TB-Profiler result

Run: SRR5341341

Summary

Run ID: SRR5341341

Sample name:

Date: 2024-04-15T22:49:04.779687

Number of reads: 1230499

Percentage reads mapped: 29.56

Median coverage: 24.0

Strain: lineage2.2.1

Spoligotype:

Drug-resistance: Pre-XDR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage2 East-Asian RD105 0.96
lineage2.2.1 East-Asian (Beijing) RD105;RD207;RD181 0.99
lineage2.2 East-Asian (Beijing) RD105;RD207 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.Ser450Leu Assoc w R
isoniazid katG p.Ser315Thr Assoc w R High-level resistance
c.451_453delGTCinsCG Assoc w R High-level resistance
ethambutol embB p.Tyr319Ser Assoc w R
pyrazinamide pncA p.Thr160Ala Not assoc w R - Interim Mutation from literature
streptomycin
fluoroquinolones
moxifloxacin gyrB p.Thr500Asn Uncertain significance Mutation from literature
ofloxacin
levofloxacin gyrB p.Thr500Asn Uncertain significance Mutation from literature
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide
clofazimine
para-aminosalicylic_acid
delamanid fgd1 c.730_732delAACinsGG Assoc w R - Interim Confers DLM-PMD cross-resistance
c.766_768delGCTinsCC Assoc w R - Interim Confers DLM-PMD cross-resistance
fbiC c.2401_2403delGAAinsAC Assoc w R - Interim Confers DLM-PMD cross-resistance
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
gyrB 6738 p.Thr500Asn missense_variant 0.43 levofloxacin Uncertain significance Mutation from literature
moxifloxacin Uncertain significance Mutation from literature
fgd1 491512 c.730_732delAACinsGG frameshift_variant&missense_variant 0.33 pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
delamanid Assoc w R - Interim Confers DLM-PMD cross-resistance
fgd1 491548 c.766_768delGCTinsCC frameshift_variant&missense_variant 0.37 pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
delamanid Assoc w R - Interim Confers DLM-PMD cross-resistance
rpoB 761155 p.Ser450Leu missense_variant 0.47 rifampicin Assoc w R
fbiC 1305331 c.2401_2403delGAAinsAC frameshift_variant&missense_variant 0.21 pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
delamanid Assoc w R - Interim Confers DLM-PMD cross-resistance
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid Assoc w R High-level resistance
katG 2155659 c.451_453delGTCinsCG frameshift_variant&missense_variant 0.23 isoniazid Assoc w R High-level resistance
pncA 2288764 p.Thr160Ala missense_variant 1.0 pyrazinamide Not assoc w R - Interim Mutation from literature
embB 4247469 p.Tyr319Ser missense_variant 0.51 ethambutol Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
dnaA 741 c.741T>C synonymous_variant 0.38 isoniazid Not assoc w R - Interim
dnaA 750 c.750C>G synonymous_variant 0.41 isoniazid
dnaA 756 c.756T>C synonymous_variant 0.41 isoniazid
gyrB 6097 c.858G>A synonymous_variant 0.37 levofloxacin
moxifloxacin
gyrB 6100 c.861G>C synonymous_variant 0.39 levofloxacin
moxifloxacin
gyrB 6109 c.870G>C synonymous_variant 0.25 levofloxacin
moxifloxacin
gyrB 6115 c.876A>G synonymous_variant 0.41 levofloxacin
moxifloxacin
gyrB 6123 p.Ala295Gly missense_variant 0.38 levofloxacin
moxifloxacin
gyrB 6127 c.888G>T synonymous_variant 0.26 levofloxacin
moxifloxacin
gyrB 6130 c.891T>C synonymous_variant 0.2 levofloxacin
moxifloxacin
gyrB 6133 c.894G>C synonymous_variant 0.2 levofloxacin
moxifloxacin
gyrB 6170 p.His311Ala missense_variant 0.2 levofloxacin
moxifloxacin
gyrA 6649 c.-653T>C upstream_gene_variant 0.29 levofloxacin
moxifloxacin
gyrA 6655 c.-647T>C upstream_gene_variant 0.31 levofloxacin
moxifloxacin
gyrA 6673 c.-629A>T upstream_gene_variant 0.42 levofloxacin
moxifloxacin
gyrA 6700 c.-602T>C upstream_gene_variant 0.48 levofloxacin
moxifloxacin
gyrA 6703 c.-599G>C upstream_gene_variant 0.48 levofloxacin
moxifloxacin
gyrA 6709 c.-593A>G upstream_gene_variant 0.5 levofloxacin
moxifloxacin
gyrA 6712 c.-590G>C upstream_gene_variant 0.5 levofloxacin
moxifloxacin
gyrB 6715 c.1476C>G synonymous_variant 0.45 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 6730 c.-572A>G upstream_gene_variant 0.49 levofloxacin
moxifloxacin
gyrA 6742 c.-560A>G upstream_gene_variant 0.42 levofloxacin
moxifloxacin
gyrB 6745 c.1506T>C synonymous_variant 0.54 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 6760 c.-542G>C upstream_gene_variant 0.58 levofloxacin
moxifloxacin
gyrB 6775 c.1536G>C synonymous_variant 0.28 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 6778 c.-524C>T upstream_gene_variant 0.42 levofloxacin
moxifloxacin
gyrB 6793 c.1554T>C synonymous_variant 0.49 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6797 p.Gly520Thr missense_variant 0.18 levofloxacin
moxifloxacin
gyrB 6808 c.1569C>T synonymous_variant 0.21 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6811 c.1572C>T synonymous_variant 0.55 levofloxacin
moxifloxacin Not assoc w R - Interim
gyrA 6838 c.-464C>G upstream_gene_variant 0.2 levofloxacin
moxifloxacin
gyrB 6841 c.1602T>C synonymous_variant 0.53 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 6844 c.-458T>C upstream_gene_variant 0.39 levofloxacin
moxifloxacin
gyrA 6853 c.-449A>G upstream_gene_variant 0.44 levofloxacin
moxifloxacin
gyrB 6856 c.1617T>C synonymous_variant 0.44 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6859 c.1620T>C synonymous_variant 0.44 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 6869 c.-433T>C upstream_gene_variant 0.43 levofloxacin
moxifloxacin
gyrA 6872 c.-430T>C upstream_gene_variant 0.39 levofloxacin
moxifloxacin
gyrB 6878 c.1639T>C synonymous_variant 0.38 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 6881 c.1642T>C synonymous_variant 0.33 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 6889 c.-413G>T upstream_gene_variant 0.29 levofloxacin
moxifloxacin
gyrA 7153 c.-149G>T upstream_gene_variant 0.34 levofloxacin
moxifloxacin
gyrB 7159 c.1920C>T synonymous_variant 0.26 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrB 7162 c.1923C>T synonymous_variant 0.26 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7165 c.-137C>T upstream_gene_variant 0.26 levofloxacin
moxifloxacin
gyrA 7168 c.-134C>G upstream_gene_variant 0.5 levofloxacin
moxifloxacin
gyrA 7178 c.-124T>C upstream_gene_variant 0.29 levofloxacin
moxifloxacin
gyrB 7210 p.Asp657Glu missense_variant 0.3 levofloxacin
moxifloxacin
gyrA 7213 c.-89G>C upstream_gene_variant 0.24 levofloxacin
moxifloxacin
gyrA 7225 c.-77T>C upstream_gene_variant 0.41 levofloxacin
moxifloxacin
gyrA 7243 c.-59G>A upstream_gene_variant 0.29 levofloxacin
moxifloxacin
gyrA 7355 c.54T>C synonymous_variant 0.29 levofloxacin
moxifloxacin
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7382 c.81C>T synonymous_variant 0.28 levofloxacin
moxifloxacin
gyrA 7391 c.90C>T synonymous_variant 0.3 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7394 c.93T>C synonymous_variant 0.46 levofloxacin Not assoc w R - Interim
moxifloxacin
gyrA 7397 c.96G>C synonymous_variant 0.34 levofloxacin
moxifloxacin
gyrA 7406 c.105G>C synonymous_variant 0.37 levofloxacin
moxifloxacin
gyrA 7412 c.111C>G synonymous_variant 0.53 levofloxacin
moxifloxacin
gyrA 7433 c.132G>A synonymous_variant 0.54 levofloxacin
moxifloxacin
gyrA 7442 c.141G>C synonymous_variant 0.61 levofloxacin
moxifloxacin
gyrA 7457 c.156T>C synonymous_variant 0.56 levofloxacin
moxifloxacin
gyrA 7463 c.162G>C synonymous_variant 0.48 levofloxacin
moxifloxacin
gyrA 7472 c.171T>C synonymous_variant 0.49 levofloxacin Not assoc w R - Interim
moxifloxacin
gyrA 7475 c.174A>G synonymous_variant 0.49 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7480 p.Phe60Tyr missense_variant 0.52 levofloxacin
moxifloxacin
gyrA 7484 c.183T>C synonymous_variant 0.51 levofloxacin
moxifloxacin
gyrA 7499 c.198G>C synonymous_variant 0.51 levofloxacin
moxifloxacin
gyrA 7526 c.225G>C synonymous_variant 0.48 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7532 c.231T>G synonymous_variant 0.39 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7541 c.240C>G synonymous_variant 0.52 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7547 c.246C>T synonymous_variant 0.44 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7565 c.264C>T synonymous_variant 0.46 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7569 c.268_270delGCGinsTC frameshift_variant&missense_variant 0.38 levofloxacin
moxifloxacin
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7592 c.291G>C synonymous_variant 0.43 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7595 c.294C>G synonymous_variant 0.54 levofloxacin
moxifloxacin
gyrA 7607 c.306C>G synonymous_variant 0.45 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7613 c.312G>A synonymous_variant 0.38 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7622 c.321C>T synonymous_variant 0.22 levofloxacin
moxifloxacin
gyrA 7631 c.330G>C synonymous_variant 0.34 levofloxacin
moxifloxacin
gyrA 7652 c.351C>T synonymous_variant 0.18 levofloxacin
moxifloxacin
gyrA 7728 c.427_429delAGGinsCC frameshift_variant&missense_variant 0.32 levofloxacin
moxifloxacin
gyrA 7760 c.459C>T synonymous_variant 0.26 levofloxacin
moxifloxacin
gyrA 7763 c.462T>G synonymous_variant 0.59 levofloxacin
moxifloxacin
gyrA 7775 c.474C>T synonymous_variant 0.48 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7784 c.483A>G synonymous_variant 0.59 levofloxacin
moxifloxacin
gyrA 7790 c.489G>C synonymous_variant 0.35 levofloxacin
moxifloxacin
gyrA 7796 c.495G>T synonymous_variant 0.34 levofloxacin
moxifloxacin
gyrA 7799 c.498A>G synonymous_variant 0.58 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7802 c.501C>G synonymous_variant 0.41 levofloxacin
moxifloxacin
gyrA 7814 c.513C>G synonymous_variant 0.22 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7832 c.531G>T synonymous_variant 0.54 levofloxacin
moxifloxacin
gyrA 7835 c.534A>G synonymous_variant 0.5 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7841 c.540C>T synonymous_variant 0.47 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 7847 c.546G>C synonymous_variant 0.4 levofloxacin
moxifloxacin
gyrA 7859 c.558A>C synonymous_variant 0.47 levofloxacin
moxifloxacin
gyrA 7865 c.564T>C synonymous_variant 0.54 levofloxacin
moxifloxacin
gyrA 7874 c.573G>C synonymous_variant 0.18 levofloxacin
moxifloxacin
gyrA 7886 c.585T>G synonymous_variant 0.26 levofloxacin
moxifloxacin
gyrA 7898 p.Asp199Glu missense_variant 0.25 levofloxacin
moxifloxacin
gyrA 8156 c.855T>C synonymous_variant 0.29 levofloxacin
moxifloxacin
gyrA 8168 c.867A>G synonymous_variant 0.32 levofloxacin
moxifloxacin
gyrA 8174 c.873C>G synonymous_variant 0.32 levofloxacin
moxifloxacin
gyrA 8177 c.876A>C synonymous_variant 0.31 levofloxacin
moxifloxacin
gyrA 8191 p.Ala297Gly missense_variant 0.28 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrA 8198 c.897T>C synonymous_variant 0.28 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8207 c.906T>C synonymous_variant 0.28 levofloxacin
moxifloxacin
gyrA 8210 c.909G>A synonymous_variant 0.28 levofloxacin
moxifloxacin
gyrA 8264 c.963T>C synonymous_variant 0.25 levofloxacin
moxifloxacin
gyrA 8283 c.982_984delATCinsCG frameshift_variant&missense_variant 0.41 levofloxacin
moxifloxacin
gyrA 8288 c.987T>C synonymous_variant 0.45 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8294 c.993T>C synonymous_variant 0.49 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8315 c.1014G>A synonymous_variant 0.2 levofloxacin
moxifloxacin
gyrA 8324 c.1023T>C synonymous_variant 0.52 levofloxacin
moxifloxacin
gyrA 8327 c.1026C>G synonymous_variant 0.21 levofloxacin
moxifloxacin
gyrA 8339 c.1038A>C synonymous_variant 0.38 levofloxacin
moxifloxacin
gyrA 8340 p.Ala347Ser missense_variant 0.51 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrA 8354 c.1053G>C synonymous_variant 0.18 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8357 c.1056G>A synonymous_variant 0.19 levofloxacin
moxifloxacin
gyrA 8366 c.1065G>C synonymous_variant 0.24 levofloxacin
moxifloxacin
gyrA 8378 c.1077C>T synonymous_variant 0.38 levofloxacin
moxifloxacin
gyrA 8382 p.Leu361Met missense_variant 0.38 levofloxacin
moxifloxacin
gyrA 8391 c.1090_1092delTATinsCC frameshift_variant&missense_variant 0.3 levofloxacin
moxifloxacin
gyrA 8399 c.1098T>C synonymous_variant 0.34 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8401 p.Asp367Ala missense_variant 0.38 levofloxacin
moxifloxacin
gyrA 8408 c.1107A>G synonymous_variant 0.41 levofloxacin
moxifloxacin
gyrA 8417 c.1116C>G synonymous_variant 0.44 levofloxacin
moxifloxacin
gyrA 8420 c.1119T>C synonymous_variant 0.45 levofloxacin
moxifloxacin
gyrA 8426 c.1125G>A synonymous_variant 0.44 levofloxacin
moxifloxacin
gyrA 8432 c.1131C>T synonymous_variant 0.43 levofloxacin
moxifloxacin
gyrA 8453 c.1152A>C synonymous_variant 0.37 levofloxacin
moxifloxacin
gyrA 8462 c.1161A>G synonymous_variant 0.37 levofloxacin
moxifloxacin
gyrA 8465 c.1164C>G synonymous_variant 0.35 levofloxacin
moxifloxacin
gyrA 8471 c.1170T>C synonymous_variant 0.37 levofloxacin
moxifloxacin
gyrA 8472 c.1171C>T synonymous_variant 0.34 levofloxacin
moxifloxacin
gyrA 8480 c.1179C>T synonymous_variant 0.39 levofloxacin
moxifloxacin
gyrA 8486 c.1185T>C synonymous_variant 0.4 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8492 c.1191G>C synonymous_variant 0.3 levofloxacin
moxifloxacin
gyrA 8501 c.1200G>C synonymous_variant 0.24 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8504 c.1203G>C synonymous_variant 0.37 levofloxacin
moxifloxacin
gyrA 8516 c.1215T>C synonymous_variant 0.27 levofloxacin
moxifloxacin
gyrA 8519 c.1218A>G synonymous_variant 0.27 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8585 c.1284C>T synonymous_variant 0.22 levofloxacin
moxifloxacin
gyrA 8603 c.1302A>C synonymous_variant 0.43 levofloxacin
moxifloxacin
gyrA 8606 c.1305C>T synonymous_variant 0.26 levofloxacin
moxifloxacin
gyrA 8619 c.1318T>C synonymous_variant 0.63 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8624 c.1323G>C synonymous_variant 0.68 levofloxacin
moxifloxacin
gyrA 8627 c.1326C>G synonymous_variant 0.66 levofloxacin
moxifloxacin
gyrA 8636 c.1335A>C synonymous_variant 0.66 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8649 p.Arg450Lys missense_variant 0.63 levofloxacin
moxifloxacin
gyrA 8672 c.1371A>G synonymous_variant 0.62 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8678 c.1377G>A synonymous_variant 0.54 levofloxacin
moxifloxacin
gyrA 8693 c.1392T>C synonymous_variant 0.41 levofloxacin
moxifloxacin
gyrA 8711 c.1410A>C synonymous_variant 0.3 levofloxacin
moxifloxacin
gyrA 8714 c.1413A>G synonymous_variant 0.29 levofloxacin
moxifloxacin
gyrA 8717 c.1416C>G synonymous_variant 0.25 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8729 c.1428T>C synonymous_variant 0.25 levofloxacin
moxifloxacin
gyrA 8731 p.Gly477Ala missense_variant 0.24 levofloxacin
moxifloxacin
gyrA 8744 p.Asp481Glu missense_variant 0.22 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrA 8747 c.1446A>G synonymous_variant 0.22 levofloxacin
moxifloxacin
gyrA 8767 p.Arg489Lys missense_variant 0.21 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrA 8769 p.His490Tyr missense_variant 0.21 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrA 8801 c.1500G>C synonymous_variant 0.39 levofloxacin
moxifloxacin
gyrA 8810 c.1509A>C synonymous_variant 0.42 levofloxacin
moxifloxacin
gyrA 8813 p.Asp504Glu missense_variant 0.38 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrA 8828 c.1527T>C synonymous_variant 0.24 levofloxacin
moxifloxacin
gyrA 8829 c.1528T>C synonymous_variant 0.71 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8837 c.1536C>G synonymous_variant 0.27 levofloxacin
moxifloxacin
gyrA 8840 c.1539C>T synonymous_variant 0.26 levofloxacin
moxifloxacin
gyrA 8852 c.1551T>C synonymous_variant 0.37 levofloxacin
moxifloxacin
gyrA 8852 c.1551T>G synonymous_variant 0.39 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8858 c.1557T>G synonymous_variant 0.73 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8867 c.1566A>G synonymous_variant 0.77 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8870 c.1569G>C synonymous_variant 0.77 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8873 c.1572A>C synonymous_variant 0.67 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8876 c.1575C>T synonymous_variant 0.27 levofloxacin
moxifloxacin
gyrA 8897 c.1596T>C synonymous_variant 0.59 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8903 c.1602T>C synonymous_variant 0.67 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8915 c.1614A>G synonymous_variant 0.59 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8942 c.1641G>T synonymous_variant 0.43 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8946 c.1645_1647delTTGinsCC frameshift_variant&missense_variant 0.48 levofloxacin
moxifloxacin
gyrA 8981 c.1680G>C synonymous_variant 0.47 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8996 c.1695T>C synonymous_variant 0.41 levofloxacin
moxifloxacin
gyrA 8998 p.Leu566Trp missense_variant 0.42 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrA 9017 c.1716C>G synonymous_variant 0.41 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 9023 c.1722A>C synonymous_variant 0.38 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 9182 c.1881T>C synonymous_variant 0.27 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 9200 c.1899A>G synonymous_variant 0.41 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 9248 c.1947G>C synonymous_variant 0.29 levofloxacin
moxifloxacin
gyrA 9252 p.Val651Ile missense_variant 0.47 levofloxacin Uncertain significance
moxifloxacin Uncertain significance
gyrA 9267 p.Asn656Gly missense_variant 0.5 levofloxacin
moxifloxacin
gyrA 9296 c.1995T>C synonymous_variant 0.47 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 9304 p.Gly668Glu missense_variant 1.0 levofloxacin
moxifloxacin
gyrA 9308 c.2007C>T synonymous_variant 0.29 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 9323 c.2022C>G synonymous_variant 0.38 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 9335 c.2034G>C synonymous_variant 0.42 levofloxacin
moxifloxacin
gyrA 9345 c.2044A>C synonymous_variant 0.44 levofloxacin
moxifloxacin
gyrA 9377 c.2076A>G synonymous_variant 0.35 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 9383 c.2082T>C synonymous_variant 0.37 levofloxacin
moxifloxacin
gyrA 9386 c.2085T>G synonymous_variant 0.36 levofloxacin
moxifloxacin
gyrA 9395 c.2094G>C synonymous_variant 0.24 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 9398 c.2097T>G synonymous_variant 0.26 levofloxacin
moxifloxacin
