TB-Profiler result

Run: e36cc082-9ce5-484d-b7b0-09670e6f3253

Summary

Run ID: e36cc082-9ce5-484d-b7b0-09670e6f3253

Sample name:

Date: 17-07-2023 14:04:32

Number of reads: 46013

Percentage reads mapped: 24.78

Median coverage: 10

Strain:

Spoligotype:

Drug-resistance: HR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4.8.3 Euro-American (mainly T) RD219 0.06
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin
isoniazid fabG1 c.-16A>G Assoc w R - interim
c.-5T>A Uncertain significance
katG c.2075delG Uncertain significance
c.1554_1555delTC Uncertain significance
c.1538_1539delAT Uncertain significance
c.1378delA Uncertain significance
p.Ala379Val Uncertain significance
p.Ile335Thr Uncertain significance
p.Ile317Leu Uncertain significance
c.760dupC Uncertain significance
p.Asn238Lys Uncertain significance
c.708delC Uncertain significance
c.318delG Uncertain significance
c.315_316insA Uncertain significance
c.300delG Uncertain significance
c.296_297insT Uncertain significance
c.242_246delAGGAA Uncertain significance
c.51_52insG Uncertain significance
ethambutol embB p.His312Arg Uncertain significance
p.Leu359Ile Uncertain significance
p.Tyr384Asn Uncertain significance
p.Ala388Gly Uncertain significance
p.Asn399Asp Uncertain significance
p.Ala659Thr Uncertain significance
pyrazinamide panD p.Val138Ala Uncertain significance
moxifloxacin
levofloxacin
bedaquiline
delamanid
pretomanid
linezolid
streptomycin rrs n.462C>T Uncertain significance
amikacin
kanamycin
capreomycin tlyA c.520_521insC Uncertain significance
c.788delC Uncertain significance
clofazimine
ethionamide ethA c.1344_1345insT Uncertain significance
c.1258_1259insC Uncertain significance
c.217_218insGA Uncertain significance
c.208_209delAC Uncertain significance
c.117_118delAT Uncertain significance
para-aminosalicylic_acid
cycloserine
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
rrs 1472307 n.462C>T non_coding_transcript_exon_variant 0.91 streptomycin Uncertain significance
fabG1 1673424 c.-16A>G upstream_gene_variant 0.83 isoniazid Assoc w R - interim
fabG1 1673435 c.-5T>A upstream_gene_variant 0.92 isoniazid Uncertain significance
tlyA 1918459 c.520_521insC frameshift_variant 0.91 capreomycin Uncertain significance
tlyA 1918726 c.788delC frameshift_variant 0.83 capreomycin Uncertain significance
katG 2154036 c.2075delG frameshift_variant 1.0 isoniazid Uncertain significance
katG 2154556 c.1554_1555delTC frameshift_variant 1.0 isoniazid Uncertain significance
katG 2154572 c.1538_1539delAT frameshift_variant 1.0 isoniazid Uncertain significance
katG 2154733 c.1378delA frameshift_variant 1.0 isoniazid Uncertain significance
katG 2154976 p.Ala379Val missense_variant 1.0 isoniazid Uncertain significance
katG 2155108 p.Ile335Thr missense_variant 1.0 isoniazid Uncertain significance
katG 2155161 p.Ile317Leu missense_variant 0.91 isoniazid Uncertain significance
katG 2155351 c.760dupC frameshift_variant 0.96 isoniazid Uncertain significance
katG 2155398 p.Asn238Lys missense_variant 1.0 isoniazid Uncertain significance
katG 2155403 c.708delC frameshift_variant 1.0 isoniazid Uncertain significance
katG 2155793 c.318delG frameshift_variant 1.0 isoniazid Uncertain significance
katG 2155796 c.315_316insA frameshift_variant 1.0 isoniazid Uncertain significance
katG 2155811 c.300delG frameshift_variant 1.0 isoniazid Uncertain significance
katG 2155815 c.296_297insT frameshift_variant 1.0 isoniazid Uncertain significance
katG 2155865 c.242_246delAGGAA frameshift_variant 1.0 isoniazid Uncertain significance
katG 2156060 c.51_52insG frameshift_variant 0.8 isoniazid Uncertain significance
panD 4043869 p.Val138Ala missense_variant 1.0 pyrazinamide Uncertain significance
embB 4247448 p.His312Arg missense_variant 1.0 ethambutol Uncertain significance
embB 4247588 p.Leu359Ile missense_variant 1.0 ethambutol Uncertain significance
embB 4247663 p.Tyr384Asn missense_variant 1.0 ethambutol Uncertain significance
embB 4247676 p.Ala388Gly missense_variant 1.0 ethambutol Uncertain significance
embB 4247708 p.Asn399Asp missense_variant 0.96 ethambutol Uncertain significance
embB 4248488 p.Ala659Thr missense_variant 0.96 ethambutol Uncertain significance
ethA 4326129 c.1344_1345insT frameshift_variant 1.0 ethionamide Uncertain significance
ethA 4326215 c.1258_1259insC frameshift_variant 1.0 ethionamide Uncertain significance
ethA 4327256 c.217_218insGA frameshift_variant 1.0 ethionamide Uncertain significance
ethA 4327264 c.208_209delAC frameshift_variant 1.0 ethionamide Uncertain significance
ethA 4327355 c.117_118delAT frameshift_variant 1.0 ethionamide Uncertain significance
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrB 5046 c.-194T>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5048 c.-192G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5060 c.-180G>T upstream_gene_variant 0.9 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5070 c.-170C>A upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5073 c.-167G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5090 c.-150G>C upstream_gene_variant 0.9 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5136 c.-104A>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrB 5138 c.-102G>C upstream_gene_variant 0.9 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5151 c.-89C>T upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5152 c.-88C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5153 c.-86delT upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5156 c.-84_-83insAC upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5159 c.-81C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5160 c.-80C>T upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5172 c.-68C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5174 c.-66G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5197 c.-42delC upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5207 c.-33A>C upstream_gene_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5208 c.-32T>C upstream_gene_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5212 c.-28C>T upstream_gene_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5214 c.-26C>A upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5222 c.-18G>A upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5230 c.-10T>C upstream_gene_variant 0.9 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrB 5231 c.-9A>T upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5235 c.-5G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5238 c.-2T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5254 c.15A>G synonymous_variant 0.82 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5263 c.24C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5278 c.39C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5282 p.Ala15Ser missense_variant 0.83 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5285 p.Ser16Ala missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5294 p.Ile19Val missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5299 c.60C>G synonymous_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5314 c.75C>G synonymous_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5326 c.87T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5332 c.93C>T synonymous_variant 0.82 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5341 c.102T>C synonymous_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5347 c.108G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5353 c.114T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5359 c.120C>A synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5363 c.124_126delTTAinsCTG synonymous_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5371 c.132T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5377 c.138T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5396 p.Ala53Ser missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5407 c.168G>A synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5419 c.180T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5422 c.183T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5431 c.192A>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5432 c.194delT frameshift_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5435 p.Asn66Val missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5439 p.Val67Asp missense_variant 0.85 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5446 c.207G>C synonymous_variant 0.85 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5449 c.210T>G synonymous_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5452 p.Glu71Asp missense_variant 0.8 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrB 5455 c.216T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5459 p.Gly74Ser missense_variant 0.85 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5477 p.Asp80Asn missense_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5491 c.252T>C synonymous_variant 0.87 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5494 c.255G>C synonymous_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5500 c.261C>G synonymous_variant 0.88 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5502 p.Thr88Met missense_variant 0.93 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5509 c.270C>G synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5510 p.Ser91Thr missense_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5516 p.Ile93Ala missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5521 c.282G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5542 c.303A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5545 c.306A>G synonymous_variant 0.93 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5548 c.309A>G synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5551 c.312T>C synonymous_variant 0.81 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5575 c.336_337insA frameshift_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5580 p.Tyr114Ser missense_variant 0.9 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5584 c.345G>A synonymous_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5586 p.Ile116Thr missense_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5593 c.354T>C synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5614 c.375G>C synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5623 c.384T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5629 c.390G>A synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5632 c.393A>G synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5647 c.408A>G synonymous_variant 0.88 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5651 p.Glu138Asn missense_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5657 p.Lys140Ala missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5665 c.426C>T synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5668 c.429G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5685 p.Val149Asp missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5689 c.450T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5692 p.Glu151Asp missense_variant 0.81 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5694 p.Lys152Thr missense_variant 0.86 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5696 p.Ser153Pro missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5735 p.Lys166Arg missense_variant 0.93 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5740 c.501G>C synonymous_variant 0.81 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5743 c.504G>C synonymous_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5744 p.Ser169Thr missense_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5749 c.510G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5750 p.Val171Ile missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5772 p.Ala178Asp missense_variant 0.88 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5774 p.Val179Ile missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5782 c.543A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5788 c.549G>C synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5791 c.552A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5806 c.567C>G synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5809 c.570C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5815 c.576C>G synonymous_variant 0.89 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5824 c.585A>G synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5827 c.588G>A synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5848 c.609G>C synonymous_variant 0.89 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5863 c.624G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5873 c.634A>C synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5882 p.Gln215Asn missense_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5887 p.Asp216Glu missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5902 c.663A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5915 p.Val226Thr missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5923 p.Glu228Asp missense_variant 1.0 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrB 5926 c.687G>A synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5929 c.690G>C synonymous_variant 0.9 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5939 p.Ser234Gly missense_variant 0.8 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5953 c.714C>G synonymous_variant 0.72 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5959 c.720C>G synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5960 p.Thr241Ala missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5965 c.726A>G synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5971 c.732C>T synonymous_variant 0.78 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5974 c.735A>G synonymous_variant 0.9 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5977 c.738T>C synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5981 p.Ser248His missense_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5992 c.753T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 5998 c.759T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6001 c.762G>C synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6004 c.765T>C synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6013 c.774G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6022 c.783G>C synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6034 c.795C>T synonymous_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6043 c.804G>A synonymous_variant 0.89 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6047 p.Ala270Pro missense_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6052 c.813T>C synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6065 p.Val276Ile missense_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6069 c.831_832delCT frameshift_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6079 c.840C>G synonymous_variant 0.88 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6086 p.Thr283Pro missense_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6091 c.852G>C synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6100 c.861G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6115 c.876A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6123 p.Ala295Gly missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6127 c.888G>C synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6133 c.894G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6136 c.897G>A synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6148 c.909C>G synonymous_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6169 c.930C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6190 c.951A>G synonymous_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6209 c.970C>T synonymous_variant 0.88 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6214 c.975G>C synonymous_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6217 c.978G>C synonymous_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6223 c.984G>C synonymous_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6242 p.Arg335Lys missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrB 6250 c.1011A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6253 c.1014G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6280 c.1041T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6286 c.1047T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6292 c.1053G>C synonymous_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6295 c.1056A>G synonymous_variant 0.82 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6298 c.1059C>T synonymous_variant 0.9 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6299 c.1060C>T synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6307 c.-995T>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6319 c.-983G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6325 c.-977C>G upstream_gene_variant 0.9 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6361 c.-941G>A upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6362 c.-940T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6379 c.-923C>G upstream_gene_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6382 c.-920A>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6388 c.-914T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6400 c.-902C>G upstream_gene_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6403 c.-899T>C upstream_gene_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6415 c.-887G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6427 c.-875T>C upstream_gene_variant 0.85 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6440 p.Thr401Ala missense_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 6448 c.-854G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6455 p.Val406Ile missense_variant 0.9 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 6460 c.-842G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6469 c.-833T>G upstream_gene_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6472 c.-830G>T upstream_gene_variant 0.9 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6475 c.-827C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6478 c.-824G>A upstream_gene_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6484 c.-818A>G upstream_gene_variant 0.84 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6487 c.-815C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6490 c.-812T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6493 c.-809C>T upstream_gene_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6496 c.-806G>C upstream_gene_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6499 c.-803A>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6502 c.-800T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6508 c.-794A>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6523 c.-779G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6526 c.-776T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6535 c.-767C>A upstream_gene_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6538 c.-764C>T upstream_gene_variant 0.86 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6542 p.Ile435Leu missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 6547 c.-755T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6550 c.-752A>G upstream_gene_variant 0.89 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6565 c.-737G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6571 c.-731T>C upstream_gene_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6577 c.-725T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6580 c.-722C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6583 c.-719G>C upstream_gene_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6586 c.-716T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6598 c.-704C>G upstream_gene_variant 0.77 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6602 c.-700C>T upstream_gene_variant 0.9 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6610 c.-692C>G upstream_gene_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6613 c.-689A>C upstream_gene_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6616 c.-686A>G upstream_gene_variant 0.75 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6634 c.-668T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6637 c.-665T>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6640 c.