous_variant 0.89 rifampicin
rpoC 766327 c.2958C>G synonymous_variant 0.9 rifampicin
rpoC 766345 c.2976T>C synonymous_variant 0.91 rifampicin
rpoC 766348 c.2979A>G synonymous_variant 0.91 rifampicin
rpoC 766363 c.2994G>C synonymous_variant 0.92 rifampicin
rpoC 766381 c.3012C>T synonymous_variant 0.94 rifampicin
rpoC 766384 c.3015A>G synonymous_variant 0.95 rifampicin
rpoC 766390 c.3021C>T synonymous_variant 0.95 rifampicin
rpoC 766408 c.3039C>T synonymous_variant 0.94 rifampicin
rpoC 766426 c.3057C>T synonymous_variant 0.94 rifampicin
rpoC 766444 c.3075C>G synonymous_variant 0.95 rifampicin
rpoC 766447 c.3078T>C synonymous_variant 0.95 rifampicin
rpoC 766483 c.3114G>C synonymous_variant 0.96 rifampicin
rpoC 766484 p.Val1039Ile missense_variant 0.96 rifampicin
rpoC 766492 c.3123T>C synonymous_variant 0.96 rifampicin
rpoC 766495 c.3126C>T synonymous_variant 0.96 rifampicin
rpoC 766528 c.3159T>G synonymous_variant 0.96 rifampicin
rpoC 766543 c.3174C>T synonymous_variant 0.96 rifampicin
rpoC 766573 c.3204T>C synonymous_variant 0.94 rifampicin
rpoC 766583 p.Gly1072Ser missense_variant 0.95 rifampicin
rpoC 766591 c.3222A>G synonymous_variant 0.95 rifampicin
rpoC 766594 c.3225G>C synonymous_variant 0.95 rifampicin
rpoC 766597 c.3228C>G synonymous_variant 0.95 rifampicin
rpoC 766607 p.Ile1080Leu missense_variant 0.98 rifampicin
rpoC 766630 c.3261G>C synonymous_variant 0.98 rifampicin
rpoC 766645 c.3276A>G synonymous_variant 0.98 rifampicin
rpoC 766651 c.3282T>C synonymous_variant 0.98 rifampicin
rpoC 766657 c.3288A>G synonymous_variant 0.98 rifampicin
rpoC 766672 c.3303T>C synonymous_variant 0.98 rifampicin
rpoC 766738 c.3369G>T synonymous_variant 0.97 rifampicin
rpoC 766750 c.3381C>G synonymous_variant 0.97 rifampicin
rpoC 766765 c.3396A>C synonymous_variant 0.96 rifampicin
rpoC 766769 c.3400C>T synonymous_variant 0.96 rifampicin
rpoC 766774 c.3405T>C synonymous_variant 0.96 rifampicin
rpoC 766801 c.3432C>G synonymous_variant 0.95 rifampicin
rpoC 766804 c.3435A>G synonymous_variant 0.96 rifampicin
rpoC 766861 c.3492G>C synonymous_variant 0.96 rifampicin
rpoC 766864 c.3495G>C synonymous_variant 0.96 rifampicin
rpoC 766894 c.3525T>C synonymous_variant 0.95 rifampicin
rpoC 766895 c.3526T>C synonymous_variant 0.95 rifampicin
rpoC 766900 c.3531T>C synonymous_variant 0.97 rifampicin
rpoC 766933 c.3564A>G synonymous_variant 0.97 rifampicin
rpoC 766945 c.3576A>G synonymous_variant 0.96 rifampicin
rpoC 766963 c.3594T>C synonymous_variant 0.96 rifampicin
rpoC 766972 c.3603G>C synonymous_variant 0.96 rifampicin
rpoC 766978 c.3609C>G synonymous_variant 0.98 rifampicin
rpoC 766996 c.3627C>T synonymous_variant 0.98 rifampicin
rpoC 767009 c.3640_3642delTCGinsAGC synonymous_variant 0.96 rifampicin
rpoC 767014 c.3645G>C synonymous_variant 0.98 rifampicin
rpoC 767033 c.3664_3666delTCGinsAGC synonymous_variant 0.98 rifampicin
rpoC 767059 c.3690T>G synonymous_variant 0.97 rifampicin