gyrA 9401 c.2100G>T synonymous_variant 0.24 levofloxacin
moxifloxacin
gyrA 9413 c.2112G>C synonymous_variant 0.21 levofloxacin
moxifloxacin
gyrA 9419 c.2118T>C synonymous_variant 0.29 levofloxacin
moxifloxacin
gyrA 9420 p.Ile707Ala missense_variant 0.29 levofloxacin
moxifloxacin
fgd1 491286 c.504G>C synonymous_variant 0.33 clofazimine Not assoc w R - Interim
pretomanid
delamanid Not assoc w R - Interim
fgd1 491295 c.513C>G synonymous_variant 0.48 clofazimine Not assoc w R - Interim
pretomanid
delamanid Not assoc w R - Interim
fgd1 491307 c.525C>G synonymous_variant 0.5 clofazimine
pretomanid
delamanid
fgd1 491316 c.534C>A synonymous_variant 0.44 clofazimine
pretomanid
delamanid
fgd1 491340 c.558C>G synonymous_variant 0.4 clofazimine
pretomanid
delamanid
fgd1 491343 c.561C>G synonymous_variant 0.33 clofazimine
pretomanid
delamanid
fgd1 491349 c.567T>C synonymous_variant 0.34 clofazimine Not assoc w R - Interim
pretomanid
delamanid Not assoc w R - Interim
fgd1 491499 c.717G>C synonymous_variant 0.44 clofazimine
pretomanid
delamanid
fgd1 491508 c.726A>C synonymous_variant 0.4 clofazimine
pretomanid
delamanid
fgd1 491536 c.754C>T synonymous_variant 0.35 clofazimine
pretomanid
delamanid
fgd1 491542 c.760T>C synonymous_variant 0.55 clofazimine
pretomanid
delamanid
fgd1 491562 c.780C>T synonymous_variant 0.41 clofazimine
pretomanid
delamanid
fgd1 491563 c.781_783delAGCinsTCG synonymous_variant 0.56 clofazimine
pretomanid
delamanid
fgd1 491571 c.789C>T synonymous_variant 0.59 clofazimine
pretomanid
delamanid
fgd1 491742 c.960T>C synonymous_variant 1.0 clofazimine Not assoc w R
pretomanid
delamanid Not assoc w R - Interim
mshA 575689 c.342G>C synonymous_variant 0.45 ethionamide
isoniazid
mshA 575692 c.345G>A synonymous_variant 0.25 ethionamide
isoniazid
mshA 575701 c.354G>A synonymous_variant 0.2 ethionamide
isoniazid
mshA 575704 c.357T>C synonymous_variant 0.51 ethionamide
isoniazid
mshA 575705 c.358T>C synonymous_variant 0.48 ethionamide
isoniazid
mshA 575714 p.Tyr123Asn missense_variant 0.18 ethionamide
isoniazid
mshA 575725 c.378C>G synonymous_variant 0.33 ethionamide
isoniazid
mshA 575734 c.387T>G synonymous_variant 0.56 ethionamide
isoniazid
mshA 575737 c.390T>C synonymous_variant 0.24 ethionamide
isoniazid
mshA 575744 p.Ala133Thr missense_variant 0.27 ethionamide
isoniazid Uncertain significance
mshA 575749 c.402C>A synonymous_variant 0.29 ethionamide
isoniazid
mshA 575764 c.417C>G synonymous_variant 0.27 ethionamide
isoniazid
mshA 575771 p.Val142Thr missense_variant 0.19 ethionamide
isoniazid
mshA 575776 c.429C>T synonymous_variant 0.33 ethionamide
isoniazid
mshA 575782 c.435G>C synonymous_variant 0.37 ethionamide
isoniazid
mshA 575785 c.438T>C synonymous_variant 0.42 ethionamide
isoniazid
mshA 575795 p.Ile150Val missense_variant 0.43 ethionamide
isoniazid
mshA 575800 c.453G>C synonymous_variant 0.26 ethionamide
isoniazid
mshA 575803 c.456C>T synonymous_variant 0.4 ethionamide
isoniazid Not assoc w R - Interim
mshA 575821 c.474G>C synonymous_variant 0.45 ethionamide
isoniazid
mshA 575842 c.495G>C synonymous_variant 0.47 ethionamide
isoniazid
mshA 575864 c.517T>C synonymous_variant 0.35 ethionamide
isoniazid
mshA 575869 c.522G>A synonymous_variant 0.32 ethionamide
isoniazid
ccsA 620385 c.495G>C synonymous_variant 0.28 capreomycin
amikacin
kanamycin
ccsA 620604 c.714C>G synonymous_variant 0.32 capreomycin
amikacin
kanamycin
ccsA 620625 c.735A>C synonymous_variant 0.48 capreomycin
amikacin
kanamycin
ccsA 620625 p.Ile245Met missense_variant 0.52 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Uncertain significance
ccsA 620631 c.741T>C synonymous_variant 0.52 capreomycin
amikacin
kanamycin
ccsA 620652 c.762C>G synonymous_variant 0.56 capreomycin
amikacin
kanamycin
ccsA 620661 c.771C>G synonymous_variant 0.47 capreomycin
amikacin
kanamycin
ccsA 620694 c.804C>G synonymous_variant 0.55 capreomycin
amikacin
kanamycin
ccsA 620698 p.Val270Ile missense_variant 0.5 capreomycin
amikacin
kanamycin
ccsA 620715 c.825C>T synonymous_variant 0.57 capreomycin
amikacin
kanamycin
ccsA 620730 c.840C>T synonymous_variant 0.55 capreomycin
amikacin
kanamycin
ccsA 620733 c.843G>C synonymous_variant 0.53 capreomycin
amikacin
kanamycin
ccsA 620736 c.846G>C synonymous_variant 0.57 capreomycin
amikacin
kanamycin
ccsA 620739 c.849A>G synonymous_variant 0.57 capreomycin
amikacin
kanamycin
ccsA 620742 c.852G>C synonymous_variant 0.61 capreomycin
amikacin
kanamycin
ccsA 620764 c.874_876delGCCinsTG frameshift_variant&missense_variant 0.67 capreomycin
amikacin
kanamycin
ccsA 620778 c.888T>C synonymous_variant 0.57 capreomycin
amikacin
kanamycin
ccsA 620781 c.891C>T synonymous_variant 0.57 capreomycin
amikacin
kanamycin
ccsA 620783 p.Ala298Val missense_variant 0.57 capreomycin
amikacin
kanamycin
Rv0565c 656253 c.1218G>C synonymous_variant 0.31 ethionamide
Rv0565c 656256 c.1215G>C synonymous_variant 0.35 ethionamide
Rv0565c 656283 c.1188G>A synonymous_variant 0.34 ethionamide
Rv0565c 656292 c.1179G>C synonymous_variant 0.32 ethionamide
Rv0565c 656298 c.1173G>C synonymous_variant 0.33 ethionamide
Rv0565c 656304 c.1167T>C synonymous_variant 0.36 ethionamide
Rv0565c 656307 c.1164G>C synonymous_variant 0.37 ethionamide
Rv0565c 656310 c.1161T>C synonymous_variant 0.38 ethionamide
Rv0565c 657081 c.390G>A synonymous_variant 1.0 ethionamide Not assoc w R - Interim
Rv0565c 657142 p.Arg110His missense_variant 1.0 ethionamide Uncertain significance
hadA 731774 c.-156T>C upstream_gene_variant 0.71 isoniazid
hadA 731789 c.-141A>G upstream_gene_variant 0.62 isoniazid
hadA 731792 c.-138G>A upstream_gene_variant 0.29 isoniazid
hadA 731810 c.-120G>C upstream_gene_variant 0.4 isoniazid
nusG 734421 c.168A>C synonymous_variant 0.36 rifampicin
nusG 734424 c.171G>C synonymous_variant 0.32 rifampicin
nusG 734439 c.186C>G synonymous_variant 0.47 rifampicin
nusG 734451 c.198G>C synonymous_variant 0.53 rifampicin
nusG 734454 c.201A>G synonymous_variant 0.56 rifampicin
nusG 734460 c.207G>C synonymous_variant 0.6 rifampicin
nusG 734472 c.219T>G synonymous_variant 0.44 rifampicin Not assoc w R - Interim
nusG 734475 c.222T>C synonymous_variant 0.59 rifampicin Not assoc w R - Interim
nusG 734478 c.225C>G synonymous_variant 0.3 rifampicin Not assoc w R - Interim
nusG 734499 c.246G>C synonymous_variant 0.32 rifampicin
nusG 734532 c.279A>G synonymous_variant 0.56 rifampicin Not assoc w R - Interim
nusG 734541 c.288A>G synonymous_variant 0.55 rifampicin Not assoc w R - Interim
nusG 734559 c.306T>C synonymous_variant 0.47 rifampicin
nusG 734566 c.313C>T synonymous_variant 0.31 rifampicin
nusG 734571 c.318C>G synonymous_variant 0.46 rifampicin
nusG 734580 c.327T>C synonymous_variant 0.49 rifampicin Not assoc w R - Interim
nusG 734841 c.588G>C synonymous_variant 0.48 rifampicin
nusG 734847 c.594T>C synonymous_variant 0.48 rifampicin
nusG 734853 c.600A>G synonymous_variant 0.46 rifampicin
nusG 734854 c.601T>C synonymous_variant 0.46 rifampicin
nusG 734859 c.606G>C synonymous_variant 0.54 rifampicin
nusG 734863 p.Thr204Ser missense_variant 0.52 rifampicin
nusG 734889 c.636G>A synonymous_variant 0.28 rifampicin
nusG 734895 c.642A>G synonymous_variant 0.36 rifampicin
nusG 734910 c.657C>G synonymous_variant 0.29 rifampicin
rpoB 760091 c.285G>C synonymous_variant 0.37 rifampicin Not assoc w R - Interim
rpoB 760101 c.295T>C synonymous_variant 0.36 rifampicin Not assoc w R - Interim
rpoB 760112 c.306T>C synonymous_variant 0.31 rifampicin
rpoB 760118 c.312T>G synonymous_variant 0.49 rifampicin Not assoc w R - Interim
rpoB 760121 c.315T>G synonymous_variant 0.34 rifampicin
rpoB 760130 p.Asp108Glu missense_variant 0.46 rifampicin Uncertain significance
rpoB 760136 c.330G>A synonymous_variant 0.29 rifampicin
rpoB 760139 c.333A>T synonymous_variant 0.39 rifampicin
rpoB 760142 c.336C>G synonymous_variant 0.6 rifampicin
rpoB 760148 p.Asp114Glu missense_variant 0.27 rifampicin
rpoB 760155 p.Lys117Arg missense_variant 0.2 rifampicin
rpoB 760178 c.372G>A synonymous_variant 0.38 rifampicin Not assoc w R - Interim
rpoB 760181 c.375T>C synonymous_variant 0.47 rifampicin Not assoc w R - Interim
rpoB 760184 c.378A>G synonymous_variant 0.56 rifampicin Not assoc w R - Interim
rpoB 760196 c.390C>G synonymous_variant 0.44 rifampicin Not assoc w R - Interim
rpoB 760235 c.429T>C synonymous_variant 0.6 rifampicin Not assoc w R - Interim
rpoB 760244 c.438G>C synonymous_variant 0.43 rifampicin Not assoc w R - Interim
rpoB 760283 c.477G>C synonymous_variant 0.57 rifampicin Not assoc w R - Interim
rpoB 760298 c.492G>C synonymous_variant 0.63 rifampicin Not assoc w R - Interim
rpoB 760310 c.504G>C synonymous_variant 0.6 rifampicin
rpoB 760316 c.510C>G synonymous_variant 0.37 rifampicin
rpoB 760317 p.Ser171Cys missense_variant 0.18 rifampicin
rpoB 760325 c.519G>C synonymous_variant 0.44 rifampicin Not assoc w R - Interim
rpoB 760331 c.525G>C synonymous_variant 0.6 rifampicin
rpoB 760334 c.528G>T synonymous_variant 0.46 rifampicin
rpoB 760340 c.534G>T synonymous_variant 0.56 rifampicin Not assoc w R - Interim
rpoB 760357 p.Thr184Ser missense_variant 0.57 rifampicin Uncertain significance
rpoB 760361 c.555T>C synonymous_variant 0.59 rifampicin Not assoc w R - Interim
rpoB 760376 p.Asp190Glu missense_variant 0.6 rifampicin Uncertain significance
rpoB 760406 c.600G>C synonymous_variant 0.49 rifampicin
rpoB 760407 p.Ser201Gly missense_variant 0.52 rifampicin Uncertain significance
rpoB 760415 c.609C>T synonymous_variant 0.56 rifampicin Not assoc w R - Interim
rpoB 760424 c.618C>G synonymous_variant 0.56 rifampicin Not assoc w R - Interim
rpoB 760430 c.624T>C synonymous_variant 0.55 rifampicin Not assoc w R - Interim
rpoB 760457 c.651C>T synonymous_variant 0.54 rifampicin Not assoc w R - Interim
rpoB 760463 c.657C>T synonymous_variant 0.59 rifampicin Not assoc w R - Interim
rpoB 760475 c.669A>G synonymous_variant 0.54 rifampicin Not assoc w R - Interim
rpoB 760478 c.672C>T synonymous_variant 0.51 rifampicin Not assoc w R - Interim
rpoB 760481 c.675G>T synonymous_variant 0.53 rifampicin
rpoB 760484 c.678A>G synonymous_variant 0.6 rifampicin Not assoc w R - Interim
rpoB 760502 c.696C>G synonymous_variant 0.33 rifampicin Not assoc w R - Interim
rpoB 760522 p.Ser239Asn missense_variant 0.22 rifampicin Uncertain significance
rpoB 760547 c.741G>C synonymous_variant 0.38 rifampicin Not assoc w R - Interim
rpoB 760563 p.Arg253Met missense_variant 0.24 rifampicin Uncertain significance
rpoB 760611 c.805T>C synonymous_variant 0.39 rifampicin Not assoc w R - Interim
rpoB 760646 c.840C>G synonymous_variant 0.49 rifampicin Not assoc w R - Interim
rpoB 760649 c.843G>C synonymous_variant 0.2 rifampicin
rpoB 760655 c.849A>G synonymous_variant 0.58 rifampicin Not assoc w R - Interim
rpoB 760661 c.855A>C synonymous_variant 0.61 rifampicin Not assoc w R - Interim
rpoB 760670 c.864G>C synonymous_variant 0.57 rifampicin
rpoB 760674 c.868T>C synonymous_variant 0.58 rifampicin Not assoc w R - Interim
rpoB 760679 c.873A>G synonymous_variant 0.58 rifampicin Not assoc w R - Interim
rpoB 760683 c.877T>C synonymous_variant 0.55 rifampicin Not assoc w R - Interim
rpoB 760718 c.912C>G synonymous_variant 0.18 rifampicin
rpoB 760721 c.915C>G synonymous_variant 0.45 rifampicin
rpoB 760724 c.918T>C synonymous_variant 0.29 rifampicin Not assoc w R - Interim
rpoB 760730 c.924T>C synonymous_variant 0.39 rifampicin Not assoc w R - Interim
rpoB 760748 c.942C>G synonymous_variant 0.26 rifampicin
rpoB 760751 c.945G>C synonymous_variant 0.21 rifampicin
rpoB 760817 c.1011A>G synonymous_variant 0.23 rifampicin
rpoB 760820 c.1014T>C synonymous_variant 0.24 rifampicin
rpoB 760826 c.1020C>G synonymous_variant 0.22 rifampicin Not assoc w R - Interim
rpoB 760830 c.1024T>C synonymous_variant 0.24 rifampicin Not assoc w R - Interim
rpoB 760841 c.1035T>C synonymous_variant 0.25 rifampicin Not assoc w R - Interim
rpoB 760859 c.1053T>C synonymous_variant 0.24 rifampicin
rpoB 760862 c.1056G>C synonymous_variant 0.29 rifampicin Not assoc w R - Interim
rpoB 760877 c.1071G>C synonymous_variant 0.18 rifampicin
rpoB 760883 c.1077G>C synonymous_variant 0.33 rifampicin
rpoB 760886 c.1080A>G synonymous_variant 0.32 rifampicin
rpoB 760887 p.Thr361Val missense_variant 0.32 rifampicin Uncertain significance
rpoB 760910 c.1104C>T synonymous_variant 0.29 rifampicin Not assoc w R - Interim
rpoB 760916 c.1110C>G synonymous_variant 0.28 rifampicin
rpoB 760925 c.1119T>C synonymous_variant 0.44 rifampicin
rpoB 760928 c.1122G>C synonymous_variant 0.43 rifampicin Not assoc w R - Interim
rpoB 760931 c.1125C>G synonymous_variant 0.44 rifampicin
rpoB 760934 c.1128C>T synonymous_variant 0.23 rifampicin
rpoB 760946 c.1140A>G synonymous_variant 0.49 rifampicin Not assoc w R - Interim
rpoB 760964 c.1158C>G synonymous_variant 0.28 rifampicin Not assoc w R - Interim
rpoB 760965 p.Met387Leu missense_variant 0.38 rifampicin Uncertain significance
rpoB 760982 c.1176G>C synonymous_variant 0.41 rifampicin Not assoc w R - Interim
rpoB 761015 c.1209G>C synonymous_variant 0.36 rifampicin Not assoc w R - Interim
rpoB 761021 c.1215G>C synonymous_variant 0.37 rifampicin
rpoB 761027 c.1221A>G synonymous_variant 0.35 rifampicin Not assoc w R - Interim
rpoB 761036 c.1230G>C synonymous_variant 0.33 rifampicin Not assoc w R - Interim
rpoB 761037 c.1231T>C synonymous_variant 0.31 rifampicin Not assoc w R - Interim
rpoB 761051 c.1245G>C synonymous_variant 0.31 rifampicin Not assoc w R - Interim
rpoB 761096 c.1290G>C synonymous_variant 0.45 rifampicin
rpoB 761097 c.1291_1292delAGinsTC synonymous_variant 0.45 rifampicin
rpoB 761102 c.1296A>G synonymous_variant 0.45 rifampicin
rpoB 761132 c.1326G>T synonymous_variant 0.48 rifampicin Not assoc w R - Interim
rpoB 761133 c.1327T>C synonymous_variant 0.5 rifampicin Not assoc w R - Interim
rpoB 761150 c.1344A>C synonymous_variant 0.3 rifampicin Not assoc w R - Interim
rpoB 761165 c.1359G>C synonymous_variant 0.23 rifampicin Not assoc w R - Interim
rpoB 761168 c.1362C>G synonymous_variant 0.2 rifampicin
rpoB 761171 c.1365C>T synonymous_variant 0.21 rifampicin Not assoc w R - Interim
rpoB 761180 c.1374A>C synonymous_variant 0.39 rifampicin Not assoc w R - Interim
rpoB 761189 c.1383T>C synonymous_variant 0.39 rifampicin Not assoc w R - Interim
rpoB 761195 c.1389G>C synonymous_variant 0.45 rifampicin Not assoc w R - Interim
rpoB 761198 c.1392G>T synonymous_variant 0.29 rifampicin Not assoc w R - Interim
rpoB 761213 c.1407G>C synonymous_variant 0.29 rifampicin
rpoB 761217 p.Pro471Ser missense_variant 0.3 rifampicin
rpoB 761234 c.1428G>C synonymous_variant 0.34 rifampicin Not assoc w R - Interim
rpoB 761249 c.1443A>G synonymous_variant 0.55 rifampicin Not assoc w R - Interim
rpoB 761261 c.1455G>T synonymous_variant 0.5 rifampicin Not assoc w R - Interim
rpoB 761264 c.1458C>G synonymous_variant 0.48 rifampicin Not assoc w R - Interim
rpoB 761282 c.1476C>T synonymous_variant 0.44 rifampicin
rpoB 761288 c.1482G>T synonymous_variant 0.4 rifampicin
rpoB 761318 c.1512G>T synonymous_variant 0.5 rifampicin Not assoc w R - Interim
rpoB 761327 c.1521A>G synonymous_variant 0.6 rifampicin Not assoc w R - Interim
rpoB 761330 c.1524G>C synonymous_variant 0.61 rifampicin
rpoB 761345 c.1539G>C synonymous_variant 0.49 rifampicin
rpoB 761354 c.1548C>T synonymous_variant 0.54 rifampicin
rpoB 761360 c.1554T>C synonymous_variant 0.57 rifampicin Not assoc w R - Interim
rpoB 761362 p.Ser519Thr missense_variant 0.49 rifampicin
rpoB 761367 p.Glu521Gln missense_variant 0.37 rifampicin
rpoB 761374 p.Val523Asp missense_variant 0.57 rifampicin
rpoB 761408 c.1602G>C synonymous_variant 0.48 rifampicin
rpoB 761414 c.1608A>G synonymous_variant 0.47 rifampicin Not assoc w R - Interim
rpoB 761423 c.1617T>C synonymous_variant 0.27 rifampicin
rpoB 761502 p.Pro566Ser missense_variant 0.17 rifampicin
rpoB 761510 c.1704T>C synonymous_variant 0.27 rifampicin
rpoB 761516 c.1710G>C synonymous_variant 0.37 rifampicin
rpoB 761537 c.1731C>G synonymous_variant 0.5 rifampicin Not assoc w R - Interim
rpoB 761552 c.1746G>C synonymous_variant 0.28 rifampicin
rpoB 761555 c.1749G>C synonymous_variant 0.28 rifampicin Not assoc w R - Interim
rpoB 761558 c.1752C>G synonymous_variant 0.28 rifampicin Not assoc w R - Interim
rpoB 761561 c.1755C>G synonymous_variant 0.3 rifampicin
rpoB 761564 c.1758G>C synonymous_variant 0.29 rifampicin Not assoc w R - Interim
rpoB 761570 c.1764T>C synonymous_variant 0.54 rifampicin Not assoc w R - Interim
rpoB 761573 c.1767C>G synonymous_variant 0.65 rifampicin Not assoc w R - Interim
rpoB 761579 c.1773G>C synonymous_variant 0.36 rifampicin Not assoc w R - Interim
rpoB 761600 c.1794T>C synonymous_variant 0.55 rifampicin
rpoB 761606 c.1800C>G synonymous_variant 0.72 rifampicin
rpoB 761612 c.1806G>T synonymous_variant 0.6 rifampicin Not assoc w R - Interim
rpoB 761615 c.1809A>C synonymous_variant 0.67 rifampicin Not assoc w R - Interim
rpoB 761627 c.1821C>T synonymous_variant 0.23 rifampicin Not assoc w R - Interim
rpoB 761636 c.1830G>T synonymous_variant 0.54 rifampicin Not assoc w R - Interim
rpoB 761645 c.1839C>G synonymous_variant 0.58 rifampicin Not assoc w R - Interim
rpoB 761648 c.1842T>C synonymous_variant 0.61 rifampicin
rpoB 761666 c.1860G>C synonymous_variant 0.52 rifampicin
rpoB 761669 c.1863C>T synonymous_variant 0.45 rifampicin
rpoB 761675 c.1869G>T synonymous_variant 0.48 rifampicin
rpoB 761690 c.1884G>C synonymous_variant 0.47 rifampicin
rpoB 761747 c.1941G>C synonymous_variant 0.33 rifampicin
rpoB 761765 c.1959T>C synonymous_variant 0.33 rifampicin
rpoB 761772 p.His656Ala missense_variant 0.39 rifampicin
rpoB 761778 p.Asn658Asp missense_variant 0.38 rifampicin
rpoB 761785 p.Thr660Ser missense_variant 0.23 rifampicin
rpoB 761791 p.Arg662His missense_variant 0.35 rifampicin
rpoB 761813 c.2007T>C synonymous_variant 0.39 rifampicin
rpoB 761834 c.2028T>C synonymous_variant 0.31 rifampicin
rpoB 761847 p.Cys681Arg missense_variant 0.23 rifampicin Uncertain significance
rpoB 761852 c.2046C>G synonymous_variant 0.19 rifampicin
rpoB 761916 p.Asp704Asn missense_variant 0.41 rifampicin
rpoB 761930 c.2124G>C synonymous_variant 0.55 rifampicin
rpoB 761948 c.2142G>C synonymous_variant 0.65 rifampicin Not assoc w R - Interim
rpoB 761954 c.2148C>G synonymous_variant 0.64 rifampicin Not assoc w R - Interim
rpoB 761972 c.2166C>G synonymous_variant 0.19 rifampicin Not assoc w R - Interim
rpoB 762006 c.2200_2202delCGCinsAT frameshift_variant&missense_variant 0.23 rifampicin
rpoB 762014 c.2208C>T synonymous_variant 0.38 rifampicin
rpoB 762017 c.2211A>G synonymous_variant 0.22 rifampicin Not assoc w R - Interim