-662A>G upstream_gene_variant 0.88 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6649 c.-653T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6652 c.-650C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6655 c.-647T>C upstream_gene_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6670 c.-632G>C upstream_gene_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6673 c.-629A>C upstream_gene_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6700 c.-602T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6703 c.-599G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6706 c.-596G>A upstream_gene_variant 0.87 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6709 c.-593A>G upstream_gene_variant 0.74 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6712 c.-590G>C upstream_gene_variant 0.8 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6727 c.-575G>T upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6730 c.-572A>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6745 c.-557T>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6760 c.-542G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6778 c.-524C>T upstream_gene_variant 0.84 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6793 c.-509T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6797 p.Gly520Thr missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 6824 c.-478C>T upstream_gene_variant 0.71 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6841 c.-461T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6844 c.-458T>G upstream_gene_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6853 c.-449A>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6856 c.-446T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6859 c.-443T>C upstream_gene_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6862 c.-440C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6878 c.-424T>C upstream_gene_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6881 c.-421T>C upstream_gene_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6904 c.-398C>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6910 c.-392G>A upstream_gene_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 6911 p.Asn558His missense_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 6919 c.-383T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6925 c.-377T>C upstream_gene_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6931 c.-371A>C upstream_gene_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6934 c.-368A>G upstream_gene_variant 0.88 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6937 c.-365G>A upstream_gene_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6949 c.-353A>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6952 c.-350C>G upstream_gene_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6955 c.-347G>A upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6967 c.-335T>C upstream_gene_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6970 c.-332C>T upstream_gene_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6973 c.-329G>C upstream_gene_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6976 c.-326A>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 6982 c.-320A>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7000 c.-302C>G upstream_gene_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7006 c.-296T>G upstream_gene_variant 0.82 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7018 c.-284G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7021 c.-281G>C upstream_gene_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7033 c.-269G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 7051 p.Glu604Asp missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7060 c.-242T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7066 c.-236G>C upstream_gene_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7075 c.-227T>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7078 c.-224A>G upstream_gene_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7081 c.-221T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7084 c.-218A>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7093 c.-209T>C upstream_gene_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7099 c.-203G>A upstream_gene_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7108 c.-194G>A upstream_gene_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7114 c.-188C>A upstream_gene_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 7124 p.Ser629Thr missense_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7129 c.-173T>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7132 c.-170T>G upstream_gene_variant 0.86 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7136 c.-166T>C upstream_gene_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7141 c.-161T>C upstream_gene_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7144 c.-158A>G upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7147 c.-155G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7165 c.-137C>G upstream_gene_variant 0.86 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7178 c.-124T>C upstream_gene_variant 0.93 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7216 c.-86G>C upstream_gene_variant 0.85 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7225 c.-77T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7237 c.-65C>T upstream_gene_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7243 c.-59G>A upstream_gene_variant 0.93 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7246 c.-56T>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7252 c.-50G>C upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7258 c.-44G>A upstream_gene_variant 0.86 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrB 7260 c.2022_*10delTGTCTAACGCAACCCTG frameshift_variant&stop_lost&splice_region_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7280 c.-21_-18delTCGA upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7286 c.-15_-14delGC upstream_gene_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7313 c.12G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7317 c.16T>C synonymous_variant 0.93 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7322 c.21G>A synonymous_variant 0.86 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7343 c.42G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7344 p.Ile15Val missense_variant 1.0 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7355 c.54T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7362 p.Glu21Gln missense_variant 1.0 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7391 c.90C>T synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7394 c.93T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7427 c.126G>C synonymous_variant 0.89 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7442 c.141G>C synonymous_variant 0.84 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7451 c.150C>G synonymous_variant 0.87 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7457 c.156T>C synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7472 c.171T>C synonymous_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7475 c.174A>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7480 p.Phe60Tyr missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7484 c.183T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7517 c.216G>A synonymous_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7523 c.222C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7532 c.231T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7538 c.237G>A synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7541 c.240C>G synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7571 c.270G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7585 p.Ser95Thr missense_variant 1.0 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7595 c.294C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7607 c.306C>G synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7622 c.321C>T synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7626 c.325C>T synonymous_variant 0.81 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7631 c.330G>C synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7637 c.336C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7649 c.348C>T synonymous_variant 0.76 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7652 c.351C>T synonymous_variant 0.81 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7658 c.357A>G synonymous_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7664 c.363T>C synonymous_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7670 c.369A>G synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7676 c.375G>C synonymous_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7683 c.382A>C synonymous_variant 0.85 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7694 c.393A>G synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7697 c.396C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7710 c.409T>C synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7715 c.414G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7728 c.427_429delAGGinsCGC synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7760 c.459C>T synonymous_variant 0.86 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7763 c.462T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7799 c.498A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7838 c.537C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7859 c.558A>C synonymous_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7865 c.564T>C synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7883 c.582G>C synonymous_variant 0.76 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7884 p.Arg195Gly missense_variant 0.88 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7892 c.591G>C synonymous_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7898 p.Asp199Glu missense_variant 0.93 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7919 p.Glu206Asp missense_variant 0.85 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7923 p.His208Tyr missense_variant 0.9 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7928 p.Asp209Glu missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7942 p.Glu214Ala missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7955 c.654G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7958 c.657C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7963 p.Gly221Glu missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7970 c.669T>G synonymous_variant 0.86 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7976 c.675C>A synonymous_variant 0.88 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7979 c.678G>C synonymous_variant 0.93 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 7992 p.Ala231Ser missense_variant 0.89 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 7997 c.696A>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8009 c.708A>C synonymous_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8010 p.Ser237Thr missense_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 8020 p.Thr240Ile missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 8024 c.723T>C synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8027 c.726T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8036 c.735A>G synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8039 c.738T>C synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8054 c.753T>C synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8057 c.756A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8069 c.768T>C synonymous_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8078 c.777A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8090 c.789C>G synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8099 c.798T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8111 c.810G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8156 c.855T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8168 c.867A>G synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8174 c.873C>G synonymous_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8177 c.876A>C synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8198 c.897T>C synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8207 c.906T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8219 c.918T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8225 c.924T>C synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8234 c.933T>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8237 c.936A>G synonymous_variant 0.89 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8253 p.Ile318Leu missense_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 8264 c.963T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8267 c.966G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8270 c.969G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8283 p.Ile328Leu missense_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 8288 c.987T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8294 c.993T>C synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8324 c.1023T>C synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8339 c.1038A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8342 c.1041G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8351 c.1050C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8366 c.1065G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8375 c.1074G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8391 p.Tyr364His missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 8399 c.1098T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8420 c.1119T>C synonymous_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8423 c.1122G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8442 c.1141C>T synonymous_variant 0.83 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8453 c.1152A>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8462 c.1161A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8471 c.1170T>C synonymous_variant 0.87 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8480 c.1179C>T synonymous_variant 0.8 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8486 c.1185T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8489 c.1188A>G synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8498 c.1197C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8504 c.1203G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8516 c.1215T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8519 c.1218A>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8537 c.1236G>A synonymous_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8546 c.1245T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8552 c.1251C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8562 c.1262dupT frameshift_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8603 c.1302A>G synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8619 c.1318T>C synonymous_variant 0.77 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8624 c.1323G>C synonymous_variant 0.87 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8627 c.1326C>G synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8636 c.1335A>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8642 c.1341A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8645 c.1344C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8672 c.1371A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8693 c.1392T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8699 c.1398A>G synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8711 c.1410A>C synonymous_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8714 c.1413A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8717 c.1416C>G synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8720 c.1419G>A synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8726 c.1425G>A synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8729 c.1428T>C synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8732 c.1431G>C synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8735 c.1434C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8747 c.1446A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8756 c.1455A>G synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8762 c.1461G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8765 p.Asp488Glu missense_variant 0.91 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 8767 p.Arg489Lys missense_variant 0.93 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 8779 p.Asp493Ala missense_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8786 c.1485T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8796 p.Ile499Val missense_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8801 c.1500G>C synonymous_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8810 c.1509A>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8829 c.1528T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8852 c.1551T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8858 c.1557T>C synonymous_variant 0.9 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8867 c.1566A>G synonymous_variant 0.87 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8870 c.1569G>C synonymous_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8873 c.1572A>C synonymous_variant 0.93 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8897 c.1596T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8903 c.1602T>C synonymous_variant 0.93 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8915 c.1614A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8918 c.1617C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8939 c.1638T>C synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8942 c.1641G>C synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8945 c.1644G>C synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8946 c.1645_1647delTTGinsCTC synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8951 c.1650G>A synonymous_variant 0.8 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8987 c.1686C>G synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8990 c.1689C>G synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8996 c.1695T>C synonymous_variant 0.93 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 8998 p.Leu566Trp missense_variant 0.83 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9023 c.1722A>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9029 c.1728T>C synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9032 c.1731T>C synonymous_variant 0.88 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9035 c.1734G>C synonymous_variant 0.9 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9050 p.Asp583Glu missense_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 9051 c.1750T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9062 c.1761C>G synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9068 c.1767G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9071 c.1770G>C synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9074 c.1773G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9080 c.1779G>T synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9099 c.1798_1800delTTAinsCTG synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9104 c.1803C>G synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9119 c.1818A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9122 c.1821C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9134 c.1833C>G synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9143 c.1842T>C synonymous_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9147 p.Gly616Ser missense_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9152 c.1851C>T synonymous_variant 0.9 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9153 p.Thr618Glu missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9164 c.1863G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9182 c.1881T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9191 c.1890G>C synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9200 c.1899A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9204 p.Ser635Thr missense_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9227 c.1926C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9230 c.1929T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9233 c.1932C>T synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9242 c.1941A>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9252 p.Val651Ile missense_variant 1.0 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 9275 c.1974G>A synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9278 c.1977G>C synonymous_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9281 c.1980C>G synonymous_variant 0.93 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9284 c.1983T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9291 c.1990C>T synonymous_variant 0.9 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9296 c.1995T>C synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9304 p.Gly668Glu missense_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9311 c.2010C>T synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9323 c.2022C>G synonymous_variant 0.97 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9335 c.2034G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9345 c.2044A>C synonymous_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9374 c.2073G>C synonymous_variant 0.85 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9377 c.2076A>G synonymous_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9383 c.2082T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9386 c.2085T>C synonymous_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9395 c.2094G>C synonymous_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9413 c.2112G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9419 c.2118T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9420 p.Ile707Ala missense_variant 0.96 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9429 p.Arg710Tyr missense_variant 0.84 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9443 c.2142G>C synonymous_variant 0.88 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9449 c.2148C>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9452 c.2151G>C synonymous_variant 0.91 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9455 c.2154T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9458 c.2157A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9467 c.2166T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9485 c.2184A>C synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9488 c.2187G>C synonymous_variant 0.81 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9491 c.2190C>G synonymous_variant 0.93 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9494 c.2193T>C synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9497 c.2196G>C synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9500 c.2199A>G synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9503 c.2202T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9518 c.2217A>G synonymous_variant 0.84 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9521 c.2220C>T synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9527 c.2226A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9542 c.2241T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9545 c.2244A>G synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9548 c.2247T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9557 c.2256G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9560 c.2259C>G synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9566 c.2265C>T synonymous_variant 0.76 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9575 c.2274G>C synonymous_variant 0.84 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9578 c.2277C>T synonymous_variant 0.84 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9585 c.2284T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9590 c.2289T>G synonymous_variant 0.78 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9593 c.2292G>T synonymous_variant 0.88 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9597 c.2296T>C synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9605 c.2304C>G synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9611 p.Asp770Glu missense_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9626 c.2325T>C synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9629 c.2328C>G synonymous_variant 0.79 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9630 p.Val777Ile missense_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9635 c.2334T>C synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9644 c.2343T>C synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9647 c.2346C>T synonymous_variant 0.94 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9650 c.2349G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9665 c.2364A>G synonymous_variant 0.79 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9666 p.Arg789Gly missense_variant 0.89 fluoroquinolones
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
ciprofloxacin
ofloxacin
gyrA 9674 c.2373T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9701 c.2400T>C synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9704 c.2403T>C synonymous_variant 0.95 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9708 c.2407T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9722 c.2421C>T synonymous_variant 0.84 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9734 c.2433A>G synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9738 c.2437T>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9749 c.2448G>C synonymous_variant 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9767 c.2466T>C synonymous_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9768 p.Gly823Arg missense_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9770 c.2470dupG frameshift_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9774 c.2476_2478delAAT conservative_inframe_deletion 1.0 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
gyrA 9779 p.Asn826Lys missense_variant 0.92 fluoroquinolones
moxifloxacin
levofloxacin
ciprofloxacin
ofloxacin
fgd1 490601 c.-182G>C upstream_gene_variant 1.0 delamanid
fgd1 490613 c.-170A>C upstream_gene_variant 1.0 delamanid
fgd1 490617 c.-166_-165delTTinsGC upstream_gene_variant 1.0 delamanid
fgd1 490794 c.12G>C synonymous_variant 1.0 delamanid
fgd1 490803 c.21T>A synonymous_variant 1.0 delamanid
fgd1 490812 c.30A>G synonymous_variant 1.0 delamanid
fgd1 490815 c.33G>C synonymous_variant 0.9 delamanid
fgd1 490827 c.45C>T synonymous_variant 1.0 delamanid
fgd1 490833 c.51G>C synonymous_variant 1.0 delamanid
fgd1 490842 c.60C>G synonymous_variant 1.0 delamanid
fgd1 490851 c.69A>C synonymous_variant 1.0 delamanid
fgd1 490887 c.105G>C synonymous_variant 1.0 delamanid
fgd1 490902 c.120T>C synonymous_variant 0.92 delamanid
fgd1 490905 c.123T>C synonymous_variant 0.75 delamanid
fgd1 490911 c.129T>G synonymous_variant 1.0 delamanid
fgd1 490917 c.135C>A synonymous_variant 1.0 delamanid
fgd1 490921 p.Gln47Glu missense_variant 1.0 delamanid
fgd1 490932 c.150T>C synonymous_variant 0.93 delamanid
fgd1 490948 p.Ser56Ala missense_variant 1.0 delamanid
fgd1 490962 c.180T>C synonymous_variant 1.0 delamanid
fgd1 490968 c.186C>G synonymous_variant 1.0 delamanid
fgd1 490974 c.192T>C synonymous_variant 1.0 delamanid
fgd1 490979 p.Asn66Thr missense_variant 1.0 delamanid
fgd1 490984 p.Leu68Ile missense_variant 0.94 delamanid
fgd1 490987 p.Leu69Thr missense_variant 0.81 delamanid
fgd1 490998 c.216T>C synonymous_variant 1.0 delamanid
fgd1 491007 c.225G>C synonymous_variant 1.0 delamanid
fgd1 491010 c.228C>G synonymous_variant 1.0 delamanid
fgd1 491013 c.231C>G synonymous_variant 1.0 delamanid
fgd1 491031 c.249C>G synonymous_variant 0.94 delamanid
fgd1 491038 p.Ile86Val missense_variant 1.0 delamanid
fgd1 491043 c.261T>G synonymous_variant 1.0 delamanid
fgd1 491049 c.267T>C synonymous_variant 1.0 delamanid
fgd1 491063 p.Gly94Ala missense_variant 1.0 delamanid
fgd1 491077 p.Asn99Gly missense_variant 0.92 delamanid
fgd1 491082 c.300T>G synonymous_variant 0.92 delamanid
fgd1 491083 p.Val101Ile missense_variant 1.0 delamanid
fgd1 491091 c.309T>C synonymous_variant 1.0 delamanid
fgd1 491094 c.312C>G synonymous_variant 1.0 delamanid
fgd1 491106 c.324T>C synonymous_variant 0.94 delamanid
fgd1 491121 c.339A>G synonymous_variant 1.0 delamanid
fgd1 491137 p.Glu119Gln missense_variant 1.0 delamanid
fgd1 491144 p.Ala121Glu missense_variant 0.94 delamanid
fgd1 491166 c.384G>C synonymous_variant 0.89 delamanid
fgd1 491181 c.399T>C synonymous_variant 0.94 delamanid
fgd1 491191 p.Gly137Arg missense_variant 0.85 delamanid
fgd1 491196 c.414A>G synonymous_variant 1.0 delamanid
fgd1 491202 c.420G>C synonymous_variant 1.0 delamanid
fgd1 491203 p.Gln141Glu missense_variant 1.0 delamanid
fgd1 491212 p.Ser144Arg missense_variant 1.0 delamanid
fgd1 491217 c.435T>C synonymous_variant 1.0 delamanid
fgd1 491232 c.450T>C synonymous_variant 1.0 delamanid
fgd1 491241 p.Asp153Glu missense_variant 1.0 delamanid
fgd1 491244 c.462T>C synonymous_variant 1.0 delamanid
fgd1 491259 c.477T>C synonymous_variant 0.95 delamanid
fgd1 491286 c.504G>C synonymous_variant 1.0 delamanid
fgd1 491291 c.510delG frameshift_variant 1.0 delamanid
fgd1 491296 c.514_515insA frameshift_variant 1.0 delamanid
fgd1 491319 c.537G>C synonymous_variant 0.94 delamanid
fgd1 491331 c.549G>A synonymous_variant 0.92 delamanid
fgd1 491349 c.567T>C synonymous_variant 1.0 delamanid
fgd1 491364 c.582T>C synonymous_variant 1.0 delamanid
fgd1 491367 c.585G>C synonymous_variant 1.0 delamanid
fgd1 491388 c.606C>G synonymous_variant 0.92 delamanid
fgd1 491393 p.Thr204Lys missense_variant 0.94 delamanid
fgd1 491397 p.Glu205Asp missense_variant 0.91 delamanid
fgd1 491406 p.Met208Ile missense_variant 0.95 delamanid
fgd1 491409 c.627G>C synonymous_variant 0.95 delamanid
fgd1 491417 c.636delA frameshift_variant 1.0 delamanid
fgd1 491421 c.639A>G synonymous_variant 0.87 delamanid
fgd1 491427 c.645C>G synonymous_variant 0.87 delamanid
fgd1 491430 c.648T>G synonymous_variant 0.95 delamanid
fgd1 491431 p.Ala217Ile missense_variant 0.94 delamanid
fgd1 491434 p.Ala218Asn missense_variant 0.91 delamanid
fgd1 491453 p.Gly224Asp missense_variant 0.96 delamanid
fgd1 491472 c.690A>G synonymous_variant 1.0 delamanid
fgd1 491502 c.720G>A synonymous_variant 0.95 delamanid
fgd1 491508 c.726A>G synonymous_variant 1.0 delamanid
fgd1 491509 c.727T>C synonymous_variant 0.75 delamanid