rpoC 767062 c.3693C>A synonymous_variant 0.97 rifampicin
rpoC 767074 c.3705T>C synonymous_variant 0.97 rifampicin
rpoC 767098 c.3729T>C synonymous_variant 0.97 rifampicin
rpoC 767119 c.3750A>G synonymous_variant 0.97 rifampicin
rpoC 767134 c.3765C>G synonymous_variant 0.96 rifampicin
rpoC 767158 c.3789T>G synonymous_variant 0.98 rifampicin
rpoC 767167 c.3798C>G synonymous_variant 0.96 rifampicin
rpoC 767180 p.Ala1271Gln missense_variant 0.94 rifampicin
rpoC 767191 c.3822C>G synonymous_variant 0.94 rifampicin
rpoC 767206 c.3837C>G synonymous_variant 0.92 rifampicin
rpoC 767209 c.3840T>C synonymous_variant 0.92 rifampicin
rpoC 767212 c.3843G>C synonymous_variant 0.92 rifampicin
rpoC 767221 c.3852C>G synonymous_variant 0.88 rifampicin
rpoC 767230 c.3861G>C synonymous_variant 0.85 rifampicin
rpoC 767233 c.3864T>C synonymous_variant 0.85 rifampicin
rpoC 767263 c.3894T>C synonymous_variant 0.73 rifampicin
mmpL5 775736 c.2745C>G synonymous_variant 0.73 clofazimine
mmpL5 775742 c.2739C>T synonymous_variant 0.73 clofazimine
mmpL5 775747 p.Met912Leu missense_variant 0.73 clofazimine
mmpL5 775748 c.2733T>C synonymous_variant 0.73 clofazimine
mmpL5 775760 c.2721C>T synonymous_variant 0.73 clofazimine
mmpL5 775763 c.2718T>C synonymous_variant 0.73 clofazimine
mmpL5 775769 p.Ala904Gly missense_variant 0.73 clofazimine
mmpL5 775772 p.Met903Ile missense_variant 0.67 clofazimine Uncertain significance
bedaquiline Uncertain significance
mmpL5 775778 c.2703C>G synonymous_variant 0.67 clofazimine
mmpL5 775781 c.2700G>C synonymous_variant 0.67 clofazimine
mmpL5 775784 c.2697G>A synonymous_variant 0.67 clofazimine
mmpL5 775793 c.2688C>G synonymous_variant 0.67 clofazimine
mmpL5 775796 p.Phe895Met missense_variant 0.67 clofazimine
mmpL5 775799 p.Ser894Thr missense_variant 0.67 clofazimine
mmpL5 775817 c.2664T>C synonymous_variant 0.79 clofazimine
mmpL5 775829 c.2652C>G synonymous_variant 0.79 clofazimine
mmpL5 775832 p.Ala883Ser missense_variant 0.79 clofazimine
mmpL5 775847 c.2634G>C synonymous_variant 0.85 clofazimine
mmpL5 775851 p.Ser877Thr missense_variant 0.85 clofazimine
mmpL5 775856 c.2625T>C synonymous_variant 0.85 clofazimine
mmpL5 775864 p.Ala873Ser missense_variant 0.86 clofazimine
mmpL5 775865 c.2616T>G synonymous_variant 0.86 clofazimine
mmpL5 775883 p.Ile866Leu missense_variant 0.76 clofazimine
mmpL5 775886 c.2595A>C synonymous_variant 0.87 clofazimine
mmpL5 775898 c.2583G>A synonymous_variant 0.72 clofazimine
mmpL5 775901 c.2580G>A synonymous_variant 0.68 clofazimine
mmpL5 775904 c.2577G>A synonymous_variant 0.68 clofazimine
mmpL5 775909 p.Leu858Phe missense_variant 0.89 clofazimine
mmpL5 775912 c.2569C>A synonymous_variant 0.67 clofazimine
mmpL5 775913 p.Ala856Ser missense_variant 0.14 clofazimine
mmpL5 775916 p.Val855Met missense_variant 0.85 clofazimine
mmpL5 775921 c.2560C>T synonymous_variant 0.12 clofazimine