rpoB 762024 p.Val740Thr missense_variant 0.23 rifampicin Uncertain significance
rpoB 762029 c.2223C>G synonymous_variant 0.24 rifampicin Not assoc w R - Interim
rpoB 762047 c.2241G>A synonymous_variant 0.35 rifampicin Not assoc w R - Interim
rpoB 762053 c.2247T>C synonymous_variant 0.61 rifampicin Not assoc w R - Interim
rpoB 762062 c.2256T>C synonymous_variant 0.61 rifampicin Not assoc w R - Interim
rpoB 762065 c.2259T>C synonymous_variant 0.61 rifampicin Not assoc w R - Interim
rpoB 762083 c.2277T>C synonymous_variant 0.61 rifampicin Not assoc w R - Interim
rpoB 762086 c.2280G>C synonymous_variant 0.6 rifampicin Not assoc w R - Interim
rpoB 762101 c.2295C>G synonymous_variant 0.53 rifampicin Not assoc w R - Interim
rpoB 762114 p.Ile770Val missense_variant 0.51 rifampicin Uncertain significance
rpoB 762131 c.2325C>G synonymous_variant 0.49 rifampicin
rpoB 762137 c.2331C>T synonymous_variant 0.3 rifampicin Not assoc w R - Interim
rpoB 762140 c.2334G>C synonymous_variant 0.47 rifampicin
rpoB 762143 c.2337T>C synonymous_variant 0.47 rifampicin
rpoB 762149 c.2343G>C synonymous_variant 0.48 rifampicin Not assoc w R - Interim
rpoB 762158 c.2352G>C synonymous_variant 0.58 rifampicin Not assoc w R - Interim
rpoB 762167 c.2361T>C synonymous_variant 0.63 rifampicin Not assoc w R - Interim
rpoB 762176 c.2370T>C synonymous_variant 0.66 rifampicin Not assoc w R - Interim
rpoB 762185 c.2379G>C synonymous_variant 0.68 rifampicin Not assoc w R - Interim
rpoB 762209 c.2403C>G synonymous_variant 0.21 rifampicin Not assoc w R - Interim
rpoB 762212 c.2406G>C synonymous_variant 0.31 rifampicin Not assoc w R - Interim
rpoB 762233 c.2427G>C synonymous_variant 0.6 rifampicin Not assoc w R - Interim
rpoB 762236 c.2430G>C synonymous_variant 0.32 rifampicin Not assoc w R - Interim
rpoB 762245 c.2439G>C synonymous_variant 0.38 rifampicin Not assoc w R - Interim
rpoB 762254 c.2448T>C synonymous_variant 0.3 rifampicin Not assoc w R - Interim
rpoB 762278 c.2472C>G synonymous_variant 0.23 rifampicin
rpoB 762281 c.2475G>A synonymous_variant 0.32 rifampicin
rpoB 762284 c.2478G>T synonymous_variant 0.49 rifampicin
rpoB 762287 c.2481C>T synonymous_variant 0.4 rifampicin
rpoB 762293 c.2487T>C synonymous_variant 0.64 rifampicin Not assoc w R - Interim
rpoB 762308 c.2502G>C synonymous_variant 0.3 rifampicin
rpoB 762317 c.2511A>G synonymous_variant 0.59 rifampicin Not assoc w R - Interim
rpoB 762329 c.2523G>C synonymous_variant 0.51 rifampicin Not assoc w R - Interim
rpoB 762335 c.2529C>T synonymous_variant 0.26 rifampicin
rpoB 762338 c.2532T>C synonymous_variant 0.49 rifampicin
rpoB 762347 c.2541T>C synonymous_variant 0.53 rifampicin
rpoB 762350 c.2544C>T synonymous_variant 0.21 rifampicin
rpoB 762362 p.Glu852Asp missense_variant 0.45 rifampicin
rpoB 762369 c.2563T>C synonymous_variant 0.46 rifampicin
rpoC 762374 c.-996G>C upstream_gene_variant 0.55 rifampicin
rpoC 762380 c.-990T>G upstream_gene_variant 0.26 rifampicin
rpoC 762395 c.-975G>C upstream_gene_variant 0.3 rifampicin
rpoC 762398 c.-972T>C upstream_gene_variant 0.32 rifampicin
rpoC 762401 c.-969G>C upstream_gene_variant 0.58 rifampicin
rpoB 762404 c.2598T>C synonymous_variant 0.55 rifampicin Not assoc w R - Interim
rpoC 762407 c.-963G>C upstream_gene_variant 0.26 rifampicin
rpoC 762410 c.-960T>C upstream_gene_variant 0.45 rifampicin
rpoB 762416 c.2610A>G synonymous_variant 0.62 rifampicin Not assoc w R - Interim
rpoC 762434 c.-936T>C upstream_gene_variant 0.55 rifampicin
rpoC 762443 c.-927G>C upstream_gene_variant 0.34 rifampicin
rpoB 762449 c.2643C>A synonymous_variant 0.33 rifampicin Not assoc w R - Interim
rpoB 762452 c.2646G>C synonymous_variant 0.62 rifampicin Not assoc w R - Interim
rpoB 762470 c.2664G>C synonymous_variant 0.61 rifampicin Not assoc w R - Interim
rpoB 762490 p.Val895Ala missense_variant 0.3 rifampicin
rpoC 762509 c.-861T>G upstream_gene_variant 0.61 rifampicin
rpoB 762510 c.2704_2706delGCCinsCG frameshift_variant&missense_variant 0.6 rifampicin
rpoB 762515 c.2709C>T synonymous_variant 0.27 rifampicin Not assoc w R - Interim
rpoC 762527 c.-843G>C upstream_gene_variant 0.36 rifampicin
rpoC 762533 c.-837T>C upstream_gene_variant 0.6 rifampicin
rpoC 762536 c.-834T>C upstream_gene_variant 0.58 rifampicin
rpoC 762537 c.-833T>C upstream_gene_variant 0.31 rifampicin
rpoC 762551 c.-819C>T upstream_gene_variant 0.56 rifampicin
rpoB 762782 c.2976T>C synonymous_variant 0.44 rifampicin Not assoc w R - Interim
rpoB 762785 p.Asp993Glu missense_variant 0.44 rifampicin Uncertain significance
rpoB 762788 c.2982G>C synonymous_variant 0.42 rifampicin Not assoc w R - Interim
rpoB 762789 p.Leu995Met missense_variant 0.42 rifampicin Uncertain significance
rpoB 762795 p.Asp997Asn missense_variant 0.43 rifampicin Uncertain significance
rpoB 762799 p.Ala998Gly missense_variant 0.45 rifampicin Uncertain significance
rpoB 762812 c.3006C>G synonymous_variant 0.53 rifampicin Not assoc w R - Interim
rpoB 762818 c.3012C>G synonymous_variant 0.52 rifampicin Not assoc w R - Interim
rpoB 762827 c.3021G>C synonymous_variant 0.55 rifampicin Not assoc w R - Interim
rpoB 762831 c.3025_3026delAGinsTC synonymous_variant 0.41 rifampicin Not assoc w R - Interim
rpoB 762836 c.3030C>T synonymous_variant 0.43 rifampicin Not assoc w R - Interim
rpoC 762848 c.-522G>C upstream_gene_variant 0.29 rifampicin
rpoB 762857 c.3051C>G synonymous_variant 0.63 rifampicin Not assoc w R - Interim
rpoB 762860 c.3054G>C synonymous_variant 0.3 rifampicin Not assoc w R - Interim
rpoB 762863 c.3057T>C synonymous_variant 0.68 rifampicin Not assoc w R - Interim
rpoB 762879 c.3073_3075delATGinsCC frameshift_variant&missense_variant 0.41 rifampicin
rpoB 762920 c.3114C>T synonymous_variant 0.61 rifampicin Not assoc w R - Interim
rpoB 762929 c.3123G>C synonymous_variant 0.75 rifampicin Not assoc w R - Interim
rpoB 762959 c.3153G>C synonymous_variant 0.38 rifampicin Not assoc w R - Interim
rpoB 762962 c.3156C>T synonymous_variant 0.46 rifampicin Not assoc w R - Interim
rpoB 762989 c.3183G>T synonymous_variant 0.2 rifampicin Not assoc w R - Interim
rpoB 762995 c.3189G>T synonymous_variant 0.69 rifampicin Not assoc w R - Interim
rpoB 763004 c.3198G>A synonymous_variant 0.39 rifampicin Not assoc w R - Interim
rpoB 763007 c.3201C>T synonymous_variant 0.37 rifampicin Not assoc w R - Interim
rpoB 763028 c.3222T>C synonymous_variant 0.33 rifampicin Not assoc w R - Interim
rpoB 763031 c.3225T>C synonymous_variant 0.32 rifampicin Not assoc w R
rpoB 763031 c.3225T>G synonymous_variant 0.68 rifampicin Not assoc w R - Interim
rpoB 763034 c.3228C>G synonymous_variant 0.31 rifampicin Not assoc w R - Interim
rpoB 763040 c.3234C>G synonymous_variant 0.33 rifampicin Not assoc w R - Interim
rpoC 763050 c.-320C>T upstream_gene_variant 0.31 rifampicin
rpoB 763053 c.3247T>C synonymous_variant 0.66 rifampicin Not assoc w R - Interim
rpoB 763070 c.3264T>C synonymous_variant 0.63 rifampicin Not assoc w R - Interim
rpoB 763085 c.3279C>G synonymous_variant 0.3 rifampicin Not assoc w R - Interim
rpoB 763094 c.3288G>C synonymous_variant 0.35 rifampicin Not assoc w R - Interim
rpoC 763100 c.-270G>A upstream_gene_variant 0.19 rifampicin
rpoC 763103 c.-267G>C upstream_gene_variant 0.3 rifampicin
rpoB 763115 c.3309T>C synonymous_variant 0.5 rifampicin Not assoc w R - Interim
rpoB 763127 c.3321G>C synonymous_variant 0.47 rifampicin Not assoc w R - Interim
rpoB 763130 c.3324G>A synonymous_variant 0.2 rifampicin Not assoc w R - Interim
rpoC 763133 c.-237G>C upstream_gene_variant 0.2 rifampicin
rpoB 763136 c.3330C>T synonymous_variant 0.47 rifampicin Not assoc w R - Interim
rpoC 763142 c.-228C>G upstream_gene_variant 0.48 rifampicin
rpoB 763158 c.3352_3354delCTGinsTT frameshift_variant&synonymous_variant 0.24 rifampicin
rpoB 763166 c.3360A>G synonymous_variant 0.28 rifampicin Not assoc w R - Interim
rpoC 763169 c.-201A>G upstream_gene_variant 0.59 rifampicin
rpoC 763190 c.-180C>T upstream_gene_variant 0.21 rifampicin
rpoC 763199 c.-171G>C upstream_gene_variant 0.19 rifampicin
rpoC 763202 c.-168A>G upstream_gene_variant 0.49 rifampicin
rpoB 763203 p.Ser1133Ala missense_variant 0.34 rifampicin Uncertain significance
rpoB 763207 p.Ser1134Lys missense_variant 0.42 rifampicin Uncertain significance
rpoB 763214 c.3408T>C synonymous_variant 0.25 rifampicin Not assoc w R - Interim
rpoC 763217 c.-153G>C upstream_gene_variant 0.23 rifampicin
rpoB 763227 c.3421C>T synonymous_variant 0.48 rifampicin Not assoc w R - Interim
rpoB 763238 c.3432T>C synonymous_variant 0.37 rifampicin Not assoc w R - Interim
rpoC 763262 c.-108C>A upstream_gene_variant 0.28 rifampicin
rpoC 763265 c.-105G>C upstream_gene_variant 0.39 rifampicin
rpoC 763375 c.6C>A synonymous_variant 0.36 rifampicin Not assoc w R - Interim
rpoC 763396 c.27A>G synonymous_variant 0.29 rifampicin Not assoc w R - Interim
rpoC 763408 c.39T>C synonymous_variant 0.53 rifampicin Not assoc w R - Interim
rpoC 763411 c.42T>G synonymous_variant 0.43 rifampicin Not assoc w R - Interim
rpoC 763414 c.45T>G synonymous_variant 0.48 rifampicin Not assoc w R - Interim
rpoC 763423 p.Glu18Asp missense_variant 0.22 rifampicin Uncertain significance
rpoC 763430 c.61_63delAGGinsCT frameshift_variant&missense_variant 0.6 rifampicin
rpoC 763433 c.64_66delCAAinsAC frameshift_variant&missense_variant 0.2 rifampicin
rpoC 763443 p.Tyr25Phe missense_variant 0.21 rifampicin
rpoC 763447 c.78C>T synonymous_variant 0.4 rifampicin
rpoC 763456 c.87A>G synonymous_variant 0.67 rifampicin Not assoc w R - Interim
rpoC 763465 c.96G>A synonymous_variant 0.45 rifampicin
rpoC 763468 c.99G>C synonymous_variant 0.28 rifampicin Not assoc w R - Interim
rpoC 763486 c.117T>C synonymous_variant 0.74 rifampicin Not assoc w R - Interim
rpoC 763492 c.123G>T synonymous_variant 0.34 rifampicin
rpoC 763528 c.159G>A synonymous_variant 0.7 rifampicin Not assoc w R - Interim
rpoC 763546 c.177A>G synonymous_variant 0.67 rifampicin Not assoc w R - Interim
rpoC 763558 c.189C>T synonymous_variant 0.36 rifampicin Not assoc w R - Interim
rpoC 763570 c.201G>C synonymous_variant 0.61 rifampicin Not assoc w R - Interim
rpoC 763573 c.204G>C synonymous_variant 0.38 rifampicin Not assoc w R - Interim
rpoC 763588 c.219C>T synonymous_variant 0.39 rifampicin Not assoc w R - Interim
rpoC 763594 c.225C>T synonymous_variant 0.7 rifampicin Not assoc w R - Interim
rpoC 763603 c.234C>T synonymous_variant 0.74 rifampicin Not assoc w R - Interim
rpoC 763609 c.240C>T synonymous_variant 0.26 rifampicin
rpoC 763615 c.246G>C synonymous_variant 0.49 rifampicin Not assoc w R - Interim
rpoC 763618 c.249C>T synonymous_variant 0.53 rifampicin
rpoC 763621 c.252C>T synonymous_variant 0.25 rifampicin
rpoC 763633 c.264T>C synonymous_variant 0.49 rifampicin Not assoc w R - Interim
rpoC 763657 c.288G>A synonymous_variant 0.25 rifampicin Not assoc w R - Interim
rpoC 763660 c.291T>G synonymous_variant 0.74 rifampicin Not assoc w R - Interim
rpoC 763666 c.297G>A synonymous_variant 0.64 rifampicin
rpoC 763669 c.300C>G synonymous_variant 0.21 rifampicin Not assoc w R - Interim
rpoC 763675 c.306C>G synonymous_variant 0.47 rifampicin Not assoc w R - Interim
rpoC 763696 c.327T>C synonymous_variant 0.28 rifampicin Not assoc w R - Interim
rpoC 763702 c.333C>G synonymous_variant 0.62 rifampicin Not assoc w R - Interim
rpoC 763705 c.336G>C synonymous_variant 0.18 rifampicin
rpoC 763709 c.340C>T synonymous_variant 0.6 rifampicin
rpoC 763714 c.345G>C synonymous_variant 0.57 rifampicin Not assoc w R - Interim
rpoC 763717 c.348T>C synonymous_variant 0.56 rifampicin Not assoc w R - Interim
rpoC 763723 c.354G>C synonymous_variant 0.27 rifampicin
rpoC 763732 c.363C>T synonymous_variant 0.44 rifampicin
rpoC 763735 c.366G>C synonymous_variant 0.23 rifampicin
rpoC 763741 c.372C>T synonymous_variant 0.37 rifampicin
rpoC 763747 c.378G>A synonymous_variant 0.43 rifampicin
rpoC 763765 c.396T>G synonymous_variant 0.57 rifampicin Not assoc w R - Interim
rpoC 763792 p.Glu141Asp missense_variant 0.6 rifampicin
rpoC 763807 c.438T>C synonymous_variant 0.58 rifampicin Not assoc w R - Interim
rpoC 763813 c.444C>G synonymous_variant 0.58 rifampicin
rpoC 763831 c.462A>G synonymous_variant 0.55 rifampicin
rpoC 763837 c.468G>C synonymous_variant 0.56 rifampicin
rpoC 763840 c.471G>C synonymous_variant 0.55 rifampicin
rpoC 763858 c.489A>G synonymous_variant 0.56 rifampicin
rpoC 763861 c.492C>T synonymous_variant 0.47 rifampicin
rpoC 763872 p.Gly168Ala missense_variant 0.47 rifampicin
rpoC 763876 p.Glu169Asp missense_variant 0.46 rifampicin
rpoC 763879 c.510A>G synonymous_variant 0.48 rifampicin
rpoC 763882 c.513G>A synonymous_variant 0.41 rifampicin
rpoC 763891 c.522G>C synonymous_variant 0.49 rifampicin
rpoC 763894 c.525A>G synonymous_variant 0.51 rifampicin
rpoC 763900 c.531G>C synonymous_variant 0.42 rifampicin Not assoc w R - Interim
rpoC 763921 c.552G>C synonymous_variant 0.31 rifampicin
rpoC 763924 c.555G>A synonymous_variant 0.26 rifampicin
rpoC 763930 c.561G>A synonymous_variant 0.55 rifampicin
rpoC 763933 c.564C>T synonymous_variant 0.24 rifampicin Not assoc w R - Interim
rpoC 763936 c.567C>G synonymous_variant 0.33 rifampicin
rpoC 763939 c.570G>A synonymous_variant 0.33 rifampicin
rpoC 763940 p.Ala191Ser missense_variant 0.18 rifampicin Uncertain significance
rpoC 763947 p.Ala193Val missense_variant 0.5 rifampicin Uncertain significance
rpoC 763951 c.582G>C synonymous_variant 0.22 rifampicin Not assoc w R - Interim
rpoC 763960 c.591T>C synonymous_variant 0.36 rifampicin Not assoc w R - Interim
rpoC 763966 c.597C>T synonymous_variant 0.32 rifampicin Not assoc w R - Interim
rpoC 763969 c.600C>T synonymous_variant 0.53 rifampicin Not assoc w R - Interim
rpoC 763978 c.609C>T synonymous_variant 0.21 rifampicin
rpoC 763987 c.618C>T synonymous_variant 0.31 rifampicin
rpoC 763991 p.Ile208Leu missense_variant 0.28 rifampicin
rpoC 763996 c.627T>G synonymous_variant 0.46 rifampicin Not assoc w R - Interim
rpoC 764005 c.636G>C synonymous_variant 0.57 rifampicin Not assoc w R - Interim
rpoC 764024 c.655_657delTTGinsCC frameshift_variant&missense_variant 0.34 rifampicin
rpoC 764029 p.Glu220Asp missense_variant 0.33 rifampicin
rpoC 764040 p.Ser224Thr missense_variant 0.38 rifampicin
rpoC 764044 c.675T>C synonymous_variant 0.47 rifampicin
rpoC 764059 c.690G>T synonymous_variant 0.32 rifampicin
rpoC 764071 c.702G>C synonymous_variant 0.26 rifampicin
rpoC 764083 c.714A>G synonymous_variant 0.5 rifampicin
rpoC 764084 p.Asn239Ala missense_variant 0.22 rifampicin
rpoC 764087 c.718_720delCTCinsGG frameshift_variant&missense_variant 0.29 rifampicin
rpoC 764098 c.729A>G synonymous_variant 0.5 rifampicin Not assoc w R - Interim
rpoC 764101 c.732C>G synonymous_variant 0.5 rifampicin Not assoc w R - Interim
rpoC 764102 p.Val245Gln missense_variant 0.25 rifampicin
rpoC 764140 c.771C>T synonymous_variant 0.38 rifampicin Not assoc w R - Interim
rpoC 764143 c.774G>C synonymous_variant 0.44 rifampicin Not assoc w R - Interim
rpoC 764161 c.792G>C synonymous_variant 0.23 rifampicin
rpoC 764182 p.Asp271Glu missense_variant 0.22 rifampicin Uncertain significance
rpoC 764188 c.819A>G synonymous_variant 0.6 rifampicin Not assoc w R - Interim
rpoC 764195 c.826_828delTCGinsAC frameshift_variant&missense_variant 0.18 rifampicin
rpoC 764203 c.834G>C synonymous_variant 0.51 rifampicin
rpoC 764206 c.837T>C synonymous_variant 0.38 rifampicin Not assoc w R - Interim
rpoC 764207 p.Val280Thr missense_variant 0.5 rifampicin Uncertain significance
rpoC 764213 p.Arg282Lys missense_variant 0.28 rifampicin Uncertain significance
rpoC 764217 p.Asn283Ser missense_variant 0.21 rifampicin
rpoC 764239 c.870T>G synonymous_variant 0.28 rifampicin Not assoc w R - Interim
rpoC 764248 c.879C>G synonymous_variant 0.19 rifampicin Not assoc w R - Interim
rpoC 764254 c.885G>C synonymous_variant 0.49 rifampicin
rpoC 764255 c.886_888delCTGinsTC frameshift_variant&missense_variant 0.19 rifampicin
rpoC 764263 c.894G>C synonymous_variant 0.26 rifampicin
rpoC 764266 c.897T>C synonymous_variant 0.37 rifampicin
rpoC 764272 c.903G>C synonymous_variant 0.27 rifampicin
rpoC 764278 c.909A>G synonymous_variant 0.65 rifampicin Not assoc w R - Interim
rpoC 764293 c.924G>C synonymous_variant 0.49 rifampicin Not assoc w R - Interim
rpoC 764297 p.Met310Leu missense_variant 0.38 rifampicin
rpoC 764317 c.948C>G synonymous_variant 0.32 rifampicin
rpoC 764320 c.951C>G synonymous_variant 0.29 rifampicin
rpoC 764344 c.975C>T synonymous_variant 0.55 rifampicin
rpoC 764353 c.984G>T synonymous_variant 0.46 rifampicin Not assoc w R - Interim
rpoC 764365 c.996C>T synonymous_variant 0.75 rifampicin Not assoc w R - Interim
rpoC 764371 c.1002G>C synonymous_variant 0.52 rifampicin Not assoc w R - Interim
rpoC 764380 c.1011G>C synonymous_variant 0.51 rifampicin Not assoc w R - Interim
rpoC 764387 c.1018_1020delTTGinsCC frameshift_variant&missense_variant 0.68 rifampicin
rpoC 764405 c.1036_1038delAGGinsCC frameshift_variant&missense_variant 0.71 rifampicin
rpoC 764410 c.1041G>C synonymous_variant 0.2 rifampicin
rpoC 764431 c.1062G>C synonymous_variant 0.57 rifampicin Not assoc w R - Interim
rpoC 764434 c.1065A>G synonymous_variant 0.65 rifampicin Not assoc w R - Interim
rpoC 764435 c.1066_1068delAGGinsCA frameshift_variant&missense_variant 0.65 rifampicin
rpoC 764446 c.1077T>C synonymous_variant 0.74 rifampicin
rpoC 764449 c.1080G>C synonymous_variant 0.74 rifampicin
rpoC 764458 c.1089G>C synonymous_variant 0.73 rifampicin Not assoc w R - Interim
rpoC 764461 c.1092A>G synonymous_variant 0.73 rifampicin Not assoc w R - Interim
rpoC 764485 c.1116G>C synonymous_variant 0.5 rifampicin
rpoC 764491 c.1122G>T synonymous_variant 0.53 rifampicin
rpoC 764497 c.1128A>G synonymous_variant 0.67 rifampicin Not assoc w R - Interim
rpoC 764500 c.1131C>G synonymous_variant 0.46 rifampicin
rpoC 764512 c.1143G>T synonymous_variant 0.48 rifampicin Not assoc w R - Interim
rpoC 764521 c.1152T>C synonymous_variant 0.66 rifampicin Not assoc w R - Interim
rpoC 764527 c.1158C>T synonymous_variant 0.57 rifampicin Not assoc w R - Interim
rpoC 764536 c.1167G>T synonymous_variant 0.47 rifampicin Not assoc w R - Interim
rpoC 764539 c.1170C>G synonymous_variant 0.71 rifampicin Not assoc w R - Interim
rpoC 764548 c.1179G>C synonymous_variant 0.19 rifampicin
rpoC 764566 c.1197C>G synonymous_variant 0.21 rifampicin Not assoc w R - Interim
rpoC 764575 c.1206T>G synonymous_variant 0.55 rifampicin Not assoc w R - Interim
rpoC 764605 c.1236G>C synonymous_variant 0.53 rifampicin Not assoc w R - Interim