fgd1 491512 p.Asn244Glu missense_variant 1.0 delamanid
fgd1 491526 c.744T>C synonymous_variant 1.0 delamanid
fgd1 491532 c.750G>T synonymous_variant 0.94 delamanid
fgd1 491542 c.760T>C synonymous_variant 1.0 delamanid
fgd1 491547 c.765A>C synonymous_variant 1.0 delamanid
fgd1 491550 c.768T>C synonymous_variant 1.0 delamanid
fgd1 491583 c.801G>A synonymous_variant 1.0 delamanid
fgd1 491595 c.813C>G synonymous_variant 0.89 delamanid
fgd1 491601 c.819T>C synonymous_variant 1.0 delamanid
fgd1 491610 c.828A>C synonymous_variant 1.0 delamanid
fgd1 491616 c.834A>G synonymous_variant 1.0 delamanid
fgd1 491620 p.Ile280Val missense_variant 1.0 delamanid
fgd1 491643 c.861G>C synonymous_variant 1.0 delamanid
fgd1 491661 c.879C>G synonymous_variant 1.0 delamanid
fgd1 491664 c.882C>G synonymous_variant 1.0 delamanid
fgd1 491666 p.Glu295Ala missense_variant 1.0 delamanid
fgd1 491672 c.890_891insCA frameshift_variant 1.0 delamanid
fgd1 491675 c.894_895delTC frameshift_variant 1.0 delamanid
fgd1 491679 p.Gln299His missense_variant 0.94 delamanid
fgd1 491684 c.902_903insC frameshift_variant 0.93 delamanid
fgd1 491687 c.906delA frameshift_variant 1.0 delamanid
fgd1 491697 c.915G>C synonymous_variant 1.0 delamanid
fgd1 491709 c.927A>G synonymous_variant 1.0 delamanid
fgd1 491712 c.930T>C synonymous_variant 0.83 delamanid
fgd1 491718 c.936A>G synonymous_variant 0.94 delamanid
fgd1 491721 c.939A>C synonymous_variant 1.0 delamanid
fgd1 491724 c.942A>C synonymous_variant 0.93 delamanid
fgd1 491727 c.945T>C synonymous_variant 0.93 delamanid
fgd1 491742 c.960T>C synonymous_variant 0.88 delamanid
fgd1 491751 c.969C>G synonymous_variant 1.0 delamanid
fgd1 491755 p.Gln325Glu missense_variant 1.0 delamanid
fgd1 491758 p.Ser326Lys missense_variant 1.0 delamanid
fgd1 491769 c.987A>G synonymous_variant 1.0 delamanid
fgd1 491776 c.994_996delTTGinsCTT synonymous_variant 0.88 delamanid
mshA 575153 c.-195C>G upstream_gene_variant 0.79 ethionamide
isoniazid
mshA 575154 c.-194_-192delGTGinsCTC upstream_gene_variant 1.0 ethionamide
isoniazid
mshA 575161 c.-187_-186delTTinsCC upstream_gene_variant 1.0 ethionamide
isoniazid
mshA 575189 c.-159G>C upstream_gene_variant 1.0 ethionamide
isoniazid
mshA 575192 c.-156A>C upstream_gene_variant 1.0 ethionamide
isoniazid
mshA 575195 c.-153C>A upstream_gene_variant 0.94 ethionamide
isoniazid
mshA 575197 c.-151_-150delTCinsCG upstream_gene_variant 1.0 ethionamide
isoniazid
mshA 575204 c.-144C>G upstream_gene_variant 0.9 ethionamide
isoniazid
mshA 575207 c.-141A>G upstream_gene_variant 0.95 ethionamide
isoniazid
mshA 575216 c.-132C>G upstream_gene_variant 0.95 ethionamide
isoniazid
mshA 575219 c.-129T>C upstream_gene_variant 1.0 ethionamide
isoniazid
mshA 575228 c.-120A>G upstream_gene_variant 1.0 ethionamide
isoniazid
mshA 575232 c.-116_-114delGGTinsAGC upstream_gene_variant 0.95 ethionamide
isoniazid
mshA 575237 c.-111C>G upstream_gene_variant 1.0 ethionamide
isoniazid Uncertain significance
mshA 575238 c.-110T>A upstream_gene_variant 1.0 ethionamide
isoniazid
mshA 575246 c.-102A>G upstream_gene_variant 1.0 ethionamide
isoniazid
mshA 575247 c.-101T>G upstream_gene_variant 0.93 ethionamide
isoniazid
mshA 575261 c.-87T>C upstream_gene_variant 1.0 ethionamide
isoniazid
mshA 575272 c.-76_-75delAGinsGC upstream_gene_variant 0.92 ethionamide
isoniazid
mshA 575276 c.-72C>G upstream_gene_variant 1.0 ethionamide
isoniazid
mshA 575277 c.-71_-70delACinsGT upstream_gene_variant 1.0 ethionamide
isoniazid
mshA 575282 c.-66C>G upstream_gene_variant 0.85 ethionamide
isoniazid Uncertain significance
mshA 575288 c.-60G>C upstream_gene_variant 0.92 ethionamide
isoniazid Uncertain significance
mshA 575290 c.-58C>A upstream_gene_variant 0.77 ethionamide
isoniazid
mshA 575291 c.-56delC upstream_gene_variant 1.0 ethionamide
isoniazid
mshA 575295 c.-52_-48delCGTGA upstream_gene_variant 1.0 ethionamide
isoniazid
mshA 575311 c.-37_-36insC upstream_gene_variant 0.9 ethionamide
isoniazid
mshA 575343 c.-5C>T upstream_gene_variant 0.71 ethionamide
isoniazid
mshA 575346 c.-2G>A upstream_gene_variant 1.0 ethionamide Uncertain significance
isoniazid Uncertain significance
mshA 575351 p.Ala2Thr missense_variant 1.0 ethionamide Uncertain significance
isoniazid Uncertain significance
mshA 575372 c.26_110delGTTCAGGGTTGATCGCCCAGCGCCGTCCGGTCCGCGGCGAGGGTGCCACCCGCTCGCGCGGCCCATCCGGGCCATCCAATCGGAA frameshift_variant 1.0 ethionamide
isoniazid
mshA 575459 p.Val38Leu missense_variant 1.0 ethionamide
isoniazid
mshA 575462 p.Ser39Pro missense_variant 0.77 ethionamide
isoniazid
mshA 575467 c.120A>T synonymous_variant 0.92 ethionamide
isoniazid
mshA 575473 c.126C>T synonymous_variant 1.0 ethionamide
isoniazid
mshA 575476 p.Asp43Glu missense_variant 1.0 ethionamide
isoniazid
mshA 575488 c.141T>C synonymous_variant 0.94 ethionamide
isoniazid
mshA 575491 c.144G>C synonymous_variant 0.94 ethionamide
isoniazid
mshA 575492 p.Leu49Val missense_variant 1.0 ethionamide
isoniazid
mshA 575503 c.156G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575512 c.165A>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 575515 c.168G>A synonymous_variant 1.0 ethionamide
isoniazid
mshA 575521 c.174A>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575527 c.180G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575536 c.189T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575542 c.195C>G synonymous_variant 0.94 ethionamide
isoniazid
mshA 575561 p.Met72Val missense_variant 1.0 ethionamide
isoniazid
mshA 575569 c.222A>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 575571 p.Ser75Thr missense_variant 0.95 ethionamide
isoniazid
mshA 575575 c.228G>C synonymous_variant 0.95 ethionamide
isoniazid
mshA 575587 c.240C>A synonymous_variant 1.0 ethionamide
isoniazid
mshA 575590 c.243T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575593 c.246G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575623 c.276C>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 575629 c.282A>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575635 c.288A>C synonymous_variant 0.95 ethionamide
isoniazid
mshA 575638 c.291T>C synonymous_variant 0.94 ethionamide
isoniazid
mshA 575641 c.294A>G synonymous_variant 0.85 ethionamide
isoniazid
mshA 575648 p.Val101Gln missense_variant 1.0 ethionamide
isoniazid
mshA 575658 p.Ala104Val missense_variant 1.0 ethionamide
isoniazid
mshA 575665 c.318G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575669 p.Leu108Val missense_variant 1.0 ethionamide
isoniazid
mshA 575689 c.342G>C synonymous_variant 0.95 ethionamide
isoniazid
mshA 575695 c.348C>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 575704 c.357T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575705 c.358T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575713 c.366G>A synonymous_variant 0.8 ethionamide
isoniazid
mshA 575719 c.372C>T synonymous_variant 0.91 ethionamide
isoniazid
mshA 575734 c.387T>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 575737 c.390T>C synonymous_variant 0.96 ethionamide
isoniazid
mshA 575746 c.399C>G synonymous_variant 0.91 ethionamide
isoniazid
mshA 575767 c.420G>A synonymous_variant 0.9 ethionamide
isoniazid
mshA 575779 c.432A>G synonymous_variant 0.96 ethionamide
isoniazid
mshA 575821 c.474G>C synonymous_variant 0.76 ethionamide
isoniazid
mshA 575824 c.477T>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 575864 c.517T>C synonymous_variant 0.92 ethionamide
isoniazid
mshA 575878 c.531A>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 575884 c.537G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575893 c.546C>G synonymous_variant 0.96 ethionamide
isoniazid
mshA 575902 c.555C>T synonymous_variant 0.83 ethionamide
isoniazid
mshA 575905 c.558G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575908 c.561A>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 575944 c.597T>C synonymous_variant 0.95 ethionamide
isoniazid
mshA 575950 c.603C>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 575953 c.606G>C synonymous_variant 0.88 ethionamide
isoniazid
mshA 575965 c.618C>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 575977 c.630G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575980 c.633T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 575984 c.637T>C synonymous_variant 0.96 ethionamide
isoniazid
mshA 576004 c.657T>C synonymous_variant 0.95 ethionamide
isoniazid
mshA 576010 c.663C>G synonymous_variant 0.81 ethionamide
isoniazid
mshA 576011 c.664A>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576017 p.Val224Leu missense_variant 0.86 ethionamide
isoniazid
mshA 576026 p.Leu227Ile missense_variant 1.0 ethionamide
isoniazid
mshA 576031 c.684T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576032 p.Gly229His missense_variant 1.0 ethionamide
isoniazid
mshA 576040 c.693T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576046 c.699A>C synonymous_variant 0.94 ethionamide
isoniazid
mshA 576047 c.700_702delCGAinsAGG synonymous_variant 0.87 ethionamide
isoniazid
mshA 576052 c.705C>T synonymous_variant 0.95 ethionamide
isoniazid
mshA 576058 c.711G>C synonymous_variant 0.95 ethionamide
isoniazid
mshA 576061 c.714C>G synonymous_variant 0.95 ethionamide
isoniazid
mshA 576070 c.723T>G synonymous_variant 0.88 ethionamide
isoniazid
mshA 576073 c.726C>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 576076 c.729T>C synonymous_variant 0.89 ethionamide
isoniazid
mshA 576079 c.732G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576091 c.744C>G synonymous_variant 0.85 ethionamide
isoniazid
mshA 576094 c.747G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576097 c.750T>C synonymous_variant 0.9 ethionamide
isoniazid
mshA 576100 c.753T>C synonymous_variant 0.95 ethionamide
isoniazid
mshA 576103 c.756G>T synonymous_variant 0.95 ethionamide
isoniazid
mshA 576109 c.762G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576124 c.777A>G synonymous_variant 0.94 ethionamide
isoniazid
mshA 576127 c.780A>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 576130 c.783A>G synonymous_variant 0.94 ethionamide
isoniazid
mshA 576133 c.786A>G synonymous_variant 0.94 ethionamide
isoniazid
mshA 576134 p.Val263Leu missense_variant 1.0 ethionamide
isoniazid
mshA 576143 p.Arg266Asp missense_variant 1.0 ethionamide