mmpL5 775937 p.Ala848Ser missense_variant 0.74 clofazimine
mmpL5 775946 c.2535C>G synonymous_variant 0.17 clofazimine
mmpL5 775955 p.Ile842Leu missense_variant 0.13 clofazimine
mmpL5 775966 p.Ala839Ser missense_variant 0.68 clofazimine
mmpL5 775970 c.2511G>C synonymous_variant 0.64 clofazimine
mmpL5 775975 c.2506T>C synonymous_variant 0.82 clofazimine
mmpL5 775981 p.Leu834Met missense_variant 0.81 clofazimine
mmpL5 775990 c.2491C>T synonymous_variant 0.15 clofazimine
mmpL5 775991 p.Glu830Lys missense_variant 0.63 clofazimine
mmpL5 775994 p.Ile829Leu missense_variant 0.15 clofazimine
mmpL5 775997 c.2484T>C synonymous_variant 0.81 clofazimine
mmpL5 776003 p.Ile826Leu missense_variant 0.54 clofazimine
mmpL5 776008 p.His825Tyr missense_variant 0.19 clofazimine
mmpL5 776009 c.2472A>G synonymous_variant 0.81 clofazimine
mmpL5 776015 p.Ile822Leu missense_variant 0.13 clofazimine
mmpL5 776027 c.2454G>C synonymous_variant 0.13 clofazimine
mmpL5 776030 c.2451G>C synonymous_variant 0.13 clofazimine
mmpL5 776036 c.2445G>A synonymous_variant 0.57 clofazimine
mmpL5 776039 c.2442C>A synonymous_variant 0.54 clofazimine
mmpL5 776048 c.2433G>A synonymous_variant 0.54 clofazimine
mmpL5 776051 c.2428_2430delTTGinsCTC synonymous_variant 0.52 clofazimine
mmpL5 776056 p.Val809Leu missense_variant 0.67 clofazimine
mmpL5 776057 c.2424G>A synonymous_variant 0.55 clofazimine
mmpL5 776060 c.2421C>G synonymous_variant 0.14 clofazimine
mmpL5 776063 c.2418C>G synonymous_variant 0.1 clofazimine
mmpL5 776066 c.2415C>G synonymous_variant 0.55 clofazimine
mmpL5 776075 p.Ala802Leu missense_variant 0.57 clofazimine
mmpL5 776078 p.Ala801Ser missense_variant 0.63 clofazimine
mmpL5 776081 c.2400G>T synonymous_variant 0.57 clofazimine
mmpL5 776084 c.2397C>G synonymous_variant 0.67 clofazimine
mmpL5 776087 c.2394C>G synonymous_variant 0.57 clofazimine
mmpL5 776092 p.Ser797Gly missense_variant 0.57 clofazimine
mmpL5 776100 p.Thr794Ile missense_variant 1.0 clofazimine Uncertain significance
bedaquiline Uncertain significance
mmpL5 776120 c.2361C>T synonymous_variant 0.65 clofazimine
mmpL5 776129 c.2352C>G synonymous_variant 0.62 clofazimine
mmpL5 776132 p.Ala783Ser missense_variant 0.57 clofazimine
mmpL5 776135 c.2346C>T synonymous_variant 0.57 clofazimine
mmpL5 776152 p.Met777Leu missense_variant 0.5 clofazimine
mmpL5 776155 c.2326T>C synonymous_variant 0.5 clofazimine
mmpL5 776159 c.2322T>C synonymous_variant 0.45 clofazimine
mmpL5 776163 p.Thr773Asn missense_variant 0.5 clofazimine
mmpL5 776982 p.Leu500Gln missense_variant 0.3 clofazimine
mmpL5 776987 c.1494G>C synonymous_variant 0.3 clofazimine
mmpL5 776993 c.1488A>G synonymous_variant 0.3 clofazimine
mmpS5 778547 p.Gly120Asp missense_variant 0.15 clofazimine
rpsL 781608 p.Ser17Gly missense_variant 0.71 streptomycin
rpsL 781631 c.72G>C synonymous_variant 0.82 streptomycin
rpsL 781649 c.90T>C synonymous_variant 0.93 streptomycin