rpoC 764611 c.1242G>T synonymous_variant 0.54 rifampicin Not assoc w R - Interim
rpoC 764623 c.1254C>G synonymous_variant 0.47 rifampicin Not assoc w R - Interim
rpoC 764626 c.1257C>T synonymous_variant 0.74 rifampicin Not assoc w R - Interim
rpoC 764632 c.1263T>C synonymous_variant 0.48 rifampicin Not assoc w R - Interim
rpoC 764650 c.1281G>T synonymous_variant 0.77 rifampicin Not assoc w R - Interim
rpoC 764668 c.1299C>T synonymous_variant 0.31 rifampicin Not assoc w R - Interim
rpoC 764701 c.1332C>G synonymous_variant 0.42 rifampicin Not assoc w R - Interim
rpoC 764713 c.1344G>T synonymous_variant 0.54 rifampicin Not assoc w R - Interim
rpoC 764716 c.1347G>C synonymous_variant 0.4 rifampicin Not assoc w R - Interim
rpoC 764746 c.1377G>T synonymous_variant 0.56 rifampicin Not assoc w R - Interim
rpoC 764752 c.1383G>C synonymous_variant 0.7 rifampicin Not assoc w R - Interim
rpoC 764758 c.1389C>G synonymous_variant 0.57 rifampicin Not assoc w R - Interim
rpoC 764764 c.1395T>C synonymous_variant 0.72 rifampicin Not assoc w R - Interim
rpoC 764791 c.1422C>G synonymous_variant 0.19 rifampicin Not assoc w R - Interim
rpoC 764803 c.1434C>T synonymous_variant 0.63 rifampicin Not assoc w R - Interim
rpoC 764809 c.1440C>T synonymous_variant 0.71 rifampicin Not assoc w R
rpoC 764815 c.1446A>G synonymous_variant 0.78 rifampicin Not assoc w R - Interim
rpoC 764817 p.Val483Gly missense_variant 0.23 rifampicin Uncertain significance
rpoC 764824 c.1455T>C synonymous_variant 0.74 rifampicin Not assoc w R - Interim
rpoC 764827 c.1458G>C synonymous_variant 0.76 rifampicin Not assoc w R - Interim
rpoC 764858 c.1489T>C synonymous_variant 0.74 rifampicin Not assoc w R - Interim
rpoC 764863 c.1494G>C synonymous_variant 0.3 rifampicin Not assoc w R - Interim
rpoC 764869 c.1500C>T synonymous_variant 0.75 rifampicin Not assoc w R - Interim
rpoC 764875 c.1506C>T synonymous_variant 0.48 rifampicin
rpoC 764878 c.1509C>G synonymous_variant 0.72 rifampicin
rpoC 764887 c.1518G>C synonymous_variant 0.68 rifampicin Not assoc w R - Interim
rpoC 764888 c.1519T>C synonymous_variant 0.68 rifampicin Not assoc w R - Interim
rpoC 764911 c.1542A>G synonymous_variant 0.63 rifampicin
rpoC 764912 p.Met515Gln missense_variant 0.62 rifampicin Uncertain significance
rpoC 764935 c.1566T>C synonymous_variant 0.45 rifampicin
rpoC 764948 c.1579T>C synonymous_variant 0.6 rifampicin Not assoc w R - Interim
rpoC 764968 c.1599T>C synonymous_variant 0.48 rifampicin Not assoc w R - Interim
rpoC 765019 c.1650A>G synonymous_variant 0.35 rifampicin Not assoc w R - Interim
rpoC 765034 c.1665T>A synonymous_variant 0.36 rifampicin Not assoc w R - Interim
rpoC 765040 c.1671T>C synonymous_variant 0.42 rifampicin Not assoc w R - Interim
rpoC 765041 c.1672T>C synonymous_variant 0.42 rifampicin Not assoc w R - Interim
rpoC 765047 c.1678T>C synonymous_variant 0.41 rifampicin Not assoc w R - Interim
rpoC 765052 c.1683C>G synonymous_variant 0.41 rifampicin Not assoc w R - Interim
rpoC 765076 c.1707A>C synonymous_variant 0.36 rifampicin Not assoc w R - Interim
rpoC 765079 c.1710T>G synonymous_variant 0.37 rifampicin Not assoc w R - Interim
rpoC 765082 c.1713G>C synonymous_variant 0.36 rifampicin Not assoc w R - Interim
rpoC 765089 c.1720T>C synonymous_variant 0.37 rifampicin Not assoc w R - Interim
rpoC 765103 c.1734G>A synonymous_variant 0.26 rifampicin Not assoc w R - Interim
rpoC 765352 c.1983G>C synonymous_variant 0.45 rifampicin Not assoc w R - Interim
rpoC 765403 c.2034G>C synonymous_variant 0.2 rifampicin
rpoC 765404 p.Leu679Thr missense_variant 0.55 rifampicin Uncertain significance
rpoC 765409 c.2040T>G synonymous_variant 0.44 rifampicin Not assoc w R - Interim
rpoC 765412 c.2043T>C synonymous_variant 0.22 rifampicin
rpoC 765425 p.Lys686Glu missense_variant 0.24 rifampicin
rpoC 765445 c.2076G>T synonymous_variant 0.52 rifampicin Not assoc w R - Interim
rpoC 765452 p.Ala695Met missense_variant 0.25 rifampicin
rpoC 765466 c.2097C>T synonymous_variant 0.25 rifampicin
rpoC 765478 c.2109T>C synonymous_variant 0.5 rifampicin Not assoc w R - Interim
rpoC 765480 p.Tyr704Phe missense_variant 0.24 rifampicin Uncertain significance
rpoC 765496 c.2127C>G synonymous_variant 0.21 rifampicin
rpoC 765499 c.2130C>G synonymous_variant 0.2 rifampicin Not assoc w R - Interim
rpoC 765508 c.2139C>G synonymous_variant 0.35 rifampicin Not assoc w R - Interim
rpoC 765526 c.2157C>G synonymous_variant 0.3 rifampicin Not assoc w R - Interim
rpoC 765547 c.2178C>G synonymous_variant 0.25 rifampicin Not assoc w R - Interim
rpoC 765548 c.2179_2181delAGCinsTCG synonymous_variant 0.33 rifampicin
rpoC 765553 c.2184C>G synonymous_variant 0.27 rifampicin
rpoC 765556 c.2187G>C synonymous_variant 0.35 rifampicin
rpoC 765559 c.2190G>C synonymous_variant 0.23 rifampicin
rpoC 765562 c.2193G>C synonymous_variant 0.35 rifampicin
rpoC 765611 p.His748Ser missense_variant 0.33 rifampicin Uncertain significance
rpoC 765625 c.2256C>G synonymous_variant 0.36 rifampicin Not assoc w R - Interim
rpoC 765628 c.2259G>C synonymous_variant 0.37 rifampicin Not assoc w R - Interim
rpoC 765655 c.2286T>C synonymous_variant 0.47 rifampicin Not assoc w R - Interim
rpoC 765658 c.2289C>T synonymous_variant 0.48 rifampicin Not assoc w R - Interim
rpoC 765662 c.2293_2295delTTGinsCC frameshift_variant&missense_variant 0.48 rifampicin
rpoC 765700 c.2331T>C synonymous_variant 0.43 rifampicin Not assoc w R - Interim
rpoC 765718 p.Asp783Glu missense_variant 0.41 rifampicin Uncertain significance
rpoC 765721 c.2352G>A synonymous_variant 0.39 rifampicin Not assoc w R - Interim
rpoC 765724 c.2355C>G synonymous_variant 0.39 rifampicin Not assoc w R - Interim
rpoC 765734 c.2365T>C synonymous_variant 0.41 rifampicin Not assoc w R - Interim
rpoC 765739 c.2370G>T synonymous_variant 0.4 rifampicin
rpoC 765742 p.Glu791Asp missense_variant 0.4 rifampicin Uncertain significance
rpoC 765751 c.2382C>G synonymous_variant 0.38 rifampicin
rpoC 765753 p.Asp795Ala missense_variant 0.4 rifampicin Uncertain significance
rpoC 765787 c.2418C>T synonymous_variant 0.32 rifampicin
rpoC 765790 c.2421C>G synonymous_variant 0.27 rifampicin
rpoC 765793 c.2424C>G synonymous_variant 0.58 rifampicin
rpoC 765796 c.2427C>T synonymous_variant 0.58 rifampicin
rpoC 765800 p.Phe811Leu missense_variant 0.3 rifampicin
rpoC 765811 c.2442T>G synonymous_variant 0.48 rifampicin
rpoC 765814 c.2445A>C synonymous_variant 0.52 rifampicin
rpoC 765817 c.2448G>C synonymous_variant 0.38 rifampicin
rpoC 765823 c.2454C>A synonymous_variant 0.41 rifampicin Not assoc w R - Interim
rpoC 765826 c.2457T>C synonymous_variant 0.66 rifampicin Not assoc w R - Interim
rpoC 765835 c.2466C>T synonymous_variant 0.72 rifampicin Not assoc w R - Interim
rpoC 765850 c.2481G>C synonymous_variant 0.2 rifampicin Not assoc w R - Interim
rpoC 765871 c.2502T>C synonymous_variant 0.63 rifampicin
rpoC 765875 p.Val836Ile missense_variant 0.73 rifampicin Uncertain significance
rpoC 765886 c.2517C>G synonymous_variant 0.54 rifampicin
rpoC 765892 c.2523T>C synonymous_variant 0.2 rifampicin Not assoc w R - Interim
rpoC 765904 c.2535C>G synonymous_variant 0.74 rifampicin Not assoc w R - Interim
rpoC 765908 c.2539C>T synonymous_variant 0.51 rifampicin
rpoC 765934 c.2565C>T synonymous_variant 0.43 rifampicin
rpoC 765937 c.2568T>C synonymous_variant 0.27 rifampicin Not assoc w R - Interim
rpoC 765940 c.2571A>T synonymous_variant 0.39 rifampicin Not assoc w R - Interim
rpoC 765946 c.2577C>T synonymous_variant 0.33 rifampicin
rpoC 765947 c.2578T>C synonymous_variant 0.33 rifampicin Not assoc w R - Interim
rpoC 765952 c.2583G>C synonymous_variant 0.32 rifampicin
rpoC 765961 c.2592G>T synonymous_variant 0.39 rifampicin
rpoC 765962 c.2593T>C synonymous_variant 0.37 rifampicin
rpoC 765967 c.2598C>T synonymous_variant 0.57 rifampicin Not assoc w R - Interim
rpoC 765979 c.2610C>G synonymous_variant 0.53 rifampicin Not assoc w R - Interim
rpoC 765982 c.2613C>T synonymous_variant 0.52 rifampicin Not assoc w R - Interim
rpoC 765994 c.2625A>T synonymous_variant 0.52 rifampicin Not assoc w R - Interim
rpoC 766009 c.2640G>C synonymous_variant 0.3 rifampicin Not assoc w R - Interim
rpoC 766012 c.2643C>G synonymous_variant 0.48 rifampicin Not assoc w R - Interim
rpoC 766043 p.Gln892Gly missense_variant 0.34 rifampicin
rpoC 766061 p.Val898Ile missense_variant 0.31 rifampicin
rpoC 766309 c.2940G>C synonymous_variant 0.51 rifampicin Not assoc w R - Interim
rpoC 766315 c.2946C>G synonymous_variant 0.53 rifampicin
rpoC 766345 c.2976T>C synonymous_variant 0.58 rifampicin
rpoC 766348 c.2979A>G synonymous_variant 0.65 rifampicin Not assoc w R - Interim
rpoC 766351 c.2982C>T synonymous_variant 0.3 rifampicin Not assoc w R - Interim
rpoC 766363 c.2994G>C synonymous_variant 0.67 rifampicin
rpoC 766366 c.2997C>G synonymous_variant 0.34 rifampicin
rpoC 766381 c.3012C>T synonymous_variant 0.63 rifampicin
rpoC 766384 c.3015A>G synonymous_variant 0.62 rifampicin
rpoC 766387 c.3018C>G synonymous_variant 0.28 rifampicin Not assoc w R - Interim
rpoC 766390 c.3021C>T synonymous_variant 0.64 rifampicin
rpoC 766408 c.3039C>T synonymous_variant 0.25 rifampicin Not assoc w R - Interim
rpoC 766426 c.3057C>T synonymous_variant 0.4 rifampicin
rpoC 766447 c.3078T>C synonymous_variant 0.27 rifampicin
rpoC 766456 c.3087C>G synonymous_variant 0.35 rifampicin
rpoC 766483 c.3114G>C synonymous_variant 0.24 rifampicin
rpoC 766484 c.3115_3117delGTAinsAC frameshift_variant&missense_variant 0.41 rifampicin
rpoC 766492 c.3123T>C synonymous_variant 0.23 rifampicin
rpoC 766495 c.3126C>T synonymous_variant 0.2 rifampicin Not assoc w R - Interim
rpoC 766517 p.Thr1050Ala missense_variant 0.43 rifampicin
rpoC 766522 c.3153C>A synonymous_variant 0.32 rifampicin
rpoC 766528 c.3159T>G synonymous_variant 0.42 rifampicin
rpoC 766530 p.Arg1054Gln missense_variant 0.43 rifampicin
rpoC 766537 c.3168G>A synonymous_variant 0.46 rifampicin
rpoC 766540 p.Asp1057Glu missense_variant 0.44 rifampicin
rpoC 766547 p.Arg1060Lys missense_variant 0.5 rifampicin
rpoC 766564 c.3195C>G synonymous_variant 0.46 rifampicin
rpoC 766570 c.3201T>G synonymous_variant 0.4 rifampicin
rpoC 766573 c.3204T>G synonymous_variant 0.38 rifampicin Not assoc w R - Interim
rpoC 766585 c.3216T>C synonymous_variant 0.46 rifampicin
rpoC 766607 c.3238_3240delATCinsTG frameshift_variant&missense_variant 0.5 rifampicin
rpoC 766610 p.Ser1081Pro missense_variant 0.52 rifampicin
rpoC 766618 c.3249G>T synonymous_variant 0.56 rifampicin
rpoC 766645 c.3276A>G synonymous_variant 0.43 rifampicin
rpoC 766651 c.3282T>C synonymous_variant 0.46 rifampicin
rpoC 766657 c.3288A>G synonymous_variant 0.42 rifampicin
rpoC 766661 p.Val1098Leu missense_variant 0.35 rifampicin
rpoC 766666 c.3297C>G synonymous_variant 0.44 rifampicin
rpoC 766672 c.3303T>C synonymous_variant 0.36 rifampicin
rpoC 766690 c.3321G>C synonymous_variant 0.31 rifampicin
rpoC 766714 c.3345G>C synonymous_variant 0.29 rifampicin
rpoC 766717 c.3348C>G synonymous_variant 0.32 rifampicin
rpoC 766720 c.3351C>T synonymous_variant 0.31 rifampicin
rpoC 766726 c.3357T>C synonymous_variant 0.49 rifampicin
rpoC 766738 c.3369G>T synonymous_variant 0.53 rifampicin
rpoC 766741 c.3372G>C synonymous_variant 0.4 rifampicin
rpoC 766765 c.3396A>C synonymous_variant 0.52 rifampicin Not assoc w R - Interim
rpoC 766771 c.3402G>C synonymous_variant 0.37 rifampicin
rpoC 766774 c.3405T>C synonymous_variant 0.54 rifampicin
rpoC 766775 p.Arg1136Lys missense_variant 0.54 rifampicin
rpoC 766787 p.Glu1140Gln missense_variant 0.29 rifampicin Uncertain significance
rpoC 766798 c.3429C>G synonymous_variant 0.65 rifampicin Not assoc w R - Interim
rpoC 766804 c.3435A>G synonymous_variant 0.52 rifampicin Not assoc w R - Interim
rpoC 766807 c.3438T>C synonymous_variant 0.5 rifampicin Not assoc w R - Interim
rpoC 766843 c.3474T>C synonymous_variant 0.4 rifampicin Not assoc w R - Interim
rpoC 766846 c.3477C>G synonymous_variant 0.4 rifampicin Not assoc w R - Interim
rpoC 766931 c.3562_3564delGCAinsAC frameshift_variant&missense_variant 0.24 rifampicin
rpoC 766942 c.3573C>T synonymous_variant 0.2 rifampicin Not assoc w R - Interim
rpoC 766963 c.3594T>C synonymous_variant 0.48 rifampicin Not assoc w R - Interim
rpoC 766981 c.3612T>C synonymous_variant 0.38 rifampicin
rpoC 766996 c.3627C>T synonymous_variant 0.65 rifampicin Not assoc w R - Interim
rpoC 767002 c.3633G>C synonymous_variant 0.66 rifampicin Not assoc w R - Interim
rpoC 767008 c.3639G>A synonymous_variant 0.42 rifampicin Not assoc w R - Interim
rpoC 767020 c.3651C>G synonymous_variant 0.44 rifampicin Not assoc w R - Interim
rpoC 767032 c.3663G>T synonymous_variant 0.2 rifampicin Not assoc w R - Interim
rpoC 767035 c.3666G>C synonymous_variant 0.21 rifampicin Not assoc w R - Interim
rpoC 767059 c.3690T>G synonymous_variant 0.27 rifampicin Not assoc w R - Interim
rpoC 767098 c.3729T>C synonymous_variant 0.61 rifampicin Not assoc w R - Interim
rpoC 767104 c.3735C>G synonymous_variant 0.6 rifampicin Not assoc w R - Interim
rpoC 767105 c.3736_3738delAACinsCG frameshift_variant&missense_variant 0.61 rifampicin
rpoC 767119 c.3750A>G synonymous_variant 0.62 rifampicin Not assoc w R - Interim
rpoC 767134 c.3765C>T synonymous_variant 0.47 rifampicin Not assoc w R - Interim
rpoC 767138 c.3769C>T synonymous_variant 0.43 rifampicin Not assoc w R - Interim
rpoC 767152 c.3783T>C synonymous_variant 0.2 rifampicin Not assoc w R - Interim
rpoC 767158 c.3789T>C synonymous_variant 0.65 rifampicin Not assoc w R - Interim
rpoC 767162 p.Asn1265Ala missense_variant 0.36 rifampicin
rpoC 767167 c.3798C>T synonymous_variant 0.5 rifampicin
rpoC 767174 p.Asn1269Asp missense_variant 0.37 rifampicin
rpoC 767180 p.Ala1271Gln missense_variant 0.38 rifampicin
rpoC 767191 c.3822C>G synonymous_variant 0.56 rifampicin Not assoc w R - Interim
rpoC 767197 c.3828G>A synonymous_variant 0.5 rifampicin Not assoc w R - Interim
rpoC 767206 c.3837C>G synonymous_variant 0.29 rifampicin Not assoc w R - Interim
rpoC 767209 c.3840T>C synonymous_variant 0.3 rifampicin Not assoc w R - Interim
rpoC 767212 c.3843G>T synonymous_variant 0.29 rifampicin
rpoC 767221 c.3852C>G synonymous_variant 0.75 rifampicin Not assoc w R - Interim
rpoC 767230 c.3861G>C synonymous_variant 0.73 rifampicin Not assoc w R - Interim
rpoC 767233 c.3864T>C synonymous_variant 0.73 rifampicin Not assoc w R - Interim
rpoC 767263 c.3894T>C synonymous_variant 0.66 rifampicin Not assoc w R - Interim
rpoC 767264 p.Ala1299Gln missense_variant 0.38 rifampicin
rpoC 767278 c.3909T>C synonymous_variant 0.6 rifampicin
rpoC 767281 c.3912C>G synonymous_variant 0.6 rifampicin Not assoc w R - Interim
rpoC 767284 c.3915C>G synonymous_variant 0.53 rifampicin Not assoc w R - Interim
rpoC 767296 c.3927C>T synonymous_variant 0.35 rifampicin Not assoc w R - Interim
rpoC 767302 c.3933C>A synonymous_variant 0.29 rifampicin
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mmpL5 775856 c.2625T>C synonymous_variant 0.46 clofazimine
bedaquiline
mmpL5 775865 c.2616T>C synonymous_variant 0.41 clofazimine
bedaquiline
mmpL5 775877 c.2604C>G synonymous_variant 0.36 clofazimine
bedaquiline
mmpL5 775883 c.2596_2598delATCinsTG frameshift_variant&missense_variant 0.39 clofazimine Uncertain significance
bedaquiline Uncertain significance
mmpL5 775886 c.2595A>C synonymous_variant 0.45 clofazimine
bedaquiline
mmpL5 775892 c.2589C>T synonymous_variant 0.41 clofazimine
bedaquiline
mmpL5 775904 c.2577G>A synonymous_variant 0.5 clofazimine
bedaquiline
mmpL5 775909 p.Leu858Phe missense_variant 0.49 clofazimine
bedaquiline
mmpL5 775915 p.Ala856Ser missense_variant 0.48 clofazimine
bedaquiline
mmpL5 775916 c.2565T>C synonymous_variant 0.5 clofazimine
bedaquiline
mmpL5 775921 c.2560C>T synonymous_variant 0.28 clofazimine
bedaquiline
mmpL5 775924 c.2557C>T synonymous_variant 0.28 clofazimine Not assoc w R - Interim
bedaquiline
mmpL5 775951 c.2530C>T synonymous_variant 0.49 clofazimine
bedaquiline
mmpL5 775966 p.Ala839Ser missense_variant 0.42 clofazimine
bedaquiline
mmpL5 775970 c.2511G>C synonymous_variant 0.37 clofazimine
bedaquiline
mmpL5 775975 c.2506T>C synonymous_variant 0.42 clofazimine
bedaquiline
mmpL5 775981 p.Leu834Met missense_variant 0.48 clofazimine
bedaquiline
mmpL5 775994 c.2485_2487delATCinsCG frameshift_variant&missense_variant 0.34 clofazimine Uncertain significance
bedaquiline Uncertain significance
mmpL5 775997 c.2484T>G synonymous_variant 0.34 clofazimine
bedaquiline
mmpL5 776000 c.2479_2481delCTGinsAC frameshift_variant&missense_variant 0.34 clofazimine Uncertain significance
bedaquiline Uncertain significance
mmpL5 776005 p.Ile826Leu missense_variant 0.32 clofazimine
bedaquiline
mmpL5 776009 c.2472A>G synonymous_variant 0.37 clofazimine
bedaquiline
mmpL5 776030 c.2451G>C synonymous_variant 0.47 clofazimine
bedaquiline
mmpL5 776045 c.2436G>C synonymous_variant 0.47 clofazimine
bedaquiline
mmpL5 776053 c.2428T>C synonymous_variant 0.45 clofazimine
bedaquiline
mmpL5 776075 c.2406C>G synonymous_variant 0.33 clofazimine
bedaquiline
mmpL5 776081 c.2400G>C synonymous_variant 0.43 clofazimine
bedaquiline
mmpL5 776084 c.2397C>G synonymous_variant 0.4 clofazimine
bedaquiline
mmpL5 776087 c.2394C>G synonymous_variant 0.42 clofazimine
bedaquiline
mmpL5 776099 p.Thr794Leu missense_variant 0.25 clofazimine
bedaquiline
mmpL5 776120 c.2361C>T synonymous_variant 0.28 clofazimine
bedaquiline
mmpL5 776182 p.Asp767Asn missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R
mmpS5 779615 c.-710C>G upstream_gene_variant 1.0 clofazimine
bedaquiline
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rpsL 781572 c.13_15delCAGinsAC frameshift_variant&missense_variant 0.19 streptomycin Uncertain significance
rpsL 781595 c.36T>C synonymous_variant 0.46 streptomycin
rpsL 781598 c.39G>C synonymous_variant 0.45 streptomycin
rpsL 781605 p.Ile16Val missense_variant 0.26 streptomycin Uncertain significance
rpsL 781608 p.Ser17Ala missense_variant 0.42 streptomycin
rpsL 781628 c.69T>C synonymous_variant 0.5 streptomycin Not assoc w R - Interim
rpsL 781631 c.72G>C synonymous_variant 0.52 streptomycin
rpsL 781649 c.90T>C synonymous_variant 0.35 streptomycin
rpsL 781655 c.96T>C synonymous_variant 0.49 streptomycin
rpsL 781658 c.99A>G synonymous_variant 0.46 streptomycin
rpsL 781682 c.123T>C synonymous_variant 0.43 streptomycin
rpsL 781709 c.150G>C synonymous_variant 0.59 streptomycin Not assoc w R - Interim
rpsL 781715 c.156T>G synonymous_variant 0.47 streptomycin
rpsL 781724 c.165G>C synonymous_variant 0.31 streptomycin
rpsL 781728 c.169T>C synonymous_variant 0.52 streptomycin
rpsL 781748 c.189C>G synonymous_variant 0.32 streptomycin
rpsL 781751 c.192G>C synonymous_variant 0.5 streptomycin
rpsL 781754 c.195G>C synonymous_variant 0.29 streptomycin
rpsL 781760 c.201T>C synonymous_variant 0.59 streptomycin
rpsL 781763 c.204C>G synonymous_variant 0.28 streptomycin
rpsL 781772 c.213C>T synonymous_variant 0.36 streptomycin Not assoc w R - Interim
rpsL 781808 c.249C>T synonymous_variant 0.6 streptomycin
rpsL 781811 c.252C>T synonymous_variant 0.21 streptomycin
rpsL 781814 c.255C>T synonymous_variant 0.42 streptomycin
rpsL 781817 c.258G>T synonymous_variant 0.42 streptomycin
rpsL 781829 c.270G>C synonymous_variant 0.39 streptomycin
rpsL 781832 c.273T>C synonymous_variant 0.54 streptomycin
rpsL 781838 c.279G>C synonymous_variant 0.37 streptomycin
rpsL 781841 c.282C>T synonymous_variant 0.36 streptomycin
rpsL 781859 c.300T>G synonymous_variant 0.46 streptomycin
rpsL 781865 c.306G>C synonymous_variant 0.3 streptomycin
rpsL 781868 c.309T>C synonymous_variant 0.57 streptomycin
rpsL 781871 c.312G>C synonymous_variant 0.58 streptomycin
rpsL 781877 c.318T>G synonymous_variant 0.21 streptomycin
rpsL 781892 c.333A>G synonymous_variant 0.62 streptomycin
rpsL 781898 c.339A>C synonymous_variant 0.62 streptomycin
rpsL 781901 c.342C>T synonymous_variant 0.33 streptomycin
rpsL 781904 c.345C>T synonymous_variant 0.18 streptomycin Not assoc w R - Interim
rpsL 781907 c.348T>C synonymous_variant 0.55 streptomycin
rpsL 781916 c.357T>C synonymous_variant 0.55 streptomycin
rpsL 781929 p.Gly124Ser missense_variant 0.56 streptomycin Uncertain significance
rplC 800516 c.-293G>C upstream_gene_variant 0.42 linezolid
rplC 800543 c.-266C>T upstream_gene_variant 0.33 linezolid
rplC 800546 c.-263T>C upstream_gene_variant 0.48 linezolid
rplC 800558 c.-251G>A upstream_gene_variant 0.17 linezolid
rplC 800570 c.-239C>G upstream_gene_variant 0.48 linezolid
rplC 800574 c.-235_-234delGTinsAC upstream_gene_variant 0.5 linezolid
rplC 800579 c.-230C>T upstream_gene_variant 0.33 linezolid
rplC 800594 c.-215C>G upstream_gene_variant 0.47 linezolid
rplC 800597 c.-212A>G upstream_gene_variant 0.43 linezolid
rplC 800600 c.-209G>C upstream_gene_variant 0.38 linezolid
rplC 800603 c.-206G>C upstream_gene_variant 0.31 linezolid
rplC 800612 c.-197A>G upstream_gene_variant 0.48 linezolid
rplC 800618 c.-191T>C upstream_gene_variant 0.54 linezolid
rplC 800633 c.-176T>C upstream_gene_variant 0.3 linezolid
rplC 800645 c.-164C>G upstream_gene_variant 0.59 linezolid
rplC 800648 c.-161A>G upstream_gene_variant 0.42 linezolid
rplC 800654 c.-155T>C upstream_gene_variant 0.59 linezolid
rplC 800678 c.-131C>T upstream_gene_variant 0.27 linezolid
rplC 800684 c.-125G>A upstream_gene_variant 0.29 linezolid
rplC 800693 c.-116A>C upstream_gene_variant 0.63 linezolid
rplC 800702 c.-107G>A upstream_gene_variant 0.47 linezolid
rplC 800703 c.-106T>C upstream_gene_variant 0.63 linezolid
rplC 800715 c.-94A>C upstream_gene_variant 0.62 linezolid
rplC 800720 c.-89T>C upstream_gene_variant 0.35 linezolid
rplC 800723 c.-86C>G upstream_gene_variant 0.33 linezolid
rplC 800735 c.-74C>G upstream_gene_variant 0.32 linezolid
rplC 800762 c.-47T>G upstream_gene_variant 0.36 linezolid
rplC 800771 c.-38C>T upstream_gene_variant 0.24 linezolid
rplC 800916 c.108A>G synonymous_variant 0.29 linezolid
rplC 800931 c.123G>C synonymous_variant 0.33 linezolid
rplC 800937 c.129A>G synonymous_variant 0.34 linezolid
rplC 800946 c.138T>C synonymous_variant 0.35 linezolid
rplC 800949 c.141T>C synonymous_variant 0.36 linezolid
rplC 800951 p.Ser48Thr missense_variant 0.19 linezolid
rplC 800964 c.156G>C synonymous_variant 0.43 linezolid
rplC 800967 c.159C>T synonymous_variant 0.24 linezolid
rplC 800970 c.162T>C synonymous_variant 0.26 linezolid Not assoc w R - Interim
rplC 800985 c.177A>G synonymous_variant 0.57 linezolid
rplC 801006 c.198G>C synonymous_variant 0.25 linezolid
rplC 801009 c.201A>C synonymous_variant 0.24 linezolid
rplC 801153 c.345G>C synonymous_variant 0.31 linezolid
rplC 801171 c.363A>G synonymous_variant 0.38 linezolid
rplC 801174 c.366T>C synonymous_variant 0.38 linezolid
Rv1129c 1254562 c.-28T>C upstream_gene_variant 1.0 moxifloxacin Not assoc w R
levofloxacin Not assoc w R
rifampicin Not assoc w R
isoniazid Not assoc w R
fbiC 1303545 c.615A>G synonymous_variant 0.41 clofazimine
pretomanid
delamanid
fbiC 1303581 c.651G>C synonymous_variant 0.47 clofazimine
pretomanid
delamanid
fbiC 1303584 c.654C>G synonymous_variant 0.26 clofazimine
pretomanid
delamanid
fbiC 1303587 c.657G>C synonymous_variant 0.21 clofazimine
pretomanid
delamanid
fbiC 1303590 c.660A>G synonymous_variant 0.49 clofazimine
pretomanid
delamanid
fbiC 1303602 c.672A>G synonymous_variant 0.41 clofazimine
pretomanid
delamanid
fbiC 1303611 c.681G>C synonymous_variant 0.31 clofazimine
pretomanid
delamanid
fbiC 1303617 c.687C>G synonymous_variant 0.33 clofazimine
pretomanid
delamanid
fbiC 1303632 c.702T>C synonymous_variant 0.35 clofazimine
pretomanid
delamanid
fbiC 1303638 c.708A>G synonymous_variant 0.24 clofazimine
pretomanid
delamanid
fbiC 1303659 c.729T>C synonymous_variant 0.27 clofazimine
pretomanid
delamanid
fbiC 1303660 p.Val244Thr missense_variant 0.23 clofazimine
pretomanid
delamanid
fbiC 1303666 p.Thr246Asp missense_variant 0.24 clofazimine
pretomanid
delamanid
fbiC 1303681 c.751T>C synonymous_variant 0.27 clofazimine
pretomanid
delamanid
fbiC 1303689 c.759T>C synonymous_variant 0.29 clofazimine
pretomanid
delamanid
fbiC 1303695 c.765T>C synonymous_variant 0.29 clofazimine
pretomanid
delamanid
fbiC 1303704 c.774T>C synonymous_variant 0.28 clofazimine
pretomanid
delamanid
fbiC 1303708 c.778T>C synonymous_variant 0.28 clofazimine
pretomanid
delamanid
fbiC 1303716 c.786C>G synonymous_variant 0.27 clofazimine
pretomanid
delamanid
fbiC 1304499 c.1569T>G synonymous_variant 0.3 clofazimine Not assoc w R - Interim
pretomanid
delamanid
fbiC 1304508 p.Glu526Asp missense_variant 0.3 clofazimine
pretomanid
delamanid
fbiC 1304520 c.1590A>C synonymous_variant 0.33 clofazimine
pretomanid
delamanid
fbiC 1304526 c.1596T>G synonymous_variant 0.35 clofazimine
pretomanid
delamanid
fbiC 1304533 c.1603T>C synonymous_variant 0.4 clofazimine
pretomanid
delamanid
fbiC 1304559 p.Glu543Asp missense_variant 0.49 clofazimine
pretomanid
delamanid
fbiC 1304562 c.1632G>C synonymous_variant 0.43 clofazimine
pretomanid
delamanid
fbiC 1304567 p.Phe546Tyr missense_variant 0.46 clofazimine
pretomanid
delamanid
fbiC 1304571 c.1641G>C synonymous_variant 0.43 clofazimine
pretomanid
delamanid
fbiC 1304580 c.1650T>C synonymous_variant 0.47 clofazimine
pretomanid
delamanid
fbiC 1304613 c.1683T>C synonymous_variant 0.42 clofazimine
pretomanid
delamanid
fbiC 1304628 c.1698G>T synonymous_variant 0.29 clofazimine
pretomanid
delamanid
fbiC 1304634 c.1704C>G synonymous_variant 0.25 clofazimine
pretomanid
delamanid
fbiC 1305360 c.2430G>C synonymous_variant 0.34 clofazimine
pretomanid
delamanid
fbiC 1305361 c.2431C>T synonymous_variant 0.42 clofazimine
pretomanid
delamanid
fbiC 1305381 c.2451G>C synonymous_variant 0.35 clofazimine
pretomanid
delamanid
fbiC 1305393 c.2463T>C synonymous_variant 0.38 clofazimine
pretomanid
delamanid
fbiC 1305399 c.2469A>G synonymous_variant 0.5 clofazimine
pretomanid
delamanid
fbiC 1305405 c.2475A>G synonymous_variant 0.33 clofazimine Not assoc w R - Interim
pretomanid
delamanid
fbiC 1305418 p.Val830Ile missense_variant 0.32 clofazimine
pretomanid
delamanid
fbiC 1305423 c.2493T>C synonymous_variant 0.29 clofazimine
pretomanid
delamanid
fbiC 1305444 c.2514A>G synonymous_variant 0.29 clofazimine
pretomanid
delamanid
sigE 1364709 c.297T>C synonymous_variant 0.4 pyrazinamide
sigE 1364712 c.300T>C synonymous_variant 0.48 pyrazinamide
sigE 1364721 c.309C>G synonymous_variant 0.42 pyrazinamide
sigE 1364724 c.312C>T synonymous_variant 0.4 pyrazinamide
sigE 1364736 c.324T>C synonymous_variant 0.44 pyrazinamide Not assoc w R - Interim
sigE 1364742 c.330A>G synonymous_variant 0.47 pyrazinamide
sigE 1364763 c.351T>C synonymous_variant 0.46 pyrazinamide
sigE 1364767 c.355A>C synonymous_variant 0.45 pyrazinamide
sigE 1364778 c.366G>C synonymous_variant 0.34 pyrazinamide
sigE 1364781 c.369G>C synonymous_variant 0.34 pyrazinamide
sigE 1364784 c.372C>G synonymous_variant 0.33 pyrazinamide
sigE 1364790 c.378T>C synonymous_variant 0.31 pyrazinamide
sigE 1364796 c.384G>A synonymous_variant 0.29 pyrazinamide
sigE 1364799 c.387G>C synonymous_variant 0.29 pyrazinamide
sigE 1364802 c.390C>A synonymous_variant 0.29 pyrazinamide
sigE 1364811 c.399A>G synonymous_variant 0.24 pyrazinamide
sigE 1364820 c.408A>G synonymous_variant 0.24 pyrazinamide
sigE 1364839 c.427T>C synonymous_variant 0.34 pyrazinamide
sigE 1364865 c.453G>C synonymous_variant 0.43 pyrazinamide
sigE 1364867 p.Ala152Gly missense_variant 0.47 pyrazinamide
sigE 1364871 c.459C>T synonymous_variant 0.43 pyrazinamide
sigE 1364883 c.471G>A synonymous_variant 0.54 pyrazinamide
sigE 1364887 c.475_477delTTAinsCG frameshift_variant&missense_variant 0.57 pyrazinamide Uncertain significance
sigE 1364898 c.486C>T synonymous_variant 0.59 pyrazinamide
sigE 1364919 c.507T>C synonymous_variant 0.51 pyrazinamide
sigE 1364922 p.Glu170Asp missense_variant 0.49 pyrazinamide
sigE 1364925 c.513C>G synonymous_variant 0.47 pyrazinamide
sigE 1364931 c.519C>T synonymous_variant 0.46 pyrazinamide
sigE 1364950 c.538_540delGCAinsTG frameshift_variant&stop_gained 0.34 pyrazinamide Uncertain significance
sigE 1364962 c.550_552delCCTinsGC frameshift_variant&missense_variant 0.3 pyrazinamide Uncertain significance
Rv1258c 1406760 c.580_581insC frameshift_variant 1.0 streptomycin Uncertain significance
isoniazid Uncertain significance
pyrazinamide Uncertain significance
atpE 1461182 c.138A>G synonymous_variant 0.28 bedaquiline
atpE 1461185 c.141G>C synonymous_variant 0.29 bedaquiline
atpE 1461197 c.153A>C synonymous_variant 0.33 bedaquiline
atpE 1461219 c.175T>C synonymous_variant 0.3 bedaquiline
atpE 1461254 c.210T>C synonymous_variant 0.3 bedaquiline
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrs 1471922 n.78delT non_coding_transcript_exon_variant 0.56 streptomycin
kanamycin
capreomycin
amikacin
rrs 1471925 n.80T>C non_coding_transcript_exon_variant 0.69 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1471926 n.81C>T non_coding_transcript_exon_variant 0.27 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1471931 n.87delA non_coding_transcript_exon_variant 0.56 streptomycin
kanamycin
capreomycin
amikacin
rrs 1471934 n.89A>G non_coding_transcript_exon_variant 0.67 streptomycin Uncertain significance
kanamycin
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1471986 n.141C>T non_coding_transcript_exon_variant 0.71 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472019 n.174G>A non_coding_transcript_exon_variant 0.42 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472023 n.178G>T non_coding_transcript_exon_variant 0.39 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472029 n.184C>T non_coding_transcript_exon_variant 0.31 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472031 n.186G>C non_coding_transcript_exon_variant 0.36 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472033 n.188A>C non_coding_transcript_exon_variant 0.35 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472035 n.190G>T non_coding_transcript_exon_variant 0.35 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472040 n.195T>G non_coding_transcript_exon_variant 0.35 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472041 n.196C>T non_coding_transcript_exon_variant 0.65 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472042 n.197T>G non_coding_transcript_exon_variant 0.51 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472053 n.211_212delGC non_coding_transcript_exon_variant 0.63 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472061 n.216A>T non_coding_transcript_exon_variant 0.69 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472075 n.230A>G non_coding_transcript_exon_variant 0.7 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472106 n.261G>A non_coding_transcript_exon_variant 0.38 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Not assoc w R
rrs 1472108 n.263C>T non_coding_transcript_exon_variant 0.71 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472150 n.305T>A non_coding_transcript_exon_variant 0.57 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472251 n.406G>A non_coding_transcript_exon_variant 0.37 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Not assoc w R
amikacin Not assoc w R
rrs 1472286 n.441C>G non_coding_transcript_exon_variant 0.37 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472287 n.442C>T non_coding_transcript_exon_variant 0.37 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472292 n.447A>G non_coding_transcript_exon_variant 0.38 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472298 n.453G>C non_coding_transcript_exon_variant 0.32 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472314 n.469A>G non_coding_transcript_exon_variant 0.33 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472315 n.470T>G non_coding_transcript_exon_variant 0.33 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472327 n.482G>A non_coding_transcript_exon_variant 0.5 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472328 n.483G>C non_coding_transcript_exon_variant 0.48 streptomycin Uncertain significance
kanamycin
capreomycin
amikacin
rrs 1472380 n.535G>C non_coding_transcript_exon_variant 0.33 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472446 n.601T>A non_coding_transcript_exon_variant 0.82 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472452 n.607G>A non_coding_transcript_exon_variant 0.8 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472464 n.619A>G non_coding_transcript_exon_variant 0.81 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472489 n.644A>G non_coding_transcript_exon_variant 0.34 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472498 n.653C>T non_coding_transcript_exon_variant 0.35 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472683 n.838_839insTA non_coding_transcript_exon_variant 0.3 streptomycin
kanamycin
capreomycin
amikacin
rrs 1472846 n.1001C>A non_coding_transcript_exon_variant 0.36 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472847 n.1002G>C non_coding_transcript_exon_variant 0.47 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472849 n.1004C>G non_coding_transcript_exon_variant 0.47 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472850 n.1005T>C non_coding_transcript_exon_variant 0.36 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472857 n.1012A>G non_coding_transcript_exon_variant 0.36 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472858 n.1013G>T non_coding_transcript_exon_variant 0.48 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472860 n.1015C>G non_coding_transcript_exon_variant 0.47 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472861 n.1016G>T non_coding_transcript_exon_variant 0.37 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472973 n.1128A>G non_coding_transcript_exon_variant 0.26 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1472973 n.1128A>T non_coding_transcript_exon_variant 0.59 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473100 n.1255G>C non_coding_transcript_exon_variant 0.17 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473104 n.1259C>T non_coding_transcript_exon_variant 0.72 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473109 n.1264T>G non_coding_transcript_exon_variant 0.18 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473110 n.1265T>G non_coding_transcript_exon_variant 0.53 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473111 n.1266A>G non_coding_transcript_exon_variant 0.65 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473123 n.1278delAinsTC non_coding_transcript_exon_variant 0.68 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473145 n.1300C>T non_coding_transcript_exon_variant 0.24 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473166 n.1321G>A non_coding_transcript_exon_variant 0.26 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473276 n.1431A>G non_coding_transcript_exon_variant 0.72 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473290 n.1445C>T non_coding_transcript_exon_variant 0.67 streptomycin
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrs 1473291 n.1446_1447insT non_coding_transcript_exon_variant 0.56 streptomycin
kanamycin
capreomycin
amikacin
rrs 1473301 n.1456T>C non_coding_transcript_exon_variant 0.71 streptomycin Uncertain significance
kanamycin Uncertain significance
capreomycin Uncertain significance
amikacin Uncertain significance
rrl 1473668 n.11C>G non_coding_transcript_exon_variant 0.36 capreomycin
linezolid
rrl 1473696 n.39T>C non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid
rrl 1473697 n.40C>T non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid
rrl 1473699 n.42A>G non_coding_transcript_exon_variant 0.27 capreomycin Uncertain significance
linezolid
rrl 1473717 n.60G>T non_coding_transcript_exon_variant 0.37 capreomycin Uncertain significance
linezolid
rrl 1473746 n.89T>C non_coding_transcript_exon_variant 0.44 capreomycin Uncertain significance
linezolid
rrl 1473758 n.101G>T non_coding_transcript_exon_variant 0.4 capreomycin Uncertain significance
linezolid
rrl 1473770 n.113T>G non_coding_transcript_exon_variant 0.63 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473788 n.131A>G non_coding_transcript_exon_variant 0.55 capreomycin Uncertain significance
linezolid
rrl 1473806 n.149C>T non_coding_transcript_exon_variant 0.32 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473807 n.150T>C non_coding_transcript_exon_variant 0.32 capreomycin Uncertain significance
linezolid
rrl 1473887 n.230delTinsAA non_coding_transcript_exon_variant 0.58 capreomycin Uncertain significance
linezolid
rrl 1473898 n.241C>T non_coding_transcript_exon_variant 0.6 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473899 n.242A>G non_coding_transcript_exon_variant 0.6 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473916 n.259C>A non_coding_transcript_exon_variant 0.53 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473922 n.265A>G non_coding_transcript_exon_variant 0.5 capreomycin
linezolid
rrl 1473923 n.266C>G non_coding_transcript_exon_variant 0.53 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1473924 n.267_268insT non_coding_transcript_exon_variant 0.53 capreomycin
linezolid
rrl 1473935 n.278C>T non_coding_transcript_exon_variant 0.44 capreomycin
linezolid
rrl 1473937 n.280C>T non_coding_transcript_exon_variant 0.44 capreomycin Uncertain significance
linezolid
rrl 1473943 n.286G>T non_coding_transcript_exon_variant 0.44 capreomycin Uncertain significance
linezolid
rrl 1473945 n.288T>A non_coding_transcript_exon_variant 0.44 capreomycin Uncertain significance
linezolid
rrl 1473946 n.289A>T non_coding_transcript_exon_variant 0.41 capreomycin Uncertain significance
linezolid
rrl 1474135 n.478G>A non_coding_transcript_exon_variant 0.41 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474140 n.483C>T non_coding_transcript_exon_variant 0.73 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474151 n.494C>T non_coding_transcript_exon_variant 0.71 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474174 n.517A>G non_coding_transcript_exon_variant 0.78 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474181 n.524C>T non_coding_transcript_exon_variant 0.76 capreomycin Uncertain significance
linezolid
rrl 1474183 n.526T>C non_coding_transcript_exon_variant 0.34 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474185 n.528G>A non_coding_transcript_exon_variant 0.33 capreomycin Uncertain significance
linezolid
rrl 1474186 n.529A>G non_coding_transcript_exon_variant 0.32 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474201 n.544T>C non_coding_transcript_exon_variant 0.34 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474202 n.545T>G non_coding_transcript_exon_variant 0.34 capreomycin
linezolid
rrl 1474249 n.592G>T non_coding_transcript_exon_variant 0.65 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474287 n.630_649delTCCTTTTCCTCTCCGGAGGAinsCTCGTT non_coding_transcript_exon_variant 0.4 capreomycin
linezolid
rrl 1474308 n.651G>T non_coding_transcript_exon_variant 0.35 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474310 n.653T>G non_coding_transcript_exon_variant 0.35 capreomycin
linezolid
rrl 1474362 n.705A>G non_coding_transcript_exon_variant 0.6 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474446 n.789C>T non_coding_transcript_exon_variant 0.24 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474552 n.895C>T non_coding_transcript_exon_variant 0.43 capreomycin
linezolid
rrl 1474626 n.969T>C non_coding_transcript_exon_variant 0.28 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474627 n.970G>A non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474629 n.972G>A non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid
rrl 1474632 n.975G>T non_coding_transcript_exon_variant 0.7 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474636 n.979A>T non_coding_transcript_exon_variant 0.68 capreomycin Uncertain significance
linezolid
rrl 1474637 n.980C>T non_coding_transcript_exon_variant 0.3 capreomycin Uncertain significance
linezolid
rrl 1474638 n.981C>A non_coding_transcript_exon_variant 0.54 capreomycin
linezolid
rrl 1474639 n.982G>C non_coding_transcript_exon_variant 0.54 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474640 n.983C>T non_coding_transcript_exon_variant 0.3 capreomycin Uncertain significance
linezolid
rrl 1474673 n.1016T>C non_coding_transcript_exon_variant 0.37 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474676 n.1019T>A non_coding_transcript_exon_variant 0.35 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474677 n.1020A>G non_coding_transcript_exon_variant 0.33 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474710 n.1052dupG non_coding_transcript_exon_variant 0.44 capreomycin Uncertain significance
linezolid
rrl 1474710 n.1053T>A non_coding_transcript_exon_variant 0.34 capreomycin
linezolid
rrl 1474710 n.1052dupG non_coding_transcript_exon_variant 0.44 capreomycin Uncertain significance
linezolid
rrl 1474710 n.1053T>A non_coding_transcript_exon_variant 0.34 capreomycin
linezolid
rrl 1474711 n.1054_1055insA non_coding_transcript_exon_variant 0.44 capreomycin
linezolid
rrl 1474711 n.1054_1056delGGTinsCAA non_coding_transcript_exon_variant 0.34 capreomycin
linezolid
rrl 1474716 n.1059_1063delAAAGCinsCCAAGAGT non_coding_transcript_exon_variant 0.33 capreomycin
linezolid
rrl 1474716 n.1061delA non_coding_transcript_exon_variant 0.45 capreomycin Uncertain significance
linezolid
rrl 1474716 n.1059_1063delAAAGCinsCCAAGAGT non_coding_transcript_exon_variant 0.33 capreomycin
linezolid
rrl 1474716 n.1061delA non_coding_transcript_exon_variant 0.45 capreomycin Uncertain significance
linezolid
rrl 1474753 n.1096A>G non_coding_transcript_exon_variant 0.83 capreomycin Uncertain significance
linezolid
rrl 1474760 n.1103A>G non_coding_transcript_exon_variant 0.82 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474794 n.1137C>T non_coding_transcript_exon_variant 0.79 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474803 n.1146G>A non_coding_transcript_exon_variant 0.4 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474812 n.1155G>A non_coding_transcript_exon_variant 0.85 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474830 n.1173A>G non_coding_transcript_exon_variant 0.83 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1474932 n.1275C>T non_coding_transcript_exon_variant 0.37 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475031 n.1374G>T non_coding_transcript_exon_variant 0.65 capreomycin Uncertain significance
linezolid
rrl 1475061 n.1404C>A non_coding_transcript_exon_variant 0.49 capreomycin Uncertain significance
linezolid
rrl 1475061 n.1404C>T non_coding_transcript_exon_variant 0.27 capreomycin Uncertain significance
linezolid
rrl 1475062 n.1405A>T non_coding_transcript_exon_variant 0.67 capreomycin Uncertain significance
linezolid
rrl 1475120 n.1463G>T non_coding_transcript_exon_variant 0.79 capreomycin Uncertain significance
linezolid
rrl 1475206 n.1549C>T non_coding_transcript_exon_variant 0.37 capreomycin Uncertain significance
linezolid
rrl 1475315 n.1658A>T non_coding_transcript_exon_variant 0.45 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475355 n.1698C>T non_coding_transcript_exon_variant 0.55 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475380 n.1723C>A non_coding_transcript_exon_variant 0.37 capreomycin Uncertain significance
linezolid
rrl 1475419 n.1762C>T non_coding_transcript_exon_variant 0.48 capreomycin Uncertain significance
linezolid
rrl 1475429 n.1772G>T non_coding_transcript_exon_variant 0.59 capreomycin Uncertain significance
linezolid
rrl 1475452 n.1795C>A non_coding_transcript_exon_variant 0.8 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475458 n.1801C>T non_coding_transcript_exon_variant 0.2 capreomycin
linezolid
rrl 1475460 n.1803A>G non_coding_transcript_exon_variant 0.27 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475479 n.1822C>G non_coding_transcript_exon_variant 0.58 capreomycin Uncertain significance
linezolid
rrl 1475482 n.1825A>G non_coding_transcript_exon_variant 0.22 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475483 n.1826C>T non_coding_transcript_exon_variant 0.64 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475505 n.1848G>A non_coding_transcript_exon_variant 0.64 capreomycin Uncertain significance
linezolid
rrl 1475526 n.1869C>A non_coding_transcript_exon_variant 0.83 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475531 n.1874C>T non_coding_transcript_exon_variant 0.48 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475544 n.1887A>T non_coding_transcript_exon_variant 0.78 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475545 n.1888T>G non_coding_transcript_exon_variant 0.78 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475573 n.1916G>A non_coding_transcript_exon_variant 0.5 capreomycin Uncertain significance
linezolid
rrl 1475602 n.1945G>C non_coding_transcript_exon_variant 0.68 capreomycin Uncertain significance
linezolid
rrl 1475603 n.1946G>T non_coding_transcript_exon_variant 0.68 capreomycin Uncertain significance
linezolid
rrl 1475604 n.1947A>C non_coding_transcript_exon_variant 0.71 capreomycin Uncertain significance
linezolid
rrl 1475608 n.1951T>C non_coding_transcript_exon_variant 0.76 capreomycin Uncertain significance
linezolid
rrl 1475612 n.1955G>C non_coding_transcript_exon_variant 0.78 capreomycin Uncertain significance
linezolid
rrl 1475629 n.1972_1973insC non_coding_transcript_exon_variant 0.76 capreomycin Uncertain significance
linezolid
rrl 1475637 n.1980T>G non_coding_transcript_exon_variant 0.76 capreomycin Uncertain significance
linezolid
rrl 1475638 n.1981C>G non_coding_transcript_exon_variant 0.73 capreomycin Uncertain significance
linezolid
rrl 1475639 n.1982C>G non_coding_transcript_exon_variant 0.73 capreomycin Uncertain significance
linezolid
rrl 1475659 n.2002G>A non_coding_transcript_exon_variant 0.72 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475753 n.2096C>G non_coding_transcript_exon_variant 0.33 capreomycin Uncertain significance
linezolid
rrl 1475753 n.2096C>T non_coding_transcript_exon_variant 0.59 capreomycin Uncertain significance
linezolid
rrl 1475764 n.2107A>C non_coding_transcript_exon_variant 0.91 capreomycin Uncertain significance
linezolid
rrl 1475765 n.2108A>G non_coding_transcript_exon_variant 0.93 capreomycin Uncertain significance
linezolid
rrl 1475775 n.2118G>A non_coding_transcript_exon_variant 0.57 capreomycin Uncertain significance
linezolid
rrl 1475775 n.2118G>T non_coding_transcript_exon_variant 0.36 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475916 n.2259C>T non_coding_transcript_exon_variant 0.33 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475975 n.2318C>T non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475977 n.2320A>G non_coding_transcript_exon_variant 0.29 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1475988 n.2331A>G non_coding_transcript_exon_variant 0.47 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1475991 n.2334T>C non_coding_transcript_exon_variant 0.46 capreomycin Uncertain significance
linezolid
rrl 1475995 n.2338G>A non_coding_transcript_exon_variant 0.76 capreomycin Uncertain significance
linezolid
rrl 1475997 n.2340A>G non_coding_transcript_exon_variant 0.28 capreomycin
linezolid
rrl 1476044 n.2387T>G non_coding_transcript_exon_variant 0.68 capreomycin Uncertain significance
linezolid
rrl 1476045 n.2388G>T non_coding_transcript_exon_variant 0.34 capreomycin Uncertain significance
linezolid
rrl 1476046 n.2389G>T non_coding_transcript_exon_variant 0.34 capreomycin
linezolid
rrl 1476047 n.2390G>T non_coding_transcript_exon_variant 0.34 capreomycin
linezolid
rrl 1476049 n.2392C>T non_coding_transcript_exon_variant 0.68 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476086 n.2429G>A non_coding_transcript_exon_variant 0.3 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476088 n.2431A>C non_coding_transcript_exon_variant 0.83 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476099 n.2442A>G non_coding_transcript_exon_variant 0.48 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476103 n.2446C>A non_coding_transcript_exon_variant 0.36 capreomycin Uncertain significance
linezolid
rrl 1476103 n.2446C>G non_coding_transcript_exon_variant 0.48 capreomycin Uncertain significance
linezolid
rrl 1476105 n.2448G>A non_coding_transcript_exon_variant 0.47 capreomycin Uncertain significance
linezolid
rrl 1476106 n.2449A>T non_coding_transcript_exon_variant 0.47 capreomycin Uncertain significance
linezolid
rrl 1476108 n.2451T>G non_coding_transcript_exon_variant 0.36 capreomycin Uncertain significance
linezolid
rrl 1476110 n.2453G>C non_coding_transcript_exon_variant 0.48 capreomycin Uncertain significance
linezolid
rrl 1476110 n.2453G>T non_coding_transcript_exon_variant 0.34 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476115 n.2458T>C non_coding_transcript_exon_variant 0.81 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476131 n.2474C>T non_coding_transcript_exon_variant 0.81 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476160 n.2503T>C non_coding_transcript_exon_variant 0.48 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476214 n.2557G>T non_coding_transcript_exon_variant 0.79 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476215 n.2558C>T non_coding_transcript_exon_variant 0.79 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476224 n.2567A>G non_coding_transcript_exon_variant 0.83 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476245 n.2588C>T non_coding_transcript_exon_variant 0.25 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476246 n.2589G>A non_coding_transcript_exon_variant 0.25 capreomycin
linezolid
rrl 1476251 n.2594T>G non_coding_transcript_exon_variant 0.59 capreomycin Uncertain significance
linezolid
rrl 1476252 n.2595T>G non_coding_transcript_exon_variant 0.25 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476256 n.2599A>C non_coding_transcript_exon_variant 0.25 capreomycin
linezolid
rrl 1476256 n.2599A>T non_coding_transcript_exon_variant 0.6 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 0.56 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476262 n.2605G>A non_coding_transcript_exon_variant 0.3 capreomycin
linezolid
rrl 1476281 n.2624T>C non_coding_transcript_exon_variant 0.89 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476297 n.2640C>T non_coding_transcript_exon_variant 0.52 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476299 n.2642C>T non_coding_transcript_exon_variant 0.53 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476408 n.2751G>A non_coding_transcript_exon_variant 0.22 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 0.21 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476529 n.2872A>G non_coding_transcript_exon_variant 0.56 capreomycin Uncertain significance
linezolid
rrl 1476529 n.2872A>T non_coding_transcript_exon_variant 0.31 capreomycin Uncertain significance
linezolid
rrl 1476540 n.2883C>T non_coding_transcript_exon_variant 0.52 capreomycin Uncertain significance
linezolid
rrl 1476583 n.2926G>A non_coding_transcript_exon_variant 0.81 capreomycin Uncertain significance
linezolid
rrl 1476584 n.2927C>T non_coding_transcript_exon_variant 0.83 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476594 n.2937C>T non_coding_transcript_exon_variant 0.84 capreomycin Not assoc w R
linezolid Uncertain significance
rrl 1476597 n.2940G>A non_coding_transcript_exon_variant 0.86 capreomycin Uncertain significance
linezolid
rrl 1476603 n.2946G>A non_coding_transcript_exon_variant 0.9 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476608 n.2951C>G non_coding_transcript_exon_variant 0.54 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476616 n.2959A>G non_coding_transcript_exon_variant 0.53 capreomycin
linezolid
rrl 1476628 n.2971T>A non_coding_transcript_exon_variant 0.88 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476664 n.3007T>C non_coding_transcript_exon_variant 0.79 capreomycin Uncertain significance
linezolid
rrl 1476665 n.3008T>A non_coding_transcript_exon_variant 0.47 capreomycin Uncertain significance
linezolid
rrl 1476665 n.3008T>C non_coding_transcript_exon_variant 0.33 capreomycin Uncertain significance
linezolid
rrl 1476674 n.3017T>C non_coding_transcript_exon_variant 0.83 capreomycin Uncertain significance
linezolid Uncertain significance
rrl 1476679 n.3022T>A non_coding_transcript_exon_variant 0.41 capreomycin Uncertain significance
linezolid
rrl 1476679 n.3022T>C non_coding_transcript_exon_variant 0.41 capreomycin Uncertain significance
linezolid
rrl 1476689 n.3032A>T non_coding_transcript_exon_variant 0.48 capreomycin
linezolid
rrl 1476690 n.3033C>T non_coding_transcript_exon_variant 0.79 capreomycin Uncertain significance
linezolid
rrl 1476693 n.3036G>A non_coding_transcript_exon_variant 0.76 capreomycin
linezolid
rrl 1476695 n.3038T>A non_coding_transcript_exon_variant 0.53 capreomycin
linezolid
rrl 1476716 n.3059A>C non_coding_transcript_exon_variant 0.56 capreomycin Uncertain significance
linezolid
rrl 1476723 n.3066T>A non_coding_transcript_exon_variant 0.54 capreomycin
linezolid
inhA 1673682 c.-520G>C upstream_gene_variant 0.38 ethionamide Uncertain significance
isoniazid Uncertain significance
inhA 1673730 c.-472C>G upstream_gene_variant 0.48 ethionamide
isoniazid
inhA 1673748 c.-454A>G upstream_gene_variant 0.44 ethionamide
isoniazid
fabG1 1673749 p.Lys104Arg missense_variant 0.44 ethionamide
isoniazid
fabG1 1674136 p.Ser233Ala missense_variant 0.27 ethionamide
isoniazid
inhA 1674471 c.270G>C synonymous_variant 0.21 ethionamide
isoniazid
inhA 1674486 c.285T>C synonymous_variant 0.29 ethionamide
isoniazid
inhA 1674534 c.333G>C synonymous_variant 0.26 ethionamide
isoniazid Not assoc w R - Interim
inhA 1674656 p.Ser152Thr missense_variant 0.4 ethionamide
isoniazid
inhA 1674690 c.489C>G synonymous_variant 0.47 ethionamide
isoniazid
inhA 1674703 c.502T>C synonymous_variant 0.47 ethionamide
isoniazid
inhA 1674718 c.517A>C synonymous_variant 0.45 ethionamide
isoniazid
inhA 1674830 p.Glu210Gly missense_variant 0.24 ethionamide
isoniazid
inhA 1674839 p.Ala213Glu missense_variant 0.27 ethionamide
isoniazid
inhA 1674848 p.Gln216Arg missense_variant 0.27 ethionamide
isoniazid Uncertain significance
inhA 1674876 c.675C>T synonymous_variant 0.33 ethionamide
isoniazid
rpsA 1833547 c.6G>A synonymous_variant 0.4 pyrazinamide
rpsA 1833589 c.48A>C synonymous_variant 0.68 pyrazinamide
rpsA 1833595 c.54T>G synonymous_variant 0.67 pyrazinamide
rpsA 1833596 p.Ser19Ala missense_variant 0.67 pyrazinamide
rpsA 1833604 c.63C>T synonymous_variant 0.36 pyrazinamide
rpsA 1833616 c.75A>C synonymous_variant 0.78 pyrazinamide
rpsA 1833619 c.78A>C synonymous_variant 0.81 pyrazinamide
rpsA 1833628 c.87G>C synonymous_variant 0.31 pyrazinamide
rpsA 1833634 c.93G>A synonymous_variant 0.3 pyrazinamide
rpsA 1833661 c.120A>G synonymous_variant 0.7 pyrazinamide
rpsA 1833664 c.123C>G synonymous_variant 0.59 pyrazinamide
rpsA 1833667 c.126C>G synonymous_variant 0.37 pyrazinamide
rpsA 1833676 c.135A>G synonymous_variant 0.73 pyrazinamide
rpsA 1833679 c.138G>T synonymous_variant 0.68 pyrazinamide
rpsA 1833685 c.144G>T synonymous_variant 0.33 pyrazinamide
rpsA 1833694 c.153G>C synonymous_variant 0.65 pyrazinamide
rpsA 1833697 c.156C>G synonymous_variant 0.67 pyrazinamide
rpsA 1833703 c.162C>T synonymous_variant 0.34 pyrazinamide Not assoc w R - Interim
rpsA 1833709 c.168C>T synonymous_variant 0.69 pyrazinamide
rpsA 1833724 c.183C>T synonymous_variant 0.36 pyrazinamide
rpsA 1833727 c.186G>C synonymous_variant 0.65 pyrazinamide
rpsA 1833730 c.189C>T synonymous_variant 0.55 pyrazinamide
rpsA 1833733 c.192C>T synonymous_variant 0.34 pyrazinamide
rpsA 1833734 p.Ala65Cys missense_variant 0.56 pyrazinamide
rpsA 1833742 c.201A>G synonymous_variant 0.22 pyrazinamide
rpsA 1833745 c.204G>C synonymous_variant 0.37 pyrazinamide
rpsA 1833760 c.219C>T synonymous_variant 0.33 pyrazinamide Not assoc w R - Interim
rpsA 1833770 p.Asn77His missense_variant 0.35 pyrazinamide
rpsA 1833778 c.237C>G synonymous_variant 0.33 pyrazinamide
rpsA 1833781 c.240T>G synonymous_variant 0.34 pyrazinamide
rpsA 1833787 c.246C>G synonymous_variant 0.36 pyrazinamide
rpsA 1833790 c.249T>C synonymous_variant 0.35 pyrazinamide
rpsA 1833793 c.252C>T synonymous_variant 0.45 pyrazinamide
rpsA 1833802 c.261A>G synonymous_variant 0.74 pyrazinamide
rpsA 1833808 c.267G>C synonymous_variant 0.37 pyrazinamide
rpsA 1833811 c.270G>C synonymous_variant 0.37 pyrazinamide
rpsA 1833811 c.270G>T synonymous_variant 0.34 pyrazinamide
rpsA 1833814 c.273C>G synonymous_variant 0.37 pyrazinamide
rpsA 1833829 c.288A>G synonymous_variant 0.34 pyrazinamide
rpsA 1833832 c.291G>A synonymous_variant 0.32 pyrazinamide
rpsA 1833838 c.297G>C synonymous_variant 0.4 pyrazinamide
rpsA 1833841 c.300C>G synonymous_variant 0.76 pyrazinamide
rpsA 1833847 c.306C>G synonymous_variant 0.78 pyrazinamide
rpsA 1833856 c.315A>G synonymous_variant 0.79 pyrazinamide
rpsA 1833862 c.321G>C synonymous_variant 0.36 pyrazinamide
rpsA 1833862 c.321G>T synonymous_variant 0.44 pyrazinamide
rpsA 1833874 c.333T>C synonymous_variant 0.39 pyrazinamide
rpsA 1833886 c.345C>G synonymous_variant 0.35 pyrazinamide
rpsA 1833894 p.Ala118Glu missense_variant 0.77 pyrazinamide
rpsA 1833904 c.363G>A synonymous_variant 0.44 pyrazinamide
rpsA 1833928 c.387G>C synonymous_variant 0.81 pyrazinamide
rpsA 1833949 c.408T>C synonymous_variant 0.75 pyrazinamide
rpsA 1833970 c.429G>T synonymous_variant 0.64 pyrazinamide
rpsA 1833976 c.435C>T synonymous_variant 0.48 pyrazinamide
rpsA 1833979 c.438T>C synonymous_variant 0.72 pyrazinamide
rpsA 1833988 c.447C>T synonymous_variant 0.16 pyrazinamide
rpsA 1833991 c.450C>A synonymous_variant 0.51 pyrazinamide
rpsA 1834000 c.459G>C synonymous_variant 0.37 pyrazinamide
rpsA 1834009 c.468C>T synonymous_variant 0.44 pyrazinamide
rpsA 1834012 c.471G>T synonymous_variant 0.36 pyrazinamide
rpsA 1834015 c.474G>C synonymous_variant 0.65 pyrazinamide
rpsA 1834021 c.480C>T synonymous_variant 0.36 pyrazinamide
rpsA 1834030 c.489C>G synonymous_variant 0.39 pyrazinamide
rpsA 1834041 p.Lys167Ser missense_variant 0.18 pyrazinamide
rpsA 1834051 c.510G>A synonymous_variant 0.23 pyrazinamide
rpsA 1834097 c.556_557delTCinsAG synonymous_variant 0.43 pyrazinamide
rpsA 1834102 c.561T>C synonymous_variant 0.64 pyrazinamide
rpsA 1834150 c.609G>C synonymous_variant 0.48 pyrazinamide
rpsA 1834153 c.612T>C synonymous_variant 0.41 pyrazinamide
rpsA 1834154 c.613_615delAACinsCG frameshift_variant&missense_variant 0.41 pyrazinamide Uncertain significance
rpsA 1834157 c.616T>C synonymous_variant 0.41 pyrazinamide
rpsA 1834162 c.621A>G synonymous_variant 0.41 pyrazinamide Not assoc w R - Interim
rpsA 1834165 c.624A>G synonymous_variant 0.42 pyrazinamide
rpsA 1834169 p.Thr210Ala missense_variant 0.41 pyrazinamide Uncertain significance
rpsA 1834177 c.636A>C synonymous_variant 1.0 pyrazinamide Not assoc w R - Interim
rpsA 1834189 c.648G>C synonymous_variant 0.56 pyrazinamide
rpsA 1834213 c.672G>C synonymous_variant 0.51 pyrazinamide
rpsA 1834234 c.693G>C synonymous_variant 0.48 pyrazinamide
rpsA 1834240 c.699T>C synonymous_variant 0.6 pyrazinamide
rpsA 1834246 c.705G>C synonymous_variant 0.42 pyrazinamide
rpsA 1834249 c.708T>C synonymous_variant 0.63 pyrazinamide
rpsA 1834252 c.711C>G synonymous_variant 0.45 pyrazinamide
rpsA 1834261 c.720A>G synonymous_variant 0.67 pyrazinamide Not assoc w R - Interim
rpsA 1834264 c.723G>C synonymous_variant 0.68 pyrazinamide
rpsA 1834279 c.738C>T synonymous_variant 0.49 pyrazinamide Not assoc w R - Interim
rpsA 1834297 c.756C>T synonymous_variant 0.5 pyrazinamide
rpsA 1834303 c.762T>G synonymous_variant 0.68 pyrazinamide
rpsA 1834306 c.765T>C synonymous_variant 0.69 pyrazinamide
rpsA 1834345 c.804C>T synonymous_variant 0.42 pyrazinamide
rpsA 1834348 c.807T>C synonymous_variant 0.73 pyrazinamide Not assoc w R - Interim
rpsA 1834361 c.820T>C synonymous_variant 0.49 pyrazinamide
rpsA 1834366 c.825A>G synonymous_variant 0.72 pyrazinamide Not assoc w R - Interim
rpsA 1834375 c.834G>A synonymous_variant 0.29 pyrazinamide
rpsA 1834378 c.837T>C synonymous_variant 0.27 pyrazinamide Not assoc w R - Interim
rpsA 1834396 c.855G>C synonymous_variant 0.45 pyrazinamide
rpsA 1834411 c.870T>C synonymous_variant 0.66 pyrazinamide
rpsA 1834417 c.876G>C synonymous_variant 0.21 pyrazinamide
rpsA 1834423 c.882G>T synonymous_variant 0.69 pyrazinamide
rpsA 1834432 c.891G>C synonymous_variant 0.27 pyrazinamide
rpsA 1834451 c.910T>C synonymous_variant 0.7 pyrazinamide
rpsA 1834456 c.915T>G synonymous_variant 0.7 pyrazinamide
rpsA 1834468 c.927A>G synonymous_variant 0.66 pyrazinamide
rpsA 1834489 c.948T>C synonymous_variant 0.62 pyrazinamide
rpsA 1834498 c.957C>T synonymous_variant 0.43 pyrazinamide
rpsA 1834513 c.972C>G synonymous_variant 0.35 pyrazinamide
rpsA 1834520 c.979_981delGCCinsTT frameshift_variant&missense_variant 0.31 pyrazinamide Uncertain significance
rpsA 1834527 p.Arg329His missense_variant 0.32 pyrazinamide
rpsA 1834540 c.999G>C synonymous_variant 0.22 pyrazinamide
rpsA 1834543 c.1002C>G synonymous_variant 0.22 pyrazinamide
rpsA 1834546 c.1005T>C synonymous_variant 0.53 pyrazinamide
rpsA 1834555 c.1014T>C synonymous_variant 0.43 pyrazinamide
rpsA 1834573 c.1032G>C synonymous_variant 0.44 pyrazinamide
rpsA 1834603 p.Glu354Asp missense_variant 0.36 pyrazinamide
rpsA 1834606 c.1065C>T synonymous_variant 0.5 pyrazinamide
rpsA 1834609 c.1068T>C synonymous_variant 0.76 pyrazinamide
rpsA 1834619 c.1078T>C synonymous_variant 0.64 pyrazinamide
rpsA 1834622 c.1081_1083delTCGinsAGC synonymous_variant 0.65 pyrazinamide
rpsA 1834633 c.1092A>G synonymous_variant 0.64 pyrazinamide
rpsA 1834639 c.1098T>C synonymous_variant 0.64 pyrazinamide
rpsA 1834666 c.1125G>C synonymous_variant 0.42 pyrazinamide
rpsA 1834667 p.Ala376Ser missense_variant 0.65 pyrazinamide
rpsA 1834690 c.1149T>C synonymous_variant 0.58 pyrazinamide
rpsA 1834732 c.1191T>C synonymous_variant 0.64 pyrazinamide
rpsA 1834738 c.1197A>G synonymous_variant 0.65 pyrazinamide
rpsA 1834747 c.1206A>G synonymous_variant 0.4 pyrazinamide
rpsA 1834751 c.1210_1212delCTTinsAC frameshift_variant&missense_variant 0.33 pyrazinamide Uncertain significance
rpsA 1834756 c.1215G>A synonymous_variant 0.51 pyrazinamide
rpsA 1834759 c.1218A>C synonymous_variant 0.47 pyrazinamide
rpsA 1834765 p.Glu408Asp missense_variant 0.51 pyrazinamide
rpsA 1834774 c.1233C>G synonymous_variant 0.47 pyrazinamide
rpsA 1834786 c.1245A>G synonymous_variant 0.47 pyrazinamide
rpsA 1834789 c.1248T>C synonymous_variant 0.47 pyrazinamide
rpsA 1834792 c.1251G>C synonymous_variant 0.45 pyrazinamide
tsnR 1853361 c.-245T>C upstream_gene_variant 0.39 linezolid
tsnR 1853370 c.-236_-234delGCAinsTC upstream_gene_variant 0.26 linezolid
tsnR 1853441 c.-165C>T upstream_gene_variant 0.33 linezolid
tsnR 1853444 c.-162C>T upstream_gene_variant 0.33 linezolid
tsnR 1853459 c.-147G>C upstream_gene_variant 0.41 linezolid
tsnR 1853462 c.-144A>G upstream_gene_variant 0.43 linezolid
tsnR 1853474 c.-132C>G upstream_gene_variant 0.56 linezolid
tsnR 1853477 c.-129T>C upstream_gene_variant 0.53 linezolid
tsnR 1853480 c.-126G>C upstream_gene_variant 0.5 linezolid
tsnR 1853481 c.-125A>G upstream_gene_variant 0.5 linezolid
tsnR 1853490 c.-116C>G upstream_gene_variant 0.46 linezolid
tsnR 1853495 c.-111G>C upstream_gene_variant 0.43 linezolid
tsnR 1853516 c.-90C>G upstream_gene_variant 0.38 linezolid
tsnR 1853523 c.-83_-82delCGinsAA upstream_gene_variant 0.35 linezolid
tsnR 1853531 c.-75A>G upstream_gene_variant 0.35 linezolid
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
katG 2154724 p.Arg463Leu missense_variant 1.0 isoniazid Not assoc w R
katG 2155668 c.444G>C synonymous_variant 0.26 isoniazid
katG 2155674 c.438G>C synonymous_variant 0.25 isoniazid
katG 2155680 c.432G>A synonymous_variant 0.27 isoniazid
katG 2155691 c.421T>C synonymous_variant 0.32 isoniazid
katG 2155696 p.Ala139Val missense_variant 0.35 isoniazid
katG 2155716 c.396T>G synonymous_variant 0.41 isoniazid
katG 2155722 c.390G>C synonymous_variant 0.41 isoniazid
katG 2155728 c.384G>C synonymous_variant 0.41 isoniazid
PPE35 2167926 p.Leu896Ser missense_variant 1.0 pyrazinamide Not assoc w R
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
kasA 2517941 c.-174C>G upstream_gene_variant 0.41 isoniazid
kasA 2517959 c.-156C>T upstream_gene_variant 0.33 isoniazid
kasA 2517962 c.-153C>G upstream_gene_variant 0.35 isoniazid
kasA 2517968 c.-147T>C upstream_gene_variant 0.37 isoniazid
kasA 2517974 c.-141T>C upstream_gene_variant 0.57 isoniazid
kasA 2517980 c.-135C>T upstream_gene_variant 0.31 isoniazid
kasA 2517989 c.-126T>G upstream_gene_variant 0.47 isoniazid
kasA 2518282 c.168A>G synonymous_variant 0.2 isoniazid
kasA 2518283 p.Ala57Pro missense_variant 0.2 isoniazid
kasA 2518504 c.390T>C synonymous_variant 0.32 isoniazid
kasA 2518506 p.Ala131Glu missense_variant 0.35 isoniazid
kasA 2518519 c.405G>T synonymous_variant 0.33 isoniazid
kasA 2518528 c.414C>G synonymous_variant 0.32 isoniazid
kasA 2518564 c.450C>G synonymous_variant 0.29 isoniazid
kasA 2518573 c.459G>C synonymous_variant 0.24 isoniazid
kasA 2518574 p.Ile154Ala missense_variant 0.47 isoniazid
kasA 2518582 c.468G>T synonymous_variant 0.23 isoniazid
kasA 2518583 p.Gln157Glu missense_variant 0.23 isoniazid
kasA 2518588 c.474T>C synonymous_variant 0.33 isoniazid
kasA 2518591 c.477G>C synonymous_variant 0.41 isoniazid
kasA 2518606 c.492G>C synonymous_variant 0.42 isoniazid
kasA 2518609 p.Met165Ile missense_variant 0.41 isoniazid
kasA 2518612 c.498C>T synonymous_variant 0.41 isoniazid
kasA 2518624 c.510C>G synonymous_variant 0.22 isoniazid
kasA 2518688 p.Val192Phe missense_variant 0.34 isoniazid
kasA 2518714 c.600A>C synonymous_variant 0.36 isoniazid
kasA 2518715 p.Pro201Gly missense_variant 0.36 isoniazid
kasA 2518732 c.618C>G synonymous_variant 0.49 isoniazid
kasA 2518747 c.633C>G synonymous_variant 0.56 isoniazid
kasA 2518756 c.642G>C synonymous_variant 0.48 isoniazid
kasA 2518780 p.Glu222Asp missense_variant 0.34 isoniazid
kasA 2518783 c.669T>C synonymous_variant 0.44 isoniazid
kasA 2518785 p.Glu224Ala missense_variant 0.28 isoniazid
kasA 2518787 c.673_675delCGGinsGT frameshift_variant&missense_variant 0.44 isoniazid
kasA 2518792 c.678C>G synonymous_variant 0.31 isoniazid
kasA 2518795 c.681C>T synonymous_variant 0.33 isoniazid
kasA 2518813 c.699C>T synonymous_variant 0.29 isoniazid
kasA 2518816 c.702C>T synonymous_variant 0.35 isoniazid
kasA 2518825 c.711T>C synonymous_variant 0.38 isoniazid
kasA 2519194 c.1080G>C synonymous_variant 0.25 isoniazid
kasA 2519203 c.1089C>T synonymous_variant 0.23 isoniazid
kasA 2519209 c.1095C>G synonymous_variant 0.22 isoniazid
Rv2477c 2782483 c.1560G>C synonymous_variant 0.45 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2782501 c.1542T>C synonymous_variant 0.44 ethambutol
moxifloxacin Not assoc w R - Interim
streptomycin
levofloxacin Not assoc w R - Interim
kanamycin Not assoc w R - Interim
rifampicin Not assoc w R - Interim
amikacin Not assoc w R - Interim
Rv2477c 2782528 c.1515G>C synonymous_variant 0.47 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2782537 c.1506T>G synonymous_variant 0.29 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2782540 c.1503T>C synonymous_variant 0.33 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2782549 c.1494T>C synonymous_variant 0.32 ethambutol Not assoc w R - Interim
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin Not assoc w R - Interim
amikacin
Rv2477c 2783634 p.Leu137Ile missense_variant 0.23 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783665 c.378A>G synonymous_variant 0.25 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783788 c.255T>C synonymous_variant 0.39 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2477c 2783797 p.Asp82Glu missense_variant 0.41 ethambutol
moxifloxacin
streptomycin
levofloxacin
kanamycin
rifampicin
amikacin
Rv2752c 3065022 c.1170G>C synonymous_variant 0.42 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
Rv2752c 3065058 c.1134C>G synonymous_variant 0.4 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
Rv2752c 3065061 c.1131C>T synonymous_variant 0.4 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
Rv2752c 3065064 c.1128G>C synonymous_variant 0.41 ethambutol Not assoc w R - Interim
moxifloxacin
levofloxacin
rifampicin Not assoc w R - Interim
isoniazid Not assoc w R - Interim
Rv2752c 3065070 c.1122C>T synonymous_variant 0.4 ethambutol Not assoc w R - Interim
moxifloxacin
levofloxacin
rifampicin Not assoc w R - Interim
isoniazid Not assoc w R - Interim
Rv2752c 3065079 c.1113T>C synonymous_variant 0.36 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
Rv2752c 3065082 c.1110G>T synonymous_variant 0.36 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
Rv2752c 3065085 c.1105_1107delAGGinsCC frameshift_variant&missense_variant 0.36 ethambutol Uncertain significance
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
rifampicin Uncertain significance
isoniazid Uncertain significance
Rv2752c 3065088 c.1104A>G synonymous_variant 0.37 ethambutol Not assoc w R - Interim
moxifloxacin
levofloxacin Not assoc w R - Interim
rifampicin Not assoc w R - Interim
isoniazid Not assoc w R - Interim
Rv2752c 3065109 c.1081_1083delAGAinsCC frameshift_variant&missense_variant 0.28 ethambutol Uncertain significance
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
rifampicin Uncertain significance
isoniazid Uncertain significance
Rv2752c 3065126 p.Ser356Ala missense_variant 0.19 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
Rv2752c 3065133 c.1059T>C synonymous_variant 0.16 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
Rv2752c 3065979 c.213T>C synonymous_variant 0.29 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
Rv2752c 3066042 c.150T>G synonymous_variant 0.36 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
Rv2752c 3066045 c.147T>C synonymous_variant 0.38 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
Rv2752c 3066066 c.126T>C synonymous_variant 0.32 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
Rv2752c 3066071 c.121T>C synonymous_variant 0.29 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
Rv2752c 3066084 c.108C>T synonymous_variant 0.38 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
Rv2752c 3066096 c.96G>C synonymous_variant 0.34 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
Rv2752c 3066118 p.Asn25Ser missense_variant 0.28 ethambutol
moxifloxacin
levofloxacin
rifampicin
isoniazid
Rv2752c 3066123 c.69C>T synonymous_variant 0.29 ethambutol Not assoc w R - Interim
moxifloxacin
levofloxacin
rifampicin Not assoc w R - Interim
isoniazid Not assoc w R - Interim
thyX 3067319 c.627G>C synonymous_variant 0.32 para-aminosalicylic_acid
thyX 3067325 c.621A>G synonymous_variant 0.33 para-aminosalicylic_acid
thyX 3067328 c.618G>C synonymous_variant 0.2 para-aminosalicylic_acid
thyX 3067349 c.597G>C synonymous_variant 0.43 para-aminosalicylic_acid
thyX 3067355 c.591A>G synonymous_variant 0.47 para-aminosalicylic_acid
thyX 3067358 c.586_588delATCinsGG frameshift_variant&missense_variant 0.25 para-aminosalicylic_acid
thyX 3067364 c.582C>T synonymous_variant 0.29 para-aminosalicylic_acid
thyX 3067367 c.579G>C synonymous_variant 0.23 para-aminosalicylic_acid
thyX 3067373 c.573C>G synonymous_variant 0.31 para-aminosalicylic_acid
thyX 3067376 c.570G>C synonymous_variant 0.23 para-aminosalicylic_acid
thyX 3067391 c.555G>A synonymous_variant 0.29 para-aminosalicylic_acid
thyX 3067403 c.543C>G synonymous_variant 0.24 para-aminosalicylic_acid
thyX 3067406 c.540A>G synonymous_variant 0.25 para-aminosalicylic_acid
thyX 3067415 c.531C>T synonymous_variant 0.18 para-aminosalicylic_acid
thyX 3067423 c.523C>T synonymous_variant 0.19 para-aminosalicylic_acid
thyX 3067424 c.522G>A synonymous_variant 0.19 para-aminosalicylic_acid
thyX 3067430 c.516C>G synonymous_variant 0.19 para-aminosalicylic_acid
thyX 3067442 c.504C>G synonymous_variant 0.3 para-aminosalicylic_acid
thyA 3073902 c.570C>G synonymous_variant 0.35 para-aminosalicylic_acid
thyA 3073920 c.552C>G synonymous_variant 0.33 para-aminosalicylic_acid
thyA 3073925 c.547T>C synonymous_variant 0.46 para-aminosalicylic_acid
thyA 3073929 c.543T>C synonymous_variant 0.32 para-aminosalicylic_acid
ald 3087699 p.Leu294Val missense_variant 0.29 cycloserine
ald 3087704 c.885T>C synonymous_variant 0.29 cycloserine
ald 3087716 c.897G>C synonymous_variant 0.32 cycloserine
ald 3087727 p.Ala303Gly missense_variant 0.28 cycloserine
Rv3236c 3612813 p.Thr102Ala missense_variant 1.0 pyrazinamide Not assoc w R - Interim
lpqB 3624407 c.504C>G synonymous_variant 0.32 bedaquiline
rifampicin
lpqB 3624649 c.262T>C synonymous_variant 0.27 bedaquiline
rifampicin
lpqB 3624680 c.231T>G synonymous_variant 0.4 bedaquiline
rifampicin
lpqB 3624701 c.210T>G synonymous_variant 0.43 bedaquiline
rifampicin
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
lpqB 3625069 c.-159T>G upstream_gene_variant 0.34 bedaquiline
rifampicin
lpqB 3625072 c.-162G>C upstream_gene_variant 0.33 bedaquiline
rifampicin
lpqB 3625102 c.-192A>G upstream_gene_variant 0.29 bedaquiline
rifampicin
lpqB 3625141 c.-231T>C upstream_gene_variant 0.29 bedaquiline
rifampicin
lpqB 3625687 c.-777G>C upstream_gene_variant 0.23 bedaquiline
rifampicin
lpqB 3625690 c.-780T>C upstream_gene_variant 0.24 bedaquiline
rifampicin
mtrB 3625729 c.885A>G synonymous_variant 0.43 bedaquiline
rifampicin Not assoc w R - Interim
mtrB 3625732 c.882C>T synonymous_variant 0.3 bedaquiline
rifampicin Not assoc w R - Interim
lpqB 3625735 c.-825C>T upstream_gene_variant 0.22 bedaquiline
rifampicin
mtrB 3625747 c.867G>C synonymous_variant 0.22 bedaquiline
rifampicin Not assoc w R - Interim
mtrB 3625753 p.Ala287Gln missense_variant 0.26 bedaquiline
rifampicin
lpqB 3625762 c.-852A>C upstream_gene_variant 0.38 bedaquiline
rifampicin
mtrB 3625765 c.849C>G synonymous_variant 0.53 bedaquiline
rifampicin Not assoc w R - Interim
mtrB 3625804 c.808_810delAGGinsCC frameshift_variant&missense_variant 0.4 bedaquiline Uncertain significance
rifampicin Uncertain significance
mtrB 3625819 c.795G>A synonymous_variant 0.29 bedaquiline
rifampicin Not assoc w R - Interim
lpqB 3625822 c.-912C>T upstream_gene_variant 0.42 bedaquiline
rifampicin
lpqB 3625828 c.-918G>C upstream_gene_variant 0.42 bedaquiline
rifampicin
mtrB 3625837 c.777C>G synonymous_variant 0.68 bedaquiline
rifampicin Not assoc w R - Interim
lpqB 3625840 c.-930A>G upstream_gene_variant 0.59 bedaquiline
rifampicin
mtrB 3625852 c.762A>G synonymous_variant 0.62 bedaquiline
rifampicin Not assoc w R - Interim
lpqB 3625864 c.-954T>G upstream_gene_variant 0.65 bedaquiline
rifampicin
lpqB 3625909 c.-999T>G upstream_gene_variant 0.29 bedaquiline
rifampicin
mtrB 3626684 c.-71G>A upstream_gene_variant 0.22 bedaquiline
rifampicin
mtrB 3626704 c.-91C>T upstream_gene_variant 0.21 bedaquiline
rifampicin
mtrA 3626711 p.Thr213Gln missense_variant 0.25 bedaquiline
rifampicin
mtrB 3626723 c.-110C>G upstream_gene_variant 0.41 bedaquiline
rifampicin
mtrB 3626726 c.-113T>C upstream_gene_variant 0.35 bedaquiline
rifampicin
mtrB 3626729 c.-116G>A upstream_gene_variant 0.36 bedaquiline
rifampicin
mtrB 3626732 c.-119A>G upstream_gene_variant 0.36 bedaquiline
rifampicin
mtrA 3626749 c.601C>T synonymous_variant 0.27 bedaquiline Not assoc w R - Interim
rifampicin Not assoc w R - Interim
mtrB 3626750 c.-137T>G upstream_gene_variant 0.34 bedaquiline
rifampicin
mtrB 3626753 c.-140G>A upstream_gene_variant 0.27 bedaquiline
rifampicin
mtrA 3626804 c.546A>G synonymous_variant 0.35 bedaquiline
rifampicin Not assoc w R - Interim
mtrB 3626843 c.-230G>T upstream_gene_variant 0.21 bedaquiline
rifampicin
mtrA 3626846 c.504G>A synonymous_variant 0.21 bedaquiline
rifampicin Not assoc w R - Interim
mtrB 3626852 c.-239G>A upstream_gene_variant 0.24 bedaquiline
rifampicin
mtrB 3626857 c.-244T>C upstream_gene_variant 0.24 bedaquiline
rifampicin
mtrB 3626858 c.-245A>G upstream_gene_variant 0.29 bedaquiline
rifampicin
mtrB 3626861 c.-248C>G upstream_gene_variant 0.29 bedaquiline
rifampicin
mtrA 3626864 c.484_486delTTGinsCC frameshift_variant&missense_variant 0.26 bedaquiline
rifampicin
mtrB 3626876 c.-263A>G upstream_gene_variant 0.28 bedaquiline
rifampicin
mtrB 3626885 c.-272A>C upstream_gene_variant 0.3 bedaquiline
rifampicin
mtrB 3626890 c.-277T>C upstream_gene_variant 0.32 bedaquiline
rifampicin
mtrB 3626969 c.-356C>G upstream_gene_variant 0.43 bedaquiline
rifampicin
mtrB 3626972 c.-359A>G upstream_gene_variant 0.5 bedaquiline
rifampicin
mtrA 3626978 p.Asp124Glu missense_variant 0.17 bedaquiline
rifampicin Uncertain significance
mtrB 3626999 c.-386G>C upstream_gene_variant 0.23 bedaquiline
rifampicin
mtrB 3627002 c.-389G>C upstream_gene_variant 0.23 bedaquiline
rifampicin
mtrB 3627005 c.-392G>A upstream_gene_variant 0.23 bedaquiline
rifampicin
mtrB 3627008 c.-395G>C upstream_gene_variant 0.49 bedaquiline
rifampicin
mtrB 3627011 c.-398T>G upstream_gene_variant 0.48 bedaquiline
rifampicin
mtrB 3627032 c.-419G>C upstream_gene_variant 0.31 bedaquiline
rifampicin
mtrA 3627041 c.307_309delATCinsGG frameshift_variant&missense_variant 0.31 bedaquiline
rifampicin
mtrB 3627044 c.-431C>T upstream_gene_variant 0.32 bedaquiline
rifampicin
mtrB 3627059 c.-446G>C upstream_gene_variant 0.33 bedaquiline
rifampicin
mtrB 3627062 c.-449G>A upstream_gene_variant 0.34 bedaquiline
rifampicin
mtrA 3627068 c.282T>C synonymous_variant 0.36 bedaquiline
rifampicin Not assoc w R - Interim
mtrB 3627071 c.-458G>C upstream_gene_variant 0.41 bedaquiline
rifampicin
mtrA 3627080 c.270T>C synonymous_variant 0.31 bedaquiline
rifampicin Not assoc w R - Interim
mtrB 3627083 c.-470G>C upstream_gene_variant 0.33 bedaquiline
rifampicin
mtrA 3627098 c.252A>C synonymous_variant 0.42 bedaquiline
rifampicin Not assoc w R - Interim
mtrB 3627167 c.-554T>C upstream_gene_variant 0.36 bedaquiline
rifampicin
fbiA 3640701 p.Ile53Met missense_variant 0.21 clofazimine
pretomanid
delamanid
fbiA 3640708 p.Leu56Val missense_variant 0.2 clofazimine
pretomanid
delamanid
fbiB 3640713 c.-822T>C upstream_gene_variant 0.22 clofazimine
pretomanid
delamanid
fbiA 3640714 p.Val58Ile missense_variant 0.22 clofazimine
pretomanid
delamanid
fbiB 3640725 c.-810T>C upstream_gene_variant 0.18 clofazimine
pretomanid
delamanid
fbiB 3640743 c.-792T>C upstream_gene_variant 0.24 clofazimine
pretomanid
delamanid
rpoA 3877545 c.963G>C synonymous_variant 0.39 rifampicin
rpoA 3877548 c.960C>G synonymous_variant 0.36 rifampicin Not assoc w R - Interim
rpoA 3877553 p.Glu319Gln missense_variant 0.38 rifampicin
rpoA 3877557 c.951C>G synonymous_variant 0.58 rifampicin Not assoc w R - Interim
rpoA 3877560 c.948C>T synonymous_variant 0.17 rifampicin Not assoc w R - Interim
rpoA 3877566 p.Ser314Thr missense_variant 0.19 rifampicin
rpoA 3877569 c.937_939delCCGinsGC frameshift_variant&missense_variant 0.6 rifampicin
rpoA 3877587 c.921A>G synonymous_variant 0.69 rifampicin Not assoc w R - Interim
rpoA 3877590 c.918G>C synonymous_variant 0.34 rifampicin
rpoA 3877593 c.915C>T synonymous_variant 0.6 rifampicin Not assoc w R - Interim
rpoA 3877596 c.912G>C synonymous_variant 0.35 rifampicin
rpoA 3877611 c.895_897delATCinsGG frameshift_variant&missense_variant 0.24 rifampicin
rpoA 3877617 c.891G>C synonymous_variant 0.26 rifampicin
rpoA 3877638 c.870T>G synonymous_variant 0.32 rifampicin
rpoA 3877638 c.870T>C synonymous_variant 0.36 rifampicin Not assoc w R - Interim
rpoA 3877647 c.861C>T synonymous_variant 0.61 rifampicin
rpoA 3877656 c.852T>C synonymous_variant 0.54 rifampicin Not assoc w R - Interim
rpoA 3877668 c.840A>G synonymous_variant 0.65 rifampicin
rpoA 3877671 c.837C>G synonymous_variant 0.26 rifampicin
rpoA 3877677 c.831G>C synonymous_variant 0.26 rifampicin Not assoc w R - Interim
rpoA 3877680 c.828G>C synonymous_variant 0.33 rifampicin Not assoc w R - Interim
rpoA 3877683 c.825G>C synonymous_variant 0.22 rifampicin
rpoA 3877686 c.822A>G synonymous_variant 0.57 rifampicin Not assoc w R - Interim
rpoA 3877689 c.819C>G synonymous_variant 0.35 rifampicin
rpoA 3877692 c.816G>C synonymous_variant 0.34 rifampicin Not assoc w R - Interim
rpoA 3877695 c.813C>G synonymous_variant 0.56 rifampicin Not assoc w R - Interim
rpoA 3877704 c.804G>T synonymous_variant 0.58 rifampicin Not assoc w R - Interim
rpoA 3877728 c.780C>G synonymous_variant 0.22 rifampicin
rpoA 3877731 c.777G>T synonymous_variant 0.2 rifampicin
rpoA 3877734 c.774G>C synonymous_variant 0.24 rifampicin
rpoA 3877737 c.771G>C synonymous_variant 0.69 rifampicin
rpoA 3877743 c.765T>C synonymous_variant 0.69 rifampicin Not assoc w R - Interim
rpoA 3877749 c.759C>T synonymous_variant 0.29 rifampicin Not assoc w R - Interim
rpoA 3877764 c.744C>G synonymous_variant 0.6 rifampicin Not assoc w R - Interim
rpoA 3877770 c.738A>G synonymous_variant 0.45 rifampicin Not assoc w R - Interim
rpoA 3877776 c.732T>C synonymous_variant 0.63 rifampicin Not assoc w R - Interim
rpoA 3877782 c.726T>C synonymous_variant 0.67 rifampicin Not assoc w R - Interim
rpoA 3877785 c.723C>A synonymous_variant 0.5 rifampicin
rpoA 3877794 c.714G>C synonymous_variant 0.33 rifampicin Not assoc w R - Interim
rpoA 3877815 c.693C>T synonymous_variant 0.27 rifampicin Not assoc w R - Interim
rpoA 3877818 c.690A>G synonymous_variant 0.69 rifampicin Not assoc w R - Interim
rpoA 3877841 c.667C>A synonymous_variant 0.25 rifampicin Not assoc w R - Interim
rpoA 3877848 c.660C>T synonymous_variant 0.73 rifampicin Not assoc w R - Interim
rpoA 3877856 c.652T>C synonymous_variant 0.52 rifampicin Not assoc w R - Interim
rpoA 3877857 c.651G>A synonymous_variant 0.67 rifampicin
rpoA 3877866 c.642G>C synonymous_variant 0.5 rifampicin
rpoA 3877875 c.633T>A synonymous_variant 0.6 rifampicin
rpoA 3877878 c.630G>C synonymous_variant 0.41 rifampicin
rpoA 3877881 c.627G>C synonymous_variant 0.31 rifampicin
rpoA 3877887 c.621G>C synonymous_variant 0.43 rifampicin
rpoA 3877893 c.615C>T synonymous_variant 0.45 rifampicin Not assoc w R - Interim
rpoA 3877905 c.603A>G synonymous_variant 0.56 rifampicin Not assoc w R - Interim
rpoA 3877908 c.600T>C synonymous_variant 0.65 rifampicin Not assoc w R - Interim
rpoA 3877920 c.588G>C synonymous_variant 0.41 rifampicin Not assoc w R - Interim
rpoA 3877926 c.582G>C synonymous_variant 0.39 rifampicin
rpoA 3877929 c.577_579delATCinsGG frameshift_variant&missense_variant 0.25 rifampicin
rpoA 3877935 c.573G>A synonymous_variant 0.19 rifampicin
rpoA 3877962 c.546G>T synonymous_variant 0.62 rifampicin Not assoc w R - Interim
rpoA 3877971 p.Asp179Glu missense_variant 0.62 rifampicin Uncertain significance
rpoA 3877974 c.534G>C synonymous_variant 0.22 rifampicin
rpoA 3877986 c.522G>C synonymous_variant 0.3 rifampicin
rpoA 3877989 c.519A>G synonymous_variant 0.56 rifampicin Not assoc w R - Interim
rpoA 3877995 c.513G>C synonymous_variant 0.27 rifampicin
rpoA 3878001 c.507A>G synonymous_variant 0.49 rifampicin Not assoc w R - Interim
rpoA 3878103 c.405A>G synonymous_variant 0.32 rifampicin
rpoA 3878127 c.381G>C synonymous_variant 0.47 rifampicin
rpoA 3878143 p.Gly122Asp missense_variant 0.61 rifampicin Uncertain significance
rpoA 3878145 c.363C>G synonymous_variant 0.48 rifampicin
rpoA 3878160 c.348C>G synonymous_variant 0.7 rifampicin Not assoc w R - Interim
rpoA 3878163 c.345C>T synonymous_variant 0.6 rifampicin Not assoc w R - Interim
rpoA 3878172 c.336G>A synonymous_variant 0.51 rifampicin
rpoA 3878184 c.324C>T synonymous_variant 0.28 rifampicin Not assoc w R - Interim
rpoA 3878187 c.321C>A synonymous_variant 0.53 rifampicin
rpoA 3878193 c.315T>C synonymous_variant 0.79 rifampicin Not assoc w R - Interim
rpoA 3878196 p.Glu104Ala missense_variant 0.2 rifampicin Uncertain significance
rpoA 3878199 c.309T>C synonymous_variant 0.2 rifampicin
rpoA 3878205 c.303T>C synonymous_variant 0.81 rifampicin Not assoc w R - Interim
rpoA 3878217 c.291A>G synonymous_variant 0.76 rifampicin Not assoc w R - Interim
rpoA 3878238 c.270C>T synonymous_variant 0.49 rifampicin
rpoA 3878244 c.264G>A synonymous_variant 0.52 rifampicin
rpoA 3878247 c.261G>C synonymous_variant 0.54 rifampicin
rpoA 3878256 c.252G>C synonymous_variant 0.51 rifampicin
rpoA 3878264 p.Ser82Gly missense_variant 0.75 rifampicin
rpoA 3878271 c.237T>C synonymous_variant 0.71 rifampicin Not assoc w R - Interim
rpoA 3878283 p.Glu75Asp missense_variant 0.61 rifampicin Uncertain significance
rpoA 3878292 c.216T>C synonymous_variant 0.39 rifampicin Not assoc w R - Interim
rpoA 3878785 c.-278T>C upstream_gene_variant 0.26 rifampicin
rpoA 3878788 c.-281G>C upstream_gene_variant 0.26 rifampicin Uncertain significance
rpoA 3878797 c.-290G>C upstream_gene_variant 0.36 rifampicin
rpoA 3878809 c.-302T>C upstream_gene_variant 0.4 rifampicin
rpoA 3878830 c.-323G>C upstream_gene_variant 0.38 rifampicin
rpoA 3878833 c.-326C>A upstream_gene_variant 0.38 rifampicin
rpoA 3878843 c.-337_-336delCGinsAA upstream_gene_variant 0.42 rifampicin
rpoA 3878845 c.-338G>C upstream_gene_variant 0.46 rifampicin
rpoA 3878853 c.-346G>A upstream_gene_variant 0.55 rifampicin
rpoA 3878873 c.-366G>A upstream_gene_variant 0.57 rifampicin
rpoA 3878878 c.-371T>C upstream_gene_variant 0.54 rifampicin Uncertain significance
rpoA 3878884 c.-377C>G upstream_gene_variant 0.46 rifampicin
rpoA 3878889 c.-382A>G upstream_gene_variant 0.41 rifampicin
rpoA 3878893 c.-388_-386delCACinsAG upstream_gene_variant 0.43 rifampicin
rpoA 3878899 c.-392C>T upstream_gene_variant 0.43 rifampicin
rpoA 3878909 c.-402A>C upstream_gene_variant 0.37 rifampicin
rpoA 3878914 c.-407T>C upstream_gene_variant 0.37 rifampicin Uncertain significance
rpoA 3878917 c.-410G>C upstream_gene_variant 0.37 rifampicin
rpoA 3879094 c.-587T>C upstream_gene_variant 0.42 rifampicin
rpoA 3879121 c.-614T>G upstream_gene_variant 0.45 rifampicin
rpoA 3879125 c.-618T>G upstream_gene_variant 0.47 rifampicin
rpoA 3879127 c.-620T>C upstream_gene_variant 0.47 rifampicin
rpoA 3879154 c.-647T>C upstream_gene_variant 0.43 rifampicin
rpoA 3879160 c.-653A>G upstream_gene_variant 0.44 rifampicin
rpoA 3879178 c.-671T>G upstream_gene_variant 0.3 rifampicin
rpoA 3879190 c.-683C>A upstream_gene_variant 0.32 rifampicin
ddn 3986636 c.-208C>G upstream_gene_variant 0.45 delamanid
pretomanid
ddn 3986648 c.-196C>G upstream_gene_variant 0.3 delamanid
pretomanid
ddn 3986696 c.-148G>C upstream_gene_variant 0.24 delamanid
pretomanid
clpC1 4038347 c.2358G>C synonymous_variant 0.36 pyrazinamide
clpC1 4038350 c.2355C>G synonymous_variant 0.23 pyrazinamide
clpC1 4038356 c.2349T>C synonymous_variant 0.35 pyrazinamide
clpC1 4038359 c.2346A>G synonymous_variant 0.33 pyrazinamide
clpC1 4038383 c.2322G>C synonymous_variant 0.29 pyrazinamide
clpC1 4038388 c.2317T>C synonymous_variant 0.43 pyrazinamide
clpC1 4038530 p.Glu725Asp missense_variant 0.33 pyrazinamide
clpC1 4038533 p.Arg724Gln missense_variant 0.33 pyrazinamide
clpC1 4038536 c.2169C>G synonymous_variant 0.32 pyrazinamide
clpC1 4038551 c.2154C>G synonymous_variant 0.42 pyrazinamide
clpC1 4038563 c.2142C>T synonymous_variant 0.52 pyrazinamide
clpC1 4038584 c.2121G>A synonymous_variant 0.38 pyrazinamide
clpC1 4038587 c.2118C>G synonymous_variant 0.43 pyrazinamide
clpC1 4038596 c.2109A>G synonymous_variant 0.55 pyrazinamide
clpC1 4038602 c.2103G>C synonymous_variant 0.58 pyrazinamide
clpC1 4038623 c.2082A>G synonymous_variant 0.57 pyrazinamide
clpC1 4038640 p.Asp689Asn missense_variant 0.65 pyrazinamide
clpC1 4038647 c.2058T>G synonymous_variant 0.58 pyrazinamide
clpC1 4038658 p.Lys683Gln missense_variant 0.48 pyrazinamide
clpC1 4038662 c.2043T>C synonymous_variant 0.46 pyrazinamide
clpC1 4038671 c.2034T>G synonymous_variant 0.5 pyrazinamide Not assoc w R - Interim
clpC1 4038679 p.Pro676Ala missense_variant 0.58 pyrazinamide
clpC1 4038683 c.2022T>C synonymous_variant 0.59 pyrazinamide Not assoc w R - Interim
clpC1 4038704 c.2001T>C synonymous_variant 0.55 pyrazinamide
clpC1 4038710 c.1995G>C synonymous_variant 0.5 pyrazinamide
clpC1 4038713 c.1992T>C synonymous_variant 0.5 pyrazinamide
clpC1 4038725 p.Thr660Trp missense_variant 0.22 pyrazinamide
clpC1 4038740 c.1965G>C synonymous_variant 0.23 pyrazinamide
clpC1 4038752 c.1953G>A synonymous_variant 0.23 pyrazinamide
clpC1 4038755 c.1950G>C synonymous_variant 0.49 pyrazinamide
clpC1 4038767 c.1938G>C synonymous_variant 0.32 pyrazinamide
clpC1 4038770 c.1935C>T synonymous_variant 0.22 pyrazinamide
clpC1 4038773 c.1932T>C synonymous_variant 0.58 pyrazinamide
clpC1 4038776 c.1929G>A synonymous_variant 0.21 pyrazinamide
clpC1 4038779 c.1926C>G synonymous_variant 0.47 pyrazinamide
clpC1 4038782 c.1923G>C synonymous_variant 0.26 pyrazinamide
clpC1 4038790 c.1915C>T synonymous_variant 0.65 pyrazinamide Not assoc w R - Interim
clpC1 4038812 c.1893T>C synonymous_variant 0.69 pyrazinamide
clpC1 4038815 c.1890G>C synonymous_variant 0.37 pyrazinamide
clpC1 4038875 c.1830C>G synonymous_variant 0.56 pyrazinamide
clpC1 4038878 c.1827A>G synonymous_variant 0.6 pyrazinamide Not assoc w R - Interim
clpC1 4038890 c.1815G>A synonymous_variant 0.25 pyrazinamide
clpC1 4038905 c.1800A>C synonymous_variant 0.41 pyrazinamide
clpC1 4038914 c.1791G>T synonymous_variant 0.26 pyrazinamide
clpC1 4038917 c.1788C>T synonymous_variant 0.21 pyrazinamide
clpC1 4038923 c.1782A>G synonymous_variant 0.37 pyrazinamide
clpC1 4038941 c.1764G>C synonymous_variant 0.19 pyrazinamide
clpC1 4038953 c.1752A>G synonymous_variant 0.48 pyrazinamide
clpC1 4038956 c.1749T>C synonymous_variant 0.41 pyrazinamide
clpC1 4038965 c.1740T>C synonymous_variant 0.53 pyrazinamide
clpC1 4038971 c.1734T>C synonymous_variant 0.56 pyrazinamide
clpC1 4038974 c.1731T>C synonymous_variant 0.58 pyrazinamide Not assoc w R - Interim
clpC1 4038989 c.1716T>C synonymous_variant 0.62 pyrazinamide
clpC1 4038997 c.1708T>C synonymous_variant 0.64 pyrazinamide Not assoc w R - Interim
clpC1 4039022 c.1683A>G synonymous_variant 0.69 pyrazinamide
clpC1 4039046 c.1659C>T synonymous_variant 0.54 pyrazinamide Not assoc w R - Interim
clpC1 4039064 c.1641C>T synonymous_variant 0.57 pyrazinamide
clpC1 4039067 c.1638G>C synonymous_variant 0.52 pyrazinamide
clpC1 4039079 c.1626C>G synonymous_variant 0.49 pyrazinamide Not assoc w R - Interim
clpC1 4039085 c.1620A>G synonymous_variant 0.53 pyrazinamide
clpC1 4039091 c.1614G>C synonymous_variant 0.33 pyrazinamide
clpC1 4039097 c.1608G>T synonymous_variant 0.36 pyrazinamide
clpC1 4039100 c.1605C>T synonymous_variant 0.29 pyrazinamide Not assoc w R - Interim
clpC1 4039103 c.1602T>C synonymous_variant 0.41 pyrazinamide
clpC1 4039106 c.1599G>C synonymous_variant 0.36 pyrazinamide
clpC1 4039118 c.1587C>A synonymous_variant 0.4 pyrazinamide
clpC1 4039142 c.1563A>G synonymous_variant 0.59 pyrazinamide
clpC1 4039145 c.1560G>C synonymous_variant 0.61 pyrazinamide
clpC1 4039169 c.1536A>G synonymous_variant 0.71 pyrazinamide
clpC1 4039178 c.1527G>C synonymous_variant 0.6 pyrazinamide
clpC1 4039183 c.1522T>C synonymous_variant 0.74 pyrazinamide
clpC1 4039187 c.1518G>T synonymous_variant 0.71 pyrazinamide
clpC1 4039190 c.1515C>G synonymous_variant 0.58 pyrazinamide
clpC1 4039208 c.1497C>G synonymous_variant 0.21 pyrazinamide
clpC1 4039220 c.1485G>C synonymous_variant 0.5 pyrazinamide
clpC1 4039241 c.1464G>C synonymous_variant 0.41 pyrazinamide
clpC1 4039271 c.1434G>A synonymous_variant 0.37 pyrazinamide
clpC1 4039274 c.1431G>C synonymous_variant 0.23 pyrazinamide Not assoc w R - Interim
clpC1 4039283 c.1422C>T synonymous_variant 0.31 pyrazinamide
clpC1 4039286 c.1419T>G synonymous_variant 0.44 pyrazinamide
clpC1 4039292 c.1413C>G synonymous_variant 0.45 pyrazinamide
clpC1 4039295 c.1410A>C synonymous_variant 0.6 pyrazinamide
clpC1 4039298 c.1407T>C synonymous_variant 0.28 pyrazinamide
clpC1 4039310 c.1395A>G synonymous_variant 0.25 pyrazinamide
clpC1 4039313 c.1392C>G synonymous_variant 0.29 pyrazinamide
clpC1 4039322 c.1383T>C synonymous_variant 0.28 pyrazinamide
clpC1 4039338 p.Thr456Gln missense_variant 0.35 pyrazinamide
clpC1 4039352 c.1353C>T synonymous_variant 0.4 pyrazinamide Not assoc w R - Interim
clpC1 4039361 c.1344C>G synonymous_variant 0.38 pyrazinamide
clpC1 4039382 c.1323C>G synonymous_variant 0.59 pyrazinamide
clpC1 4039391 c.1314T>G synonymous_variant 0.64 pyrazinamide
clpC1 4039394 c.1311G>C synonymous_variant 0.62 pyrazinamide
clpC1 4039397 c.1308A>G synonymous_variant 0.61 pyrazinamide
clpC1 4039409 c.1296T>C synonymous_variant 0.63 pyrazinamide
clpC1 4039412 c.1293T>G synonymous_variant 0.55 pyrazinamide
clpC1 4039415 p.Glu430Asp missense_variant 0.66 pyrazinamide Uncertain significance
clpC1 4039430 c.1275T>C synonymous_variant 0.7 pyrazinamide