isoniazid
mshA 576146 p.Val267Ile missense_variant 1.0 ethionamide
isoniazid
mshA 576154 c.807C>G synonymous_variant 0.95 ethionamide
isoniazid
mshA 576163 c.816A>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576184 c.837A>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576193 c.846T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576197 c.850C>T synonymous_variant 0.94 ethionamide
isoniazid
mshA 576205 c.858G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576208 c.861C>T synonymous_variant 1.0 ethionamide
isoniazid
mshA 576211 c.864C>G synonymous_variant 0.88 ethionamide
isoniazid
mshA 576214 c.867G>A synonymous_variant 0.75 ethionamide
isoniazid
mshA 576215 c.868T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576233 p.Ile296Val missense_variant 0.95 ethionamide
isoniazid
mshA 576247 c.900A>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 576258 p.Ser304Thr missense_variant 0.88 ethionamide
isoniazid
mshA 576262 c.915T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576268 c.921T>C synonymous_variant 0.94 ethionamide
isoniazid
mshA 576271 c.924A>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 576281 c.934C>T synonymous_variant 1.0 ethionamide
isoniazid
mshA 576285 p.Val313Ala missense_variant 1.0 ethionamide
isoniazid
mshA 576288 p.Arg314Leu missense_variant 0.94 ethionamide
isoniazid
mshA 576292 c.945C>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 576304 c.957G>C synonymous_variant 0.94 ethionamide
isoniazid
mshA 576313 c.966T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576316 c.969A>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 576322 c.975G>C synonymous_variant 0.89 ethionamide
isoniazid
mshA 576328 c.981T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576334 c.987G>C synonymous_variant 0.91 ethionamide
isoniazid
mshA 576345 p.His333Arg missense_variant 0.94 ethionamide
isoniazid
mshA 576347 p.Thr334Pro missense_variant 1.0 ethionamide
isoniazid
mshA 576350 p.Asp335Asn missense_variant 0.88 ethionamide
isoniazid
mshA 576361 c.1014C>T synonymous_variant 0.87 ethionamide
isoniazid
mshA 576362 c.1015T>C synonymous_variant 0.93 ethionamide
isoniazid
mshA 576367 c.1020T>C synonymous_variant 0.94 ethionamide
isoniazid
mshA 576369 p.Arg341Gln missense_variant 0.88 ethionamide
isoniazid
mshA 576376 c.1029G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576377 p.Asp344Asn missense_variant 1.0 ethionamide
isoniazid
mshA 576382 c.1035G>T synonymous_variant 0.94 ethionamide
isoniazid
mshA 576400 c.1053C>T synonymous_variant 1.0 ethionamide
isoniazid
mshA 576409 c.1062G>C synonymous_variant 0.94 ethionamide
isoniazid
mshA 576421 c.1074T>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 576424 c.1077T>G synonymous_variant 0.93 ethionamide
isoniazid
mshA 576425 p.Val360Leu missense_variant 0.93 ethionamide
isoniazid
mshA 576433 c.1086C>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 576436 c.1089A>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 576448 c.1101A>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576456 p.Val370Ala missense_variant 1.0 ethionamide
isoniazid
mshA 576460 c.1113C>G synonymous_variant 0.85 ethionamide
isoniazid
mshA 576463 c.1116G>C synonymous_variant 0.92 ethionamide
isoniazid
mshA 576469 c.1122G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576481 c.1134C>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 576484 c.1137C>G synonymous_variant 1.0 ethionamide
isoniazid
mshA 576487 c.1140G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576499 c.1152G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576500 p.Ile385Val missense_variant 1.0 ethionamide
isoniazid
mshA 576518 p.Ser391Ala missense_variant 0.93 ethionamide
isoniazid
mshA 576529 p.Glu394Asp missense_variant 1.0 ethionamide
isoniazid
mshA 576534 p.Gly396Asp missense_variant 1.0 ethionamide
isoniazid
mshA 576538 p.Gln397His missense_variant 1.0 ethionamide
isoniazid
mshA 576566 c.1221_1224delGTTG frameshift_variant 1.0 ethionamide
isoniazid
mshA 576572 p.Cys409Arg missense_variant 0.85 ethionamide
isoniazid
mshA 576583 c.1236A>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576604 c.1257G>C synonymous_variant 0.83 ethionamide
isoniazid
mshA 576612 c.1266delA frameshift_variant 1.0 ethionamide
isoniazid
mshA 576615 c.1268_1269insC frameshift_variant 1.0 ethionamide
isoniazid
mshA 576628 c.1281G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576634 c.1287G>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576640 p.Glu431Asp missense_variant 0.92 ethionamide
isoniazid
mshA 576641 p.Asn432His missense_variant 0.93 ethionamide
isoniazid
mshA 576659 c.1312T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576667 c.1320T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576670 c.1323T>C synonymous_variant 0.93 ethionamide
isoniazid
mshA 576676 c.1329T>C synonymous_variant 1.0 ethionamide
isoniazid
mshA 576683 p.Gly446Arg missense_variant 1.0 ethionamide
isoniazid
mshA 576787 c.1440G>A synonymous_variant 0.91 ethionamide
isoniazid
ccsA 619697 c.-194_-192delAGGinsCGC upstream_gene_variant 1.0 capreomycin
amikacin
ccsA 619730 c.-161A>G upstream_gene_variant 0.88 capreomycin
amikacin
ccsA 619744 c.-147A>G upstream_gene_variant 1.0 capreomycin
amikacin
ccsA 619753 c.-138G>A upstream_gene_variant 0.95 capreomycin
amikacin
ccsA 619766 c.-125A>G upstream_gene_variant 1.0 capreomycin
amikacin
ccsA 619792 c.-99C>G upstream_gene_variant 1.0 capreomycin
amikacin
ccsA 619794 c.-97C>A upstream_gene_variant 1.0 capreomycin
amikacin
ccsA 619811 c.-80A>T upstream_gene_variant 1.0 capreomycin
amikacin
ccsA 619814 c.-77_-76delGGinsCA upstream_gene_variant 1.0 capreomycin
amikacin
ccsA 619826 c.-65_-64insA upstream_gene_variant 0.92 capreomycin
amikacin
ccsA 619830 c.-61_-60delGTinsAC upstream_gene_variant 0.86 capreomycin
amikacin
ccsA 619832 c.-58_-55delTTGA upstream_gene_variant 1.0 capreomycin
amikacin
ccsA 619839 c.-51delG upstream_gene_variant 1.0 capreomycin
amikacin
ccsA 619865 c.-26G>T upstream_gene_variant 1.0 capreomycin
amikacin
ccsA 619881 c.-10_-9insT upstream_gene_variant 1.0 capreomycin
amikacin
ccsA 619889 c.-2_1delGATinsAAA initiator_codon_variant 0.94 capreomycin
amikacin
ccsA 619896 c.6C>T synonymous_variant 0.94 capreomycin
amikacin
ccsA 619899 c.9G>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 619900 p.Leu4Val missense_variant 0.94 capreomycin
amikacin
ccsA 619912 p.Val8Ile missense_variant 0.94 capreomycin
amikacin
ccsA 619916 p.Gly9Glu missense_variant 0.94 capreomycin
amikacin
ccsA 619923 c.33C>G synonymous_variant 0.93 capreomycin
amikacin
ccsA 619947 c.57C>G synonymous_variant 0.83 capreomycin
amikacin
ccsA 619953 c.63C>G synonymous_variant 0.94 capreomycin
amikacin
ccsA 619969 p.Val27Ile missense_variant 0.89 capreomycin Uncertain significance
amikacin Uncertain significance
ccsA 619989 c.99G>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 619996 p.Phe36Leu missense_variant 0.94 capreomycin
amikacin
ccsA 620007 c.117T>A synonymous_variant 0.92 capreomycin
amikacin
ccsA 620011 p.Gly41Arg missense_variant 0.81 capreomycin
amikacin
ccsA 620012 c.123_124delTC frameshift_variant 0.92 capreomycin
amikacin
ccsA 620039 p.Pro50Leu missense_variant 0.8 capreomycin
amikacin
ccsA 620046 c.156A>G synonymous_variant 1.0 capreomycin
amikacin
ccsA 620047 p.Ser53Ala missense_variant 0.85 capreomycin
amikacin
ccsA 620052 c.162G>C synonymous_variant 0.79 capreomycin
amikacin
ccsA 620054 p.Ala55Gly missense_variant 0.9 capreomycin
amikacin
ccsA 620056 p.Thr56Ala missense_variant 0.92 capreomycin Uncertain significance
amikacin Uncertain significance
ccsA 620063 c.174delC frameshift_variant 0.93 capreomycin
amikacin
ccsA 620067 c.177T>G synonymous_variant 0.93 capreomycin
amikacin
ccsA 620070 c.180C>A synonymous_variant 0.88 capreomycin
amikacin
ccsA 620073 c.183T>C synonymous_variant 0.8 capreomycin
amikacin
ccsA 620076 c.187_189delATC conservative_inframe_deletion 1.0 capreomycin
amikacin
ccsA 620084 p.Ala65Val missense_variant 0.93 capreomycin
amikacin
ccsA 620089 p.Gln67Glu missense_variant 1.0 capreomycin
amikacin
ccsA 620090 c.201_202delAC frameshift_variant 1.0 capreomycin
amikacin
ccsA 620096 p.His69Arg missense_variant 1.0 capreomycin
amikacin Uncertain significance
ccsA 620104 p.Phe72Val missense_variant 1.0 capreomycin
amikacin
ccsA 620112 c.222A>G synonymous_variant 1.0 capreomycin
amikacin
ccsA 620117 p.Val76Ala missense_variant 1.0 capreomycin
amikacin
ccsA 620121 c.231G>C synonymous_variant 0.93 capreomycin
amikacin
ccsA 620124 c.234G>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620126 p.Gly79Ala missense_variant 1.0 capreomycin
amikacin
ccsA 620130 c.240G>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620139 c.249C>G synonymous_variant 1.0 capreomycin
amikacin
ccsA 620141 p.Ala84Val missense_variant 1.0 capreomycin
amikacin
ccsA 620145 c.255T>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620153 p.Ile88Thr missense_variant 1.0 capreomycin
amikacin
ccsA 620160 c.270A>G synonymous_variant 0.94 capreomycin
amikacin
ccsA 620169 c.279G>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620173 p.Val95Leu missense_variant 1.0 capreomycin
amikacin
ccsA 620198 p.Gln103Leu missense_variant 0.94 capreomycin
amikacin
ccsA 620245 c.355T>C synonymous_variant 0.93 capreomycin
amikacin
ccsA 620249 p.Ser120Cys missense_variant 0.94 capreomycin
amikacin Uncertain significance
ccsA 620254 c.364_366delCTCinsTTG synonymous_variant 0.81 capreomycin
amikacin
ccsA 620257 p.Ile123Val missense_variant 1.0 capreomycin
amikacin Uncertain significance
ccsA 620265 c.375C>G synonymous_variant 0.93 capreomycin
amikacin
ccsA 620269 p.Val127Ile missense_variant 1.0 capreomycin
amikacin Uncertain significance
ccsA 620283 c.393T>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620284 p.Ala132Pro missense_variant 0.93 capreomycin
amikacin Uncertain significance
ccsA 620288 p.Arg133Gln missense_variant 0.79 capreomycin
amikacin Uncertain significance
ccsA 620295 c.405G>C synonymous_variant 0.88 capreomycin
amikacin
ccsA 620307 c.417C>G synonymous_variant 0.93 capreomycin
amikacin
ccsA 620317 p.Val143Leu missense_variant 1.0 capreomycin
amikacin Uncertain significance