rpsL 781655 c.96T>C synonymous_variant 0.94 streptomycin
rpsL 781682 c.123T>C synonymous_variant 0.96 streptomycin
rpsL 781715 c.156T>C synonymous_variant 0.98 streptomycin
rpsL 781728 c.169T>C synonymous_variant 0.98 streptomycin
rpsL 781736 c.177T>C synonymous_variant 0.98 streptomycin
rpsL 781751 c.192G>C synonymous_variant 0.97 streptomycin
rpsL 781754 c.195G>C synonymous_variant 0.97 streptomycin
rpsL 781760 c.201T>C synonymous_variant 0.98 streptomycin
rpsL 781793 c.234G>C synonymous_variant 0.98 streptomycin
rpsL 781832 c.273T>C synonymous_variant 0.99 streptomycin
rpsL 781841 c.282C>G synonymous_variant 0.99 streptomycin
rpsL 781859 c.300T>C synonymous_variant 0.99 streptomycin
rpsL 781868 c.309T>C synonymous_variant 0.99 streptomycin
rpsL 781871 c.312G>C synonymous_variant 0.98 streptomycin
rpsL 781892 c.333A>G synonymous_variant 0.97 streptomycin
rpsL 781898 c.339A>T synonymous_variant 0.98 streptomycin
rpsL 781916 c.357T>C synonymous_variant 0.98 streptomycin
rpsL 781929 p.Gly124Ser missense_variant 0.97 streptomycin Uncertain significance
rplC 800612 c.-197A>G upstream_gene_variant 0.79 linezolid
rplC 800618 c.-191T>C upstream_gene_variant 0.81 linezolid Uncertain significance
rplC 800648 c.-161A>C upstream_gene_variant 0.8 linezolid
rplC 800654 c.-155T>C upstream_gene_variant 0.8 linezolid
rplC 800690 c.-119C>T upstream_gene_variant 0.87 linezolid Uncertain significance
rplC 800693 c.-116A>G upstream_gene_variant 0.89 linezolid
rplC 800703 c.-106T>C upstream_gene_variant 0.89 linezolid
rplC 800715 c.-94A>C upstream_gene_variant 0.89 linezolid
rplC 800720 c.-89T>C upstream_gene_variant 0.9 linezolid
rplC 800723 c.-86C>G upstream_gene_variant 0.92 linezolid
rplC 800738 c.-71T>C upstream_gene_variant 0.9 linezolid
rplC 800747 c.-62C>G upstream_gene_variant 0.89 linezolid
rplC 800771 c.-38C>T upstream_gene_variant 0.91 linezolid
rplC 800814 c.6A>G synonymous_variant 0.89 linezolid
rplC 800817 c.9A>T synonymous_variant 0.89 linezolid
rplC 800844 c.36T>C synonymous_variant 0.92 linezolid
rplC 800865 c.57A>G synonymous_variant 0.92 linezolid
rplC 800867 p.Ser20Asn missense_variant 0.92 linezolid
rplC 800874 c.66A>G synonymous_variant 0.94 linezolid
rplC 800877 c.69A>C synonymous_variant 0.94 linezolid
rplC 800880 c.72A>G synonymous_variant 0.94 linezolid
rplC 800889 c.81C>G synonymous_variant 0.94 linezolid
rplC 800907 c.99C>G synonymous_variant 0.92 linezolid
rplC 800916 c.108A>G synonymous_variant 0.92 linezolid
rplC 800937 c.129A>G synonymous_variant 0.91 linezolid
rplC 800939 p.Arg44Gln missense_variant 0.91 linezolid
rplC 800946 c.138T>C synonymous_variant 0.91 linezolid
rplC 800949 c.141T>C synonymous_variant 0.91 linezolid
rplC 800955 c.147C>G synonymous_variant 0.91 linezolid
rplC 800967 c.159C>G synonymous_variant 0.89 linezolid
rplC 800970 c.162T>C synonymous_variant 0.91 linezolid
rplC 800982 c.174C>T synonymous_variant 0.89 linezolid
rplC 800985 c.177A>G synonymous_variant 0.89 linezolid
rplC 800994 c.186C>G synonymous_variant 0.9 linezolid
rplC 801004 p.Leu66Val missense_variant 0.9 linezolid
rplC 801009 c.201A>C synonymous_variant 0.9 linezolid
rplC 801012 c.204T>C synonymous_variant 0.89 linezolid
rplC 801019 p.Thr71Ala missense_variant 0.89 linezolid
rplC 801024 c.216C>G synonymous_variant 0.89 linezolid
rplC 801027 c.219C>G synonymous_variant 0.89 linezolid
rplC 801031 p.Val75Ile missense_variant 0.89 linezolid
rplC 801039 c.231A>G synonymous_variant 0.86 linezolid
rplC 801045 c.237A>G synonymous_variant 0.85 linezolid
rplC 801047 p.Tyr80Phe missense_variant 0.86 linezolid
rplC 801054 c.246G>C synonymous_variant 0.86 linezolid
rplC 801070 p.Asp88Asn missense_variant 0.86 linezolid
rplC 801073 p.Ser89Pro missense_variant 0.86 linezolid
rplC 801078 c.270T>C synonymous_variant 0.86 linezolid
rplC 801081 c.273C>G synonymous_variant 0.9 linezolid
rplC 801085 p.Thr93Ala missense_variant 0.92 linezolid Uncertain significance
rplC 801090 c.282G>A synonymous_variant 0.92 linezolid
rplC 801099 c.291T>C synonymous_variant 0.92 linezolid
rplC 801102 c.294G>C synonymous_variant 0.91 linezolid
rplC 801105 c.297A>G synonymous_variant 0.92 linezolid
rplC 801109 c.301T>C synonymous_variant 0.92 linezolid
rplC 801114 c.306C>G synonymous_variant 0.93 linezolid
rplC 801127 p.Ala107Thr missense_variant 0.93 linezolid
rplC 801132 c.324T>C synonymous_variant 0.93 linezolid
rplC 801147 c.339T>C synonymous_variant 0.92 linezolid
rplC 801150 c.342G>C synonymous_variant 0.92 linezolid
rplC 801153 c.345G>C synonymous_variant 0.92 linezolid
rplC 801156 c.348T>A synonymous_variant 0.89 linezolid
rplC 801171 c.363A>G synonymous_variant 0.87 linezolid
rplC 801174 c.366T>C synonymous_variant 0.9 linezolid
rplC 801183 c.375C>A synonymous_variant 0.89 linezolid
rplC 801222 c.414T>C synonymous_variant 0.9 linezolid
rplC 801228 c.420T>C synonymous_variant 0.89 linezolid
rplC 801246 c.438C>G synonymous_variant 0.89 linezolid
rplC 801249 c.441T>G synonymous_variant 0.89 linezolid
rplC 801255 c.447C>T synonymous_variant 0.9 linezolid
rplC 801267 c.459A>C synonymous_variant 0.9 linezolid
rplC 801270 c.462T>C synonymous_variant 0.9 linezolid
rplC 801276 c.468G>C synonymous_variant 0.91 linezolid
rplC 801279 c.471G>C synonymous_variant 0.9 linezolid
rplC 801282 c.474G>C synonymous_variant 0.88 linezolid
rplC 801301 c.493C>A synonymous_variant 0.9 linezolid
rplC 801312 c.504G>C synonymous_variant 0.88 linezolid
rplC 801324 c.516T>C synonymous_variant 0.89 linezolid
rplC 801336 c.528C>G synonymous_variant 0.88 linezolid
rplC 801339 c.531T>C synonymous_variant 0.88 linezolid
rplC 801341 p.Leu178Gln missense_variant 0.88 linezolid
rplC 801348 c.540T>G synonymous_variant 0.88 linezolid
rplC 801357 c.549T>C synonymous_variant 0.87 linezolid
rplC 801367 p.Ala187Thr missense_variant 0.88 linezolid
rplC 801396 c.588T>C synonymous_variant 0.87 linezolid
rplC 801402 c.594T>C synonymous_variant 0.88 linezolid
rplC 801405 c.597T>C synonymous_variant 0.88 linezolid
rplC 801417 c.609T>C synonymous_variant 0.86 linezolid
rplC 801423 c.615G>C synonymous_variant 0.85 linezolid
rplC 801438 c.630T>C synonymous_variant 0.84 linezolid
rplC 801442 p.Ile212Val missense_variant 0.84 linezolid
rplC 801461 c.653G>A splice_region_variant&stop_retained_variant 0.84 linezolid
fbiC 1303480 p.Gln184Glu missense_variant 0.7 delamanid
fbiC 1303509 c.579G>C synonymous_variant 0.64 delamanid
fbiC 1303512 c.582T>C synonymous_variant 0.64 delamanid
fbiC 1303534 p.Ser202Ala missense_variant 0.81 delamanid
fbiC 1303545 c.615A>G synonymous_variant 0.83 delamanid
fbiC 1303560 c.630G>C synonymous_variant 0.86 delamanid
fbiC 1303575 c.645G>C synonymous_variant 0.88 delamanid
fbiC 1303584 c.654C>G synonymous_variant 0.89 delamanid
fbiC 1303590 c.660A>G synonymous_variant 0.9 delamanid
fbiC 1303602 c.672A>G synonymous_variant 0.9 delamanid
fbiC 1303605 c.675C>G synonymous_variant 0.9 delamanid
fbiC 1303608 c.678G>A synonymous_variant 0.9 delamanid
fbiC 1303611 c.681G>C synonymous_variant 0.9 delamanid
fbiC 1303614 c.684C>T synonymous_variant 0.93 delamanid
fbiC 1303617 c.687C>G synonymous_variant 0.93 delamanid
fbiC 1303632 c.702T>G synonymous_variant 0.94 delamanid
fbiC 1303638 c.708A>G synonymous_variant 0.94 delamanid
fbiC 1303659 c.729T>C synonymous_variant 0.95 delamanid
fbiC 1303660 p.Val244Thr missense_variant 0.95 delamanid
fbiC 1303674 c.744C>G synonymous_variant 0.96 delamanid
fbiC 1303686 c.756C>G synonymous_variant 0.96 delamanid
fbiC 1303695 c.765T>C synonymous_variant 0.96 delamanid
fbiC 1303701 c.771C>G synonymous_variant 0.98 delamanid
fbiC 1303708 c.778T>C synonymous_variant 0.98 delamanid
fbiC 1303716 c.786C>T synonymous_variant 1.0 delamanid
fbiC 1303728 c.798G>A synonymous_variant 1.0 delamanid
fbiC 1303731 c.801A>C synonymous_variant 1.0 delamanid
fbiC 1303732 p.Ser268Ala missense_variant 1.0 delamanid
fbiC 1303737 c.807G>A synonymous_variant 1.0 delamanid
fbiC 1303746 c.816T>C synonymous_variant 1.0 delamanid
fbiC 1303749 c.819G>C synonymous_variant 1.0 delamanid
fbiC 1303752 c.822A>G synonymous_variant 1.0 delamanid
fbiC 1303755 c.825T>C synonymous_variant 1.0 delamanid
fbiC 1303785 c.855G>C synonymous_variant 1.0 delamanid
fbiC 1303789 p.Ile287Val missense_variant 1.0 delamanid
fbiC 1303818 c.888C>G synonymous_variant 1.0 delamanid
fbiC 1303836 c.906G>C synonymous_variant 1.0 delamanid
fbiC 1303845 c.915C>G synonymous_variant 1.0 delamanid
fbiC 1303846 p.Phe306Val missense_variant 1.0 delamanid
fbiC 1303854 c.924T>C synonymous_variant 1.0 delamanid
fbiC 1303860 c.930A>C synonymous_variant 1.0 delamanid
fbiC 1303881 c.951G>C synonymous_variant 1.0 delamanid
fbiC 1303884 c.954T>G synonymous_variant 1.0 delamanid
fbiC 1303900 p.Val324Met missense_variant 1.0 delamanid
fbiC 1303911 c.981G>C synonymous_variant 0.95 delamanid
fbiC 1303914 c.984C>G synonymous_variant 1.0 delamanid
fbiC 1303920 c.990C>G synonymous_variant 1.0 delamanid
fbiC 1303923 c.993C>T synonymous_variant 1.0 delamanid
fbiC 1303929 c.999G>C synonymous_variant 1.0 delamanid
fbiC 1303947 c.1017T>C synonymous_variant 1.0 delamanid
fbiC 1303948 p.Gly340Arg missense_variant 1.0 delamanid
fbiC 1303969 p.Val347Ile missense_variant 1.0 delamanid
fbiC 1303973 p.Gly348Ala missense_variant 1.0 delamanid
fbiC 1303981 p.Val351Ile missense_variant 1.0 delamanid
fbiC 1303995 c.1065C>T synonymous_variant 1.0 delamanid
fbiC 1304001 c.1071C>G synonymous_variant 1.0 delamanid
fbiC 1304008 c.1078T>C synonymous_variant 1.0 delamanid
fbiC 1304034 c.1104A>G synonymous_variant 0.98 delamanid
fbiC 1304040 c.1110C>G synonymous_variant 0.98 delamanid
fbiC 1304046 c.1116C>G synonymous_variant 0.98 delamanid
fbiC 1304049 c.1119T>G synonymous_variant 0.98 delamanid
fbiC 1304058 c.1128G>A synonymous_variant 0.98 delamanid
fbiC 1304059 c.1129C>T synonymous_variant 0.98 delamanid
fbiC 1304064 c.1134G>C synonymous_variant 0.95 delamanid
fbiC 1304067 c.1137G>C synonymous_variant 0.95 delamanid
fbiC 1304080 p.Ala384Ser missense_variant 0.95 delamanid
fbiC 1304091 p.Asp387Glu missense_variant 0.95 delamanid
fbiC 1304092 p.Met388Leu missense_variant 0.95 delamanid
fbiC 1304097 c.1167G>C synonymous_variant 0.95 delamanid
fbiC 1304115 c.1185A>G synonymous_variant 0.94 delamanid
fbiC 1304127 c.1197A>G synonymous_variant 0.94 delamanid
fbiC 1304136 c.1206C>T synonymous_variant 0.92 delamanid
fbiC 1304142 c.1212G>C synonymous_variant 0.91 delamanid
fbiC 1304161 c.1230_1231insTC frameshift_variant 0.8 delamanid
fbiC 1304163 c.1233G>C synonymous_variant 0.29 delamanid
fbiC 1304164 c.1235_1236delGA frameshift_variant 0.8 delamanid
fbiC 1304164 c.1236A>G synonymous_variant 0.67 delamanid
fbiC 1304172 c.1242G>C synonymous_variant 0.86 delamanid
fbiC 1304173 p.Val415Arg missense_variant 0.86 delamanid
fbiC 1304184 c.1254G>C synonymous_variant 0.87 delamanid
fbiC 1304192 p.Ala421Val missense_variant 0.93 delamanid
fbiC 1304199 c.1269C>T synonymous_variant 0.93 delamanid
fbiC 1304499 c.1569T>G synonymous_variant 0.94 delamanid
fbiC 1304520 c.1590A>C synonymous_variant 0.86 delamanid
fbiC 1304523 c.1593G>T synonymous_variant 0.86 delamanid
fbiC 1304526 c.1596T>A synonymous_variant 0.86 delamanid
fbiC 1304544 c.1614T>C synonymous_variant 0.89 delamanid
fbiC 1304545 p.Val539Thr missense_variant 0.89 delamanid
fbiC 1304559 p.Glu543Asp missense_variant 0.9 delamanid
fbiC 1304565 c.1635C>G synonymous_variant 0.86 delamanid
fbiC 1304568 c.1638T>C synonymous_variant 0.87 delamanid
fbiC 1304574 c.1644C>G synonymous_variant 0.87 delamanid
fbiC 1304580 c.1650T>C synonymous_variant 0.89 delamanid
fbiC 1304613 c.1683T>C synonymous_variant 0.89 delamanid
fbiC 1304628 c.1698G>C synonymous_variant 0.9 delamanid
fbiC 1304634 c.1704C>G synonymous_variant 0.89 delamanid
fbiC 1304640 c.1710A>C synonymous_variant 0.89 delamanid
fbiC 1304646 c.1716T>C synonymous_variant 0.89 delamanid
fbiC 1304658 c.1728C>G synonymous_variant 0.9 delamanid
fbiC 1304670 c.1740G>T synonymous_variant 0.87 delamanid
fbiC 1304671 p.Val581Thr missense_variant 0.87 delamanid
fbiC 1304675 p.Gly582Glu missense_variant 0.87 delamanid
fbiC 1304691 c.1761G>C synonymous_variant 0.87 delamanid
fbiC 1304694 c.1764A>C synonymous_variant 0.87 delamanid
fbiC 1304703 c.1773C>G synonymous_variant 0.87 delamanid
fbiC 1304715 c.1785G>C synonymous_variant 0.88 delamanid
fbiC 1304724 c.1794A>G synonymous_variant 0.89 delamanid
fbiC 1304727 c.1797A>G synonymous_variant 0.89 delamanid
fbiC 1304742 c.1812T>C synonymous_variant 0.91 delamanid
fbiC 1304748 c.1818T>C synonymous_variant 0.91 delamanid
fbiC 1304754 c.1824G>A synonymous_variant 0.91 delamanid
fbiC 1304757 c.1827A>G synonymous_variant 0.91 delamanid
fbiC 1304784 c.1854T>C synonymous_variant 0.9 delamanid
fbiC 1304787 c.1857T>C synonymous_variant 0.9 delamanid
fbiC 1304790 c.1860C>G synonymous_variant 0.9 delamanid
fbiC 1304808 c.1878C>G synonymous_variant 0.89 delamanid
fbiC 1304811 c.1881C>G synonymous_variant 0.88 delamanid
fbiC 1304817 c.1887T>C synonymous_variant 0.88 delamanid
fbiC 1304829 c.1899T>C synonymous_variant 0.87 delamanid
fbiC 1304832 c.1902C>G synonymous_variant 0.86 delamanid
fbiC 1304853 c.1923C>G synonymous_variant 0.86 delamanid
fbiC 1304856 c.1926C>G synonymous_variant 0.88 delamanid
fbiC 1304872 c.1942_1944delAGCinsTCG synonymous_variant 0.83 delamanid
fbiC 1304877 c.1947T>C synonymous_variant 0.85 delamanid
fbiC 1304878 c.1948_1950delCGCinsAGG synonymous_variant 0.85 delamanid
fbiC 1304889 c.1959G>A synonymous_variant 0.87 delamanid
fbiC 1304893 p.Gly655Ser missense_variant 0.87 delamanid
fbiC 1304916 c.1986T>C synonymous_variant 0.82 delamanid
fbiC 1304925 c.1995G>C synonymous_variant 0.82 delamanid
fbiC 1304928 c.1998T>C synonymous_variant 0.81 delamanid
fbiC 1304934 c.2004C>G synonymous_variant 0.83 delamanid
fbiC 1304937 c.2007G>C synonymous_variant 0.83 delamanid
fbiC 1304940 c.2010A>G synonymous_variant 0.83 delamanid
fbiC 1304946 c.2016G>C synonymous_variant 0.85 delamanid
fbiC 1304958 c.2028T>G synonymous_variant 0.83 delamanid
fbiC 1304961 c.2031C>T synonymous_variant 0.82 delamanid
fbiC 1304991 c.2061G>C synonymous_variant 0.78 delamanid
fbiC 1304994 c.2064A>G synonymous_variant 0.78 delamanid
fbiC 1304995 c.2065T>C synonymous_variant 0.78 delamanid
fbiC 1305006 c.2076A>G synonymous_variant 0.78 delamanid
fbiC 1305012 c.2082G>C synonymous_variant 0.76 delamanid
fbiC 1305015 c.2085G>C synonymous_variant 0.73 delamanid
fbiC 1305021 c.2091C>A synonymous_variant 0.66 delamanid
fbiC 1305027 c.2097G>A synonymous_variant 0.64 delamanid