ccsA 620322 c.432G>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620340 c.450C>G synonymous_variant 0.88 capreomycin
amikacin
ccsA 620349 c.459A>G synonymous_variant 1.0 capreomycin
amikacin
ccsA 620362 p.Ala158Thr missense_variant 1.0 capreomycin
amikacin Uncertain significance
ccsA 620367 c.477T>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620373 c.483C>G synonymous_variant 0.93 capreomycin
amikacin
ccsA 620385 c.495G>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620388 c.498A>G synonymous_variant 0.94 capreomycin
amikacin
ccsA 620412 c.522T>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620415 c.525T>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620433 c.543C>G synonymous_variant 1.0 capreomycin
amikacin
ccsA 620436 c.546T>C synonymous_variant 0.88 capreomycin
amikacin
ccsA 620439 c.549T>C synonymous_variant 0.9 capreomycin
amikacin
ccsA 620445 c.555A>G synonymous_variant 1.0 capreomycin
amikacin
ccsA 620460 c.570T>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620461 p.Val191Ile missense_variant 1.0 capreomycin
amikacin Uncertain significance
ccsA 620481 c.591T>G synonymous_variant 0.89 capreomycin
amikacin
ccsA 620482 p.Val198Leu missense_variant 1.0 capreomycin
amikacin Uncertain significance
ccsA 620490 c.600A>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620495 p.Arg202Pro missense_variant 1.0 capreomycin
amikacin Uncertain significance
ccsA 620502 c.612T>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620504 c.615delG frameshift_variant 1.0 capreomycin
amikacin
ccsA 620507 c.618_619delAA frameshift_variant 1.0 capreomycin
amikacin
ccsA 620517 p.Glu209Asp missense_variant 1.0 capreomycin
amikacin Uncertain significance
ccsA 620518 p.Gly210Ser missense_variant 0.82 capreomycin
amikacin Uncertain significance
ccsA 620525 p.Leu212Pro missense_variant 1.0 capreomycin
amikacin Uncertain significance
ccsA 620529 c.639G>C synonymous_variant 0.94 capreomycin
amikacin
ccsA 620532 c.642T>G synonymous_variant 1.0 capreomycin
amikacin
ccsA 620533 p.Met215Leu missense_variant 1.0 capreomycin
amikacin Uncertain significance
ccsA 620545 p.Leu219Phe missense_variant 1.0 capreomycin
amikacin Uncertain significance
ccsA 620550 c.660C>G synonymous_variant 0.88 capreomycin
amikacin
ccsA 620553 c.663T>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620556 c.666C>G synonymous_variant 1.0 capreomycin
amikacin
ccsA 620559 c.669A>G synonymous_variant 0.95 capreomycin
amikacin
ccsA 620568 c.678C>T synonymous_variant 0.84 capreomycin
amikacin
ccsA 620569 p.Gly227Arg missense_variant 1.0 capreomycin
amikacin Uncertain significance
ccsA 620589 c.699G>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620598 c.708C>G synonymous_variant 1.0 capreomycin
amikacin
ccsA 620604 c.714C>T synonymous_variant 0.95 capreomycin
amikacin
ccsA 620607 c.717T>G synonymous_variant 1.0 capreomycin
amikacin
ccsA 620619 c.729G>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620622 c.732G>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620625 c.735A>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620631 c.741T>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620646 c.756G>A synonymous_variant 1.0 capreomycin
amikacin
ccsA 620661 c.771C>G synonymous_variant 1.0 capreomycin
amikacin
ccsA 620703 c.813G>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620710 p.Val274Ile missense_variant 1.0 capreomycin
amikacin Uncertain significance
ccsA 620718 c.828G>C synonymous_variant 0.89 capreomycin
amikacin
ccsA 620721 c.831G>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620730 c.840C>T synonymous_variant 1.0 capreomycin
amikacin
ccsA 620733 c.843G>C synonymous_variant 0.89 capreomycin
amikacin
ccsA 620734 c.844C>A synonymous_variant 0.95 capreomycin
amikacin
ccsA 620739 c.849A>G synonymous_variant 0.95 capreomycin
amikacin
ccsA 620745 c.855G>C synonymous_variant 0.91 capreomycin
amikacin
ccsA 620748 c.858T>A synonymous_variant 0.95 capreomycin
amikacin
ccsA 620778 c.888T>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620784 c.894C>G synonymous_variant 0.83 capreomycin
amikacin
ccsA 620787 c.897C>G synonymous_variant 1.0 capreomycin
amikacin
ccsA 620809 c.919C>T synonymous_variant 1.0 capreomycin
amikacin
ccsA 620829 c.939G>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620835 c.945C>G synonymous_variant 1.0 capreomycin
amikacin
ccsA 620838 c.948C>T synonymous_variant 0.94 capreomycin
amikacin
ccsA 620844 c.954C>T synonymous_variant 1.0 capreomycin
amikacin
ccsA 620847 c.957G>C synonymous_variant 1.0 capreomycin
amikacin
ccsA 620862 c.972C>T synonymous_variant 0.94 capreomycin
amikacin
rpoB 759644 c.-163T>A upstream_gene_variant 0.97 rifampicin
rpoB 759647 c.-160T>C upstream_gene_variant 1.0 rifampicin Uncertain significance
rpoB 759657 c.-150G>C upstream_gene_variant 0.92 rifampicin
rpoB 759662 c.-145C>T upstream_gene_variant 1.0 rifampicin
rpoB 759667 c.-140C>T upstream_gene_variant 0.93 rifampicin Uncertain significance
rpoB 759670 c.-137C>T upstream_gene_variant 0.81 rifampicin Uncertain significance
rpoB 759671 c.-136G>T upstream_gene_variant 0.93 rifampicin
rpoB 759672 c.-135G>C upstream_gene_variant 1.0 rifampicin
rpoB 759683 c.-124T>C upstream_gene_variant 0.93 rifampicin
rpoB 759701 c.-106A>T upstream_gene_variant 0.97 rifampicin
rpoB 759707 c.-100C>T upstream_gene_variant 0.94 rifampicin
rpoB 759715 c.-91delA upstream_gene_variant 0.96 rifampicin
rpoB 759725 c.-82A>C upstream_gene_variant 1.0 rifampicin
rpoB 759728 c.-78_-77delTA upstream_gene_variant 1.0 rifampicin
rpoB 759747 c.-60C>G upstream_gene_variant 0.92 rifampicin
rpoB 759751 c.-55_-53delGCA upstream_gene_variant 1.0 rifampicin
rpoB 759756 c.-50_-48delGCT upstream_gene_variant 1.0 rifampicin
rpoB 759761 c.-45_-41delTCTAA upstream_gene_variant 1.0 rifampicin
rpoB 759769 c.-38G>C upstream_gene_variant 0.92 rifampicin
rpoB 759771 c.-35delC upstream_gene_variant 1.0 rifampicin
rpoB 759777 c.-30T>G upstream_gene_variant 1.0 rifampicin
rpoB 759778 c.-29G>A upstream_gene_variant 0.96 rifampicin
rpoB 759785 c.-22T>C upstream_gene_variant 0.93 rifampicin
rpoB 759788 c.-19A>G upstream_gene_variant 0.93 rifampicin
rpoB 759817 p.Ser4Phe missense_variant 0.96 rifampicin
rpoB 759830 c.24A>G synonymous_variant 0.88 rifampicin
rpoB 759833 c.27A>G synonymous_variant 0.79 rifampicin
rpoB 759837 p.Ala11Thr missense_variant 0.8 rifampicin
rpoB 759850 p.Pro15Arg missense_variant 0.94 rifampicin
rpoB 759852 c.47delG frameshift_variant 1.0 rifampicin
rpoB 759871 p.Ser22Leu missense_variant 0.78 rifampicin
rpoB 759875 c.69T>C synonymous_variant 0.87 rifampicin
rpoB 759876 p.Asn24Gly missense_variant 0.73 rifampicin
rpoB 759884 c.78A>G synonymous_variant 1.0 rifampicin
rpoB 759896 c.90A>C synonymous_variant 0.95 rifampicin
rpoB 759902 c.96G>A synonymous_variant 0.87 rifampicin
rpoB 759905 c.99C>T synonymous_variant 0.83 rifampicin
rpoB 759914 c.108T>C synonymous_variant 0.96 rifampicin
rpoB 759929 c.123A>G synonymous_variant 1.0 rifampicin
rpoB 759932 c.126T>C synonymous_variant 0.97 rifampicin
rpoB 759941 c.135G>C synonymous_variant 0.96 rifampicin
rpoB 759944 c.138A>C synonymous_variant 1.0 rifampicin
rpoB 759947 c.141C>G synonymous_variant 0.94 rifampicin
rpoB 759950 c.144T>G synonymous_variant 0.97 rifampicin
rpoB 759956 c.150C>G synonymous_variant 0.93 rifampicin
rpoB 759961 p.Thr52Ile missense_variant 0.97 rifampicin
rpoB 759965 c.159T>C synonymous_variant 0.97 rifampicin
rpoB 759968 c.162G>C synonymous_variant 1.0 rifampicin
rpoB 759986 c.180T>C synonymous_variant 1.0 rifampicin
rpoB 759987 p.Ser61Ala missense_variant 1.0 rifampicin
rpoB 759992 c.186G>A synonymous_variant 0.94 rifampicin
rpoB 759995 c.189C>G synonymous_variant 0.97 rifampicin
rpoB 760001 c.195C>T synonymous_variant 0.81 rifampicin
rpoB 760004 c.198A>G synonymous_variant 0.79 rifampicin
rpoB 760005 p.Ser67Ala missense_variant 0.94 rifampicin
rpoB 760009 c.203_204insGAT disruptive_inframe_insertion 0.93 rifampicin
rpoB 760019 c.213G>C synonymous_variant 0.83 rifampicin
rpoB 760022 c.216T>C synonymous_variant 0.94 rifampicin
rpoB 760025 c.219T>C synonymous_variant 0.93 rifampicin
rpoB 760026 c.221delT frameshift_variant 1.0 rifampicin
rpoB 760030 p.Asn75Ser missense_variant 0.81 rifampicin
rpoB 760036 p.Val77Glu missense_variant 0.96 rifampicin
rpoB 760040 c.234T>C synonymous_variant 1.0 rifampicin
rpoB 760043 c.237C>G synonymous_variant 0.97 rifampicin
rpoB 760059 p.Tyr85Asp missense_variant 1.0 rifampicin
rpoB 760070 c.264T>G synonymous_variant 0.95 rifampicin
rpoB 760091 c.285G>C synonymous_variant 0.91 rifampicin
rpoB 760101 c.295T>C synonymous_variant 0.94 rifampicin
rpoB 760112 c.306T>C synonymous_variant 0.94 rifampicin
rpoB 760118 c.312T>C synonymous_variant 0.91 rifampicin
rpoB 760121 c.315T>C synonymous_variant 1.0 rifampicin
rpoB 760130 p.Asp108Glu missense_variant 1.0 rifampicin Uncertain significance
rpoB 760139 c.333A>G synonymous_variant 1.0 rifampicin
rpoB 760142 c.336C>G synonymous_variant 1.0 rifampicin
rpoB 760181 c.375T>C synonymous_variant 0.97 rifampicin
rpoB 760184 c.378A>G synonymous_variant 0.97 rifampicin
rpoB 760196 c.390C>G synonymous_variant 1.0 rifampicin
rpoB 760223 c.417T>C synonymous_variant 0.98 rifampicin
rpoB 760235 c.429T>C synonymous_variant 0.95 rifampicin
rpoB 760253 c.447T>C synonymous_variant 1.0 rifampicin
rpoB 760283 c.477G>C synonymous_variant 1.0 rifampicin
rpoB 760307 c.501T>C synonymous_variant 1.0 rifampicin
rpoB 760328 c.522G>C synonymous_variant 0.97 rifampicin
rpoB 760331 c.525G>C synonymous_variant 0.95 rifampicin
rpoB 760337 c.531C>G synonymous_variant 0.88 rifampicin
rpoB 760340 c.534G>C synonymous_variant 0.77 rifampicin
rpoB 760361 c.555T>C synonymous_variant 0.97 rifampicin
rpoB 760376 p.Asp190Glu missense_variant 0.97 rifampicin
rpoB 760406 c.600G>C synonymous_variant 0.91 rifampicin
rpoB 760418 c.612G>C synonymous_variant 1.0 rifampicin
rpoB 760424 c.618C>G synonymous_variant 0.97 rifampicin
rpoB 760430 c.624T>C synonymous_variant 1.0 rifampicin
rpoB 760475 c.669A>G synonymous_variant 1.0 rifampicin
rpoB 760481 c.675G>C synonymous_variant 0.93 rifampicin
rpoB 760484 c.678A>G synonymous_variant 0.97 rifampicin
rpoB 760522 p.Ser239Asn missense_variant 0.9 rifampicin
rpoB 760532 c.726T>C synonymous_variant 0.92 rifampicin
rpoB 760533 p.Val243Thr missense_variant 1